BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3829406.2.1
(673 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW678623.1|AW678623 WS1_1_B10.b1_A002 Water-stressed 1 (... 474 e-132
gb|AW678771.1|AW678771 WS1_1_B10.b2_A002 Water-stressed 1 (... 474 e-132
gb|AW678842.1|AW678842 WS1_1_B10.g1_A002 Water-stressed 1 (... 474 e-132
gb|AW925086.1|AW925086 WS1_75_C05.b1_A002 Water-stressed 1 ... 474 e-132
gb|CN127403.1|CN127403 RHOH1_22_G04.g3_A002 Acid- and alkal... 466 e-129
gb|CF770145.1|CF770145 DSBF1_6_A08.b1_A010 Drought-stressed... 456 e-126
gb|AW679610.1|AW679610 WS1_2_H02.g1_A002 Water-stressed 1 (... 454 e-126
gb|AW676977.1|AW676977 DG1_3_G07.b1_A002 Dark Grown 1 (DG1)... 440 e-122
gb|CF770225.1|CF770225 DSBF1_6_A08.g1_A010 Drought-stressed... 434 e-120
gb|BG158686.1|BG158686 RHIZ2_43_H08.g1_A003 Rhizome2 (RHIZ2... 408 e-112
gb|AW679603.1|AW679603 WS1_2_F03.g1_A002 Water-stressed 1 (... 383 e-104
gb|CL189874.1|CL189874 104_407_10905681_116_32481_039 Sorgh... 377 e-103
gb|DN552426.1|DN552426 pSHR-L_D04_C047 pSHR Sorghum halepen... 377 e-103
gb|AW678554.1|AW678554 WS1_16_H02.g1_A002 Water-stressed 1 ... 375 e-102
gb|CW217934.1|CW217934 104_651_11195919_148_37457_058 Sorgh... 345 3e-093
gb|CF758680.1|CF758680 DSAF1_35_D02.g1_A011 Drought-stresse... 331 5e-089
gb|AW747533.1|AW747533 WS1_73_A02.g1_A002 Water-stressed 1 ... 309 2e-082
gb|CL189873.1|CL189873 104_407_10905681_114_32477_039 Sorgh... 291 4e-077
gb|CW323285.1|CW323285 104_817_11476551_116_35961_058 Sorgh... 278 6e-073
gb|AW924906.1|AW924906 WS1_73_A02.b1_A002 Water-stressed 1 ... 266 2e-069
gb|BG933472.1|BG933472 WS1_2_H02.b1_A002 Water-stressed 1 (... 242 3e-062
gb|BE592190.1|BE592190 WS1_89_E11.g1_A002 Water-stressed 1 ... 232 3e-059
gb|AI724747.1|AI724747 RHIZ1_26_F01.y2_A001 Rhizome1 (RHIZ1... 143 2e-032
gb|BE592489.1|BE592489 WS1_89_E11.b1_A002 Water-stressed 1 ... 141 9e-032
gb|AW677825.1|AW677825 WS1_11_A03.b1_A002 Water-stressed 1 ... 119 3e-025
gb|AW746072.1|AW746072 WS1_39_E07.b1_A002 Water-stressed 1 ... 119 3e-025
gb|AW746156.1|AW746156 WS1_39_E07.g1_A002 Water-stressed 1 ... 119 3e-025
gb|BE357065.1|BE357065 DG1_146_B06.g1_A002 Dark Grown 1 (DG... 119 3e-025
gb|BE361787.1|BE361787 DG1_82_D08.b1_A002 Dark Grown 1 (DG1... 119 3e-025
gb|BE361845.1|BE361845 DG1_82_D08.g1_A002 Dark Grown 1 (DG1... 119 3e-025
gb|BE592322.1|BE592322 WS1_93_C05.g1_A002 Water-stressed 1 ... 119 3e-025
gb|BM328467.1|BM328467 PIC1_29_F01.g1_A002 Pathogen-infecte... 119 3e-025
gb|CX607163.1|CX607163 ANR1_7_C01.b1_A002 Anaerobic roots S... 119 3e-025
gb|CX607254.1|CX607254 ANR1_7_C01.g1_A002 Anaerobic roots S... 119 3e-025
gb|BE356984.1|BE356984 DG1_146_B06.b1_A002 Dark Grown 1 (DG... 103 2e-020
gb|CL191658.1|CL191658 104_410_10906963_114_32532_066 Sorgh... 101 8e-020
gb|CL178425.1|CL178425 104_386_10894579_148_31911_259 Sorgh... 80 3e-013
gb|CW436887.1|CW436887 fsbb001f153l16k0 Sorghum methylation... 80 3e-013
gb|AW679561.1|AW679561 WS1_2_E01.g1_A002 Water-stressed 1 (... 80 3e-013
gb|AW746460.1|AW746460 WS1_53_D10.b1_A002 Water-stressed 1 ... 80 3e-013
gb|BG933440.1|BG933440 WS1_2_E01.b1_A002 Water-stressed 1 (... 80 3e-013
gb|CF757574.1|CF757574 DSAF1_19_F06.g1_A011 Drought-stresse... 80 3e-013
gb|CF771096.1|CF771096 DSBF1_13_H05.g1_A010 Drought-stresse... 80 3e-013
gb|CL191659.1|CL191659 104_410_10906963_116_32536_066 Sorgh... 78 1e-012
gb|CF758510.1|CF758510 DSAF1_32_H01.g1_A011 Drought-stresse... 74 2e-011
gb|CF757475.1|CF757475 DSAF1_18_D05.g1_A011 Drought-stresse... 66 4e-009
gb|CF757998.1|CF757998 DSAF1_26_A05.g1_A011 Drought-stresse... 66 4e-009
gb|CF759184.1|CF759184 DSAF1_42_A05.b1_A011 Drought-stresse... 62 7e-008
gb|CF769999.1|CF769999 DSBF1_5_C09.b1_A010 Drought-stressed... 62 7e-008
gb|CF770084.1|CF770084 DSBF1_5_C09.g1_A010 Drought-stressed... 62 7e-008
gb|CF772899.1|CF772899 DSBF1_40_G04.g1_A010 Drought-stresse... 62 7e-008
gb|CF759848.1|CF759848 DSAF1_52_A11.b1_A011 Drought-stresse... 54 2e-005
gb|BE592221.1|BE592221 WS1_90_A02.g1_A002 Water-stressed 1 ... 50 3e-004
gb|BE592753.1|BE592753 WS1_90_A02.b1_A002 Water-stressed 1 ... 50 3e-004
gb|CW126781.1|CW126781 104_507_11113080_116_34733_086 Sorgh... 42 0.065
gb|CW286159.1|CW286159 104_763_11410733_116_35511_019 Sorgh... 42 0.065
>gb|AW678623.1|AW678623 WS1_1_B10.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 615
Score = 474 bits (239), Expect = e-132
Identities = 346/378 (91%), Gaps = 4/378 (1%)
Strand = Plus / Minus
Query: 205 cacacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacgga 263
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 491 cacacacacactgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacgga 432
Query: 264 tcatgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgcac 322
|||||||| ||||||||| | |||||| ||||||||||||||||||||||||||||
Sbjct: 431 tcatgcactggtgctcaagtaagctctcaa--agctcatggcagagtgtaatctccgcac 374
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
|||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 373 ttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacctcg 314
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
| ||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||
Sbjct: 313 gccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggcacttgggg 254
Query: 443 ctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgggg 502
||||||||||||||| |||||||||| |||||||| | |||| ||||| ||||| |||
Sbjct: 253 ctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggatggcgcggagctcggg 194
Query: 503 ttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 562
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 193 ttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 134
Query: 563 ccgcactcgcccgcgccg 580
||||||||||||||||||
Sbjct: 133 ccgcactcgcccgcgccg 116
Score = 61.9 bits (31), Expect = 7e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 131 tgagacactcatatcacactggacttccacatgtatggtaatcacaa 177
|||||||| | ||||| |||||| |||||||||||||||||||||||
Sbjct: 559 tgagacacccgtatcatactggagttccacatgtatggtaatcacaa 513
>gb|AW678771.1|AW678771 WS1_1_B10.b2_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 598
Score = 474 bits (239), Expect = e-132
Identities = 346/378 (91%), Gaps = 4/378 (1%)
Strand = Plus / Minus
Query: 205 cacacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacgga 263
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 491 cacacacacactgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacgga 432
Query: 264 tcatgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgcac 322
|||||||| ||||||||| | |||||| ||||||||||||||||||||||||||||
Sbjct: 431 tcatgcactggtgctcaagtaagctctcaa--agctcatggcagagtgtaatctccgcac 374
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
|||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 373 ttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacctcg 314
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
| ||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||
Sbjct: 313 gccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggcacttgggg 254
Query: 443 ctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgggg 502
||||||||||||||| |||||||||| |||||||| | |||| ||||| ||||| |||
Sbjct: 253 ctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggatggcgcggagctcggg 194
Query: 503 ttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 562
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 193 ttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 134
Query: 563 ccgcactcgcccgcgccg 580
||||||||||||||||||
Sbjct: 133 ccgcactcgcccgcgccg 116
Score = 61.9 bits (31), Expect = 7e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 131 tgagacactcatatcacactggacttccacatgtatggtaatcacaa 177
|||||||| | ||||| |||||| |||||||||||||||||||||||
Sbjct: 559 tgagacacccgtatcatactggagttccacatgtatggtaatcacaa 513
>gb|AW678842.1|AW678842 WS1_1_B10.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 659
Score = 474 bits (239), Expect = e-132
Identities = 346/378 (91%), Gaps = 4/378 (1%)
Strand = Plus / Minus
Query: 205 cacacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacgga 263
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 491 cacacacacactgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacgga 432
Query: 264 tcatgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgcac 322
|||||||| ||||||||| | |||||| ||||||||||||||||||||||||||||
Sbjct: 431 tcatgcactggtgctcaagtaagctctcaa--agctcatggcagagtgtaatctccgcac 374
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
|||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 373 ttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacctcg 314
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
| ||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||
Sbjct: 313 gccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggcacttgggg 254
Query: 443 ctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgggg 502
||||||||||||||| |||||||||| |||||||| | |||| ||||| ||||| |||
Sbjct: 253 ctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggatggcgcggagctcggg 194
Query: 503 ttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 562
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 193 ttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 134
Query: 563 ccgcactcgcccgcgccg 580
||||||||||||||||||
Sbjct: 133 ccgcactcgcccgcgccg 116
Score = 73.8 bits (37), Expect = 2e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 45 acaagttttatttcgaggatgcaggacagcatctctggaac 85
||||||||||||| |||||||||||||||||||||||||||
Sbjct: 651 acaagttttatttggaggatgcaggacagcatctctggaac 611
Score = 61.9 bits (31), Expect = 7e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 131 tgagacactcatatcacactggacttccacatgtatggtaatcacaa 177
|||||||| | ||||| |||||| |||||||||||||||||||||||
Sbjct: 559 tgagacacccgtatcatactggagttccacatgtatggtaatcacaa 513
>gb|AW925086.1|AW925086 WS1_75_C05.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 509
Score = 474 bits (239), Expect = e-132
Identities = 346/378 (91%), Gaps = 4/378 (1%)
Strand = Plus / Minus
Query: 205 cacacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacgga 263
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 505 cacacacacactgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacgga 446
Query: 264 tcatgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgcac 322
|||||||| ||||||||| | |||||| ||||||||||||||||||||||||||||
Sbjct: 445 tcatgcactggtgctcaagtaagctctcaa--agctcatggcagagtgtaatctccgcac 388
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
|||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 387 ttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacctcg 328
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
| ||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||
Sbjct: 327 gccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggcacttgggg 268
Query: 443 ctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgggg 502
||||||||||||||| |||||||||| |||||||| | |||| ||||| ||||| |||
Sbjct: 267 ctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggatggcgcggagctcggg 208
Query: 503 ttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 562
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 207 ttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 148
Query: 563 ccgcactcgcccgcgccg 580
||||||||||||||||||
Sbjct: 147 ccgcactcgcccgcgccg 130
>gb|CN127403.1|CN127403 RHOH1_22_G04.g3_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_22_G04_A002 5', mRNA sequence
Length = 684
Score = 466 bits (235), Expect = e-129
Identities = 345/378 (91%), Gaps = 4/378 (1%)
Strand = Plus / Minus
Query: 205 cacacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacgga 263
|||||| ||| |||||| ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 488 cacacacacattgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacgga 429
Query: 264 tcatgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgcac 322
|||||||| ||||||||| | |||||| ||||||||||||||||||||||||||||
Sbjct: 428 tcatgcactggtgctcaagtaagctctcaa--agctcatggcagagtgtaatctccgcac 371
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
|||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 370 ttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacctcg 311
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
| ||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||
Sbjct: 310 gccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggcacttgggg 251
Query: 443 ctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgggg 502
||||||||||||||| |||||||||| |||||||| | |||| ||||| ||||| |||
Sbjct: 250 ctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggatggcgcggagctcggg 191
Query: 503 ttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 562
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 190 ttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 131
Query: 563 ccgcactcgcccgcgccg 580
||||||||||||||||||
Sbjct: 130 ccgcactcgcccgcgccg 113
Score = 69.9 bits (35), Expect = 3e-010
Identities = 47/51 (92%)
Strand = Plus / Minus
Query: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaac 85
|||||||| |||||||| |||| |||||||||||||||||||||||||||
Sbjct: 658 gtccaagacaacaagtttcatttggaggatgcaggacagcatctctggaac 608
Score = 61.9 bits (31), Expect = 7e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 131 tgagacactcatatcacactggacttccacatgtatggtaatcacaa 177
|||||||| | ||||| |||||| |||||||||||||||||||||||
Sbjct: 556 tgagacacccgtatcatactggagttccacatgtatggtaatcacaa 510
>gb|CF770145.1|CF770145 DSBF1_6_A08.b1_A010 Drought-stressed before flowering Sorghum
bicolor cDNA clone DSBF1_6_A08_A010 5', mRNA sequence
Length = 491
Score = 456 bits (230), Expect = e-126
Identities = 347/380 (91%), Gaps = 7/380 (1%)
Strand = Plus / Minus
Query: 206 acacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactc-cgacgga 263
||||| |||||||||| || |||||||||||| | |||||||||||||||| |||||||
Sbjct: 485 acacagacactgacacagttaccgtcacttcccacagacgtcgtgctaactctcgacgga 426
Query: 264 tca--tgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgc 320
||| ||||| ||||||||| | |||||||| ||||||||||||||||||||||||||
Sbjct: 425 tcacatgcactggtgctcaagtaagctctcgc--agctcatggcagagtgtaatctccgc 368
Query: 321 acttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacct 380
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 367 acttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacct 308
Query: 381 cgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggg 440
||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||
Sbjct: 307 cggccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggcacttgg 248
Query: 441 ggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgg 500
||||||||||||||||| |||||||||| |||||||| | |||||||||| ||||| |
Sbjct: 247 ggctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggacggcgcggagctcg 188
Query: 501 ggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcg 560
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 187 ggttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcg 128
Query: 561 ccccgcactcgcccgcgccg 580
||||||||||||||||||||
Sbjct: 127 ccccgcactcgcccgcgccg 108
>gb|AW679610.1|AW679610 WS1_2_H02.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 548
Score = 454 bits (229), Expect = e-126
Identities = 343/378 (90%), Gaps = 4/378 (1%)
Strand = Plus / Minus
Query: 205 cacacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacgga 263
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 380 cacacacacactgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacgga 321
Query: 264 tcatgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgcac 322
|||||||| ||||||||| | |||||| ||||||||||||||||||||||||||||
Sbjct: 320 tcatgcactggtgctcaagtaagctctcaa--agctcatggcagagtgtaatctccgcac 263
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
|||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 262 ttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacctcg 203
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
| ||||||||||| ||||||| ||||||||||||||||||||||| ||||||| ||||
Sbjct: 202 gccttgatcccggcgctcttggcggtcttggacagcatgacggcgcaaaggcacttgggg 143
Query: 443 ctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgggg 502
||||||||||||||| |||||||||| |||||||| | |||| ||||| ||||| |||
Sbjct: 142 ctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggatggcgcggagctcggg 83
Query: 503 ttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcgcc 562
||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct: 82 ttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcggngtngcc 23
Query: 563 ccgcactcgcccgcgccg 580
||||||||||||||||||
Sbjct: 22 ccgcactcgcccgcgccg 5
Score = 73.8 bits (37), Expect = 2e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 45 acaagttttatttcgaggatgcaggacagcatctctggaac 85
||||||||||||| |||||||||||||||||||||||||||
Sbjct: 540 acaagttttatttggaggatgcaggacagcatctctggaac 500
Score = 61.9 bits (31), Expect = 7e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 131 tgagacactcatatcacactggacttccacatgtatggtaatcacaa 177
|||||||| | ||||| |||||| |||||||||||||||||||||||
Sbjct: 448 tgagacacccgtatcatactggagttccacatgtatggtaatcacaa 402
>gb|AW676977.1|AW676977 DG1_3_G07.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 469
Score = 440 bits (222), Expect = e-122
Identities = 313/341 (91%), Gaps = 3/341 (0%)
Strand = Plus / Minus
Query: 241 gacgtcgtgctaactccgacggatcatgcacatgtgctcaagca-gctctcgcgcagctc 299
||||||||||||||||||||||||||||||| ||||||||| | |||||| |||||
Sbjct: 462 gacgtcgtgctaactccgacggatcatgcactggtgctcaagtaagctctcaa--agctc 405
Query: 300 atggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgct 359
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
Sbjct: 404 atggcagagtgtactctccgcacttgtagccgatggggcggtcgacgaggttgcagcgtt 345
Query: 360 tggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagca 419
|||||||||||||||| ||||||| ||||||||||| ||||||| |||||||||||||
Sbjct: 344 tggggatggtgatggcgacctcggccttgatcccggcgctcttggcggtcttggacagca 285
Query: 420 tgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||
Sbjct: 284 tgacggcgcagaggcacttggggctctgcttcccgatgctgtgcaccgcgctgcagcagg 225
Query: 480 cgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcg 539
| |||| ||||| ||||| |||||||||||||| |||||||||||||||||||||||||
Sbjct: 224 agctggatggcgcggagctcgggttctgcgccgccgacgcgcacggcgccagcttcagcg 165
Query: 540 ccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580
|||||||||||||||||||||||||||||||||||||||||
Sbjct: 164 ccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 124
>gb|CF770225.1|CF770225 DSBF1_6_A08.g1_A010 Drought-stressed before flowering Sorghum
bicolor cDNA clone DSBF1_6_A08_A010 3', mRNA sequence
Length = 577
Score = 434 bits (219), Expect = e-120
Identities = 346/381 (90%), Gaps = 8/381 (2%)
Strand = Plus / Minus
Query: 206 acacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactc-cgacgga 263
||||| |||||||||| || |||| ||||||| | |||||||||||||||| |||||||
Sbjct: 416 acacagacactgacacagttaccgacacttcccacagacgtcgtgctaactctcgacgga 357
Query: 264 tca--tgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgc 320
||| ||||| ||||||||| | |||||||| ||||||||||||||||||||||||||
Sbjct: 356 tcacatgcactggtgctcaagtaagctctcgc--agctcatggcagagtgtaatctccgc 299
Query: 321 acttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacct 380
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 298 acttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacct 239
Query: 381 cgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggg 440
||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||
Sbjct: 238 cggccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggcacttgg 179
Query: 441 ggctctgcttcccgatggtgtgcaccgccgtgcagca-gccgttggacggcgccgagctg 499
||||||||||||||||| |||||||||| ||||||| | | |||||||||| |||||
Sbjct: 178 ggctctgcttcccgatgctgtgcaccgcgctgcagcagggagctggacggcgcggagctc 119
Query: 500 gggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtc 559
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118 gggttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtc 59
Query: 560 gccccgcactcgcccgcgccg 580
|||||||||||||||||||||
Sbjct: 58 gccccgcactcgcccgcgccg 38
Score = 73.8 bits (37), Expect = 2e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 45 acaagttttatttcgaggatgcaggacagcatctctggaac 85
||||||||||||| |||||||||||||||||||||||||||
Sbjct: 570 acaagttttatttggaggatgcaggacagcatctctggaac 530
>gb|BG158686.1|BG158686 RHIZ2_43_H08.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 501
Score = 408 bits (206), Expect = e-112
Identities = 326/360 (90%), Gaps = 7/360 (1%)
Strand = Plus / Minus
Query: 206 acacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactc-cgacgga 263
||||| |||||||||| ||||||||||||||| | |||||||||||||||| |||||||
Sbjct: 360 acacagacactgacacagtcaccgtcacttcccacagacgtcgtgctaactctcgacgga 301
Query: 264 t--catgcacatgtgctcaag-cagctctcgcgcagctcatggcagagtgtaatctccgc 320
| ||||||| ||||||||| || ||| |||||||||||||||||||||||||||||
Sbjct: 300 tcacatgcactggtgctcaagtaagatct--cgcagctcatggcagagtgtaatctccgc 243
Query: 321 acttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacct 380
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 242 acttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacct 183
Query: 381 cgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggg 440
||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||
Sbjct: 182 cggccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggcacttgg 123
Query: 441 ggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgg 500
||||||||||||||||| |||||||||| |||||||| | |||||||||| ||||| |
Sbjct: 122 ggctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggacggcgcggagctcg 63
Query: 501 ggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgtcg 560
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 62 ggttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcggggtcg 3
Score = 46.1 bits (23), Expect = 0.004
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 59 gaggatgcaggacagcatctctggaac 85
||||||||| |||||||||||||||||
Sbjct: 497 gaggatgcatgacagcatctctggaac 471
>gb|AW679603.1|AW679603 WS1_2_F03.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 658
Score = 383 bits (193), Expect = e-104
Identities = 262/285 (91%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 406 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 347
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
|| ||||||||||||||||| ||||| | ||||||||||| ||||||| || ||||||
Sbjct: 346 cgtttggggatggtgatggcgacctcagccttgatcccggcgctcttggcagtgttggac 287
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||
Sbjct: 286 agcatgacggcgcagaggcacttggggctctgcttcccgatgctgtgcaccgcgccgcag 227
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
||| | | |||||||| |||||||||| || |||||| |||||||||||||||||||||
Sbjct: 226 caggagctagacggcgcggagctggggtcctccgccgccgacgcgcacggcgccagcttc 167
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580
||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 166 agcgccatcatgtccggcggcgtcgccccgcactcgcccgcgccg 122
>gb|CL189874.1|CL189874 104_407_10905681_116_32481_039 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10905681, DNA
sequence
Length = 712
Score = 377 bits (190), Expect = e-103
Identities = 247/266 (92%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||
Sbjct: 220 ctccgcacttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatgg 279
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||
Sbjct: 280 cgacctcggccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggc 339
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||| |||||||||| |||||||| | |||| ||||| |
Sbjct: 340 acttggggctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggatggcgcgg 399
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 400 agctcgggttctgcgccgccgacgcgcacggcgccagcttcagcgccatcctgtccggcg 459
Query: 555 gcgtcgccccgcactcgcccgcgccg 580
||||||||||||||||||||||||||
Sbjct: 460 gcgtcgccccgcactcgcccgcgccg 485
Score = 93.7 bits (47), Expect = 2e-017
Identities = 94/106 (88%), Gaps = 4/106 (3%)
Strand = Plus / Plus
Query: 213 cactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacggatcatgcac 271
||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||
Sbjct: 1 cactgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacggatcatgcac 60
Query: 272 atgtgctcaag-cagctctcgcgcagctcatggcagagtgtaatct 316
||||||||| |||||| | ||||||||||||||||||||||
Sbjct: 61 tggtgctcaagtaagctct--caaagctcatggcagagtgtaatct 104
>gb|DN552426.1|DN552426 pSHR-L_D04_C047 pSHR Sorghum halepense cDNA, mRNA sequence
Length = 669
Score = 377 bits (190), Expect = e-103
Identities = 259/282 (91%)
Strand = Plus / Plus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 326
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
|| ||||||||||||||||| ||||| | ||||||||||| ||||||| || ||||||
Sbjct: 327 cgtttggggatggtgatggcgacctcagccttgatcccggcgctcttggcggtgttggac 386
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||| ||||| ||||||| ||||||||||||||||||| |||||||||| |||||
Sbjct: 387 agcatgacagcgcacaggcacttggggctctgcttcccgatgctgtgcaccgcgctgcag 446
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
||| | |||||||||| |||||||||| || |||||| |||||||||||||||||||||
Sbjct: 447 caggagctggacggcgcagagctggggtcctccgccgccgacgcgcacggcgccagcttc 506
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcg 577
||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 507 agcgccatcatgtccggcggcgtcgccccgcactcgcccgcg 548
>gb|AW678554.1|AW678554 WS1_16_H02.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 549
Score = 375 bits (189), Expect = e-102
Identities = 261/285 (91%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 308 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 249
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
|| ||||||||||||||||| ||||| | ||||||||||| ||||||| || ||||||
Sbjct: 248 cgtttggggatggtgatggcgacctcagccttgatcccggcgctcttggcagtgttggac 189
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||
Sbjct: 188 agcatgacggcgcagaggcacttggggctctgcttcccgatgctgtgcaccgcgccgcag 129
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
||| | | |||||||| |||||||||| || |||||| ||||||||||| |||||||||
Sbjct: 128 caggagctagacggcgcggagctggggtcctccgccgccgacgcgcacggggccagcttc 69
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580
||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 68 agcgccatcatgtccggcggcgtcgccccgcactcgcccgcgccg 24
>gb|CW217934.1|CW217934 104_651_11195919_148_37457_058 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11195919, DNA
sequence
Length = 624
Score = 345 bits (174), Expect = 3e-093
Identities = 243/266 (91%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 85 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgtttggggatggtgatgg 144
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| | ||||||||||| ||||||| || |||||||||||||||||||||||||
Sbjct: 145 cgacctcagccttgatcccggcgctcttggcagtgttggacagcatgacggcgcagaggc 204
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||| |||||||||| ||||||| | | |||||||| |
Sbjct: 205 acttggggctctgcttcccgatgctgtgcaccgcgccgcagcaggagctagacggcgcgg 264
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
||||||||| || |||||| |||||||||||||||||||||||||||||| |||||||||
Sbjct: 265 agctggggtcctccgccgccgacgcgcacggcgccagcttcagcgccatcatgtccggcg 324
Query: 555 gcgtcgccccgcactcgcccgcgccg 580
||||||||||||||||||||||||||
Sbjct: 325 gcgtcgccccgcactcgcccgcgccg 350
>gb|CF758680.1|CF758680 DSAF1_35_D02.g1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_35_D02_A011 3', mRNA sequence
Length = 477
Score = 331 bits (167), Expect = 5e-089
Identities = 281/313 (89%), Gaps = 7/313 (2%)
Strand = Plus / Minus
Query: 206 acacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactc-cgacgga 263
||||| |||||||||| || |||||||||||| | |||||||||||||||| |||||||
Sbjct: 313 acacagacactgacacagttaccgtcacttcccacagacgtcgtgctaactctcgacgga 254
Query: 264 tca--tgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgc 320
||| ||||| ||||||||| | |||||||| ||||||||||||||||||||||||||
Sbjct: 253 tcacatgcactggtgctcaagtaagctctcgc--agctcatggcagagtgtaatctccgc 196
Query: 321 acttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacct 380
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 195 acttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacct 136
Query: 381 cgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggg 440
||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||
Sbjct: 135 cggccttgatcccggcgctcttggcggtcttggacagcatgacggcgcagaggcacttgg 76
Query: 441 ggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctgg 500
||||||||||||||||| |||||||||| |||||||| | |||||||||| ||||| |
Sbjct: 75 ggctctgcttcccgatgctgtgcaccgcgctgcagcaggagctggacggcgcggagctcg 16
Query: 501 ggttctgcgccgc 513
|||||||||||||
Sbjct: 15 ggttctgcgccgc 3
Score = 73.8 bits (37), Expect = 2e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 45 acaagttttatttcgaggatgcaggacagcatctctggaac 85
||||||||||||| |||||||||||||||||||||||||||
Sbjct: 467 acaagttttatttggaggatgcaggacagcatctctggaac 427
>gb|AW747533.1|AW747533 WS1_73_A02.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 470
Score = 309 bits (156), Expect = 2e-082
Identities = 248/275 (90%), Gaps = 4/275 (1%)
Strand = Plus / Minus
Query: 205 cacacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacgga 263
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 300 cacacacacactgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacgga 241
Query: 264 tcatgcacatgtgctcaagca-gctctcgcgcagctcatggcagagtgtaatctccgcac 322
|||||||| ||||||||| | |||||| ||||||||||||||||||||||||||||
Sbjct: 240 tcatgcactggtgctcaagtaagctctcaa--agctcatggcagagtgtaatctccgcac 183
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
|||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 182 ttgtagccgatggggcggtcgacgaggttgcagcgtttggggatggtgatggcgacctcg 123
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
| ||||||||||| ||||||| ||||||||||||||||||||||| | ||||| ||||
Sbjct: 122 gccttgatcccggcgctcttggcggtcttggacagcatgacggcgcaaaagcacttgggg 63
Query: 443 ctctgcttcccgatggtgtgcaccgccgtgcagca 477
||||||||||||||| |||||||||| |||||||
Sbjct: 62 ctctgcttcccgatgctgtgcaccgcgctgcagca 28
Score = 73.8 bits (37), Expect = 2e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 45 acaagttttatttcgaggatgcaggacagcatctctggaac 85
||||||||||||| |||||||||||||||||||||||||||
Sbjct: 460 acaagttttatttggaggatgcaggacagcatctctggaac 420
Score = 61.9 bits (31), Expect = 7e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 131 tgagacactcatatcacactggacttccacatgtatggtaatcacaa 177
|||||||| | ||||| |||||| |||||||||||||||||||||||
Sbjct: 368 tgagacacccgtatcatactggagttccacatgtatggtaatcacaa 322
>gb|CL189873.1|CL189873 104_407_10905681_114_32477_039 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10905681, DNA
sequence
Length = 708
Score = 291 bits (147), Expect = 4e-077
Identities = 201/219 (91%)
Strand = Plus / Minus
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| || |||| ||||||||||| ||||||| |||||||||||||||
Sbjct: 708 gggatggtgatggcgacttcggccttgatcccggcgctcttggcggtcttggacagcatg 649
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||||||||||| ||||||||||||||||||| |||||||||| |||||||| |
Sbjct: 648 acggcgcagaggcacttggggctctgcttcccgatgctgtgcaccgcgctgcagcaggag 589
Query: 482 ttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgcc 541
|||| ||||| ||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 588 ctggatggcgcggagctcgggttctgcgccgccgacgcgcacggcgccagcttcagcgcc 529
Query: 542 atcctgtccggcggcgtcgccccgcactcgcccgcgccg 580
|||||||||||||||||||||||||||||||||||||||
Sbjct: 528 atcctgtccggcggcgtcgccccgcactcgcccgcgccg 490
>gb|CW323285.1|CW323285 104_817_11476551_116_35961_058 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11476551, DNA
sequence
Length = 571
Score = 278 bits (140), Expect = 6e-073
Identities = 215/240 (89%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 332 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgtttggggatggtgatgg 391
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| | ||||||||||| ||||||| || |||||||||||||||||||||||||
Sbjct: 392 cgacctcagccttgatcccggcgctcttggcagtgttggacagcatgacggcgcagaggc 451
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||| |||||||||| ||| || | | |||||||| |
Sbjct: 452 acttggggctctgcttcccgatgctgtgcaccgcgccgcaacatgagctagacggcgcgg 511
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
||||||||| || |||||| |||||||||||||||||||||||||||||| |||||||||
Sbjct: 512 agctggggtcctccgccgccgacgcgcacggcgccagcttcagcgccatcatgtccggcg 571
Score = 42.1 bits (21), Expect = 0.065
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 296 gctcatggcagagtgtaatct 316
|||||||||||||||||||||
Sbjct: 153 gctcatggcagagtgtaatct 173
>gb|AW924906.1|AW924906 WS1_73_A02.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 309
Score = 266 bits (134), Expect = 2e-069
Identities = 170/182 (93%)
Strand = Plus / Minus
Query: 399 tcttggccgtcttggacagcatgacggcgcagaggcactgggggctctgcttcccgatgg 458
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 305 tcttggcggtcttggacagcatgacggcgcagaggcacttggggctctgcttcccgatgc 246
Query: 459 tgtgcaccgccgtgcagcagccgttggacggcgccgagctggggttctgcgccgcggacg 518
|||||||||| |||||||| | |||| ||||| ||||| |||||||||||||| ||||
Sbjct: 245 tgtgcaccgcgctgcagcaggagctggatggcgcggagctcgggttctgcgccgccgacg 186
Query: 519 cgcacggcgccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgcccgcgc 578
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 185 cgcacggcgccagcttcagcgccatcctgtccggcggcgtcgccccgcactcgcccgcgc 126
Query: 579 cg 580
||
Sbjct: 125 cg 124
>gb|BG933472.1|BG933472 WS1_2_H02.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 296
Score = 242 bits (122), Expect = 3e-062
Identities = 155/166 (93%)
Strand = Plus / Minus
Query: 415 cagcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgca 474
||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||
Sbjct: 296 cagcatgacggcgcagaggcacttggggctctgcttcccgatgctgtgcaccgcgctgca 237
Query: 475 gcagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagctt 534
|||| | |||| ||||| ||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 236 gcaggagctggatggcgcggagctcgggttctgcgccgccgacgcgcacggcgccagctt 177
Query: 535 cagcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 580
||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176 cagcgccatcctgtccggcggcgtcgccccgcactcgcccgcgccg 131
>gb|BE592190.1|BE592190 WS1_89_E11.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 250
Score = 232 bits (117), Expect = 3e-059
Identities = 159/173 (91%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 178 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggacgacgaggttgcag 119
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
|| ||||||||||||||||| ||||| | ||||||||||| ||||||| || ||||||
Sbjct: 118 cgtttggggatggtgatggcgacctcagccttgatcccggcgctcttggcagtgttggac 59
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgc 468
|||||||||||||||||||||| ||||||||| || |||||| ||||||||||
Sbjct: 58 agcatgacggcgcagaggcacttggggctctggttaccgatgctgtgcaccgc 6
>gb|AI724747.1|AI724747 RHIZ1_26_F01.y2_A001 Rhizome1 (RHIZ1) Sorghum halepense cDNA, mRNA
sequence
Length = 339
Score = 143 bits (72), Expect = 2e-032
Identities = 78/80 (97%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 91 gctcatggcagagtgtaatctccgcacttgtagcccacggggcggtcgacgaggttgcag 32
Query: 356 cgcttggggatggtgatggc 375
|| |||||||||||||||||
Sbjct: 31 cgtttggggatggtgatggc 12
>gb|BE592489.1|BE592489 WS1_89_E11.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 182
Score = 141 bits (71), Expect = 9e-032
Identities = 83/87 (95%)
Strand = Plus / Minus
Query: 494 gagctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggc 553
|||||||||| || |||||| |||||||||||||||||||||||||||||| ||||||||
Sbjct: 179 gagctggggtcctccgccgccgacgcgcacggcgccagcttcagcgccatcatgtccggc 120
Query: 554 ggcgtcgccccgcactcgcccgcgccg 580
|||||||||||||||||||||||||||
Sbjct: 119 ggcgtcgccccgcactcgcccgcgccg 93
>gb|AW677825.1|AW677825 WS1_11_A03.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 504
Score = 119 bits (60), Expect = 3e-025
Identities = 149/178 (83%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 440 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 381
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| ||||| ||||||||||| | | |||| || ||||||||||
Sbjct: 380 gggatggtaatggcgacctccggcttgatcccagcagccctggcggtgccggacagcatg 321
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 320 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 266
>gb|AW746072.1|AW746072 WS1_39_E07.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 501
Score = 119 bits (60), Expect = 3e-025
Identities = 149/178 (83%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 437 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 378
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| ||||| ||||||||||| | | |||| || ||||||||||
Sbjct: 377 gggatggtaatggcgacctccggcttgatcccagcagccctggcggtgccggacagcatg 318
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 317 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 263
>gb|AW746156.1|AW746156 WS1_39_E07.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 576
Score = 119 bits (60), Expect = 3e-025
Identities = 149/178 (83%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 372 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 313
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| ||||| ||||||||||| | | |||| || ||||||||||
Sbjct: 312 gggatggtaatggcgacctccggcttgatcccagcagccctggcggtgccggacagcatg 253
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 252 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 198
>gb|BE357065.1|BE357065 DG1_146_B06.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 618
Score = 119 bits (60), Expect = 3e-025
Identities = 149/178 (83%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 444 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 385
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| ||||| ||||||||||| | | |||| || ||||||||||
Sbjct: 384 gggatggtaatggcgacctccggcttgatcccagcagccctggcggtgccggacagcatg 325
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 324 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 270
>gb|BE361787.1|BE361787 DG1_82_D08.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 571
Score = 119 bits (60), Expect = 3e-025
Identities = 149/178 (83%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 437 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 378
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| ||||| ||||||||||| | | |||| || ||||||||||
Sbjct: 377 gggatggtaatggcgacctccggcttgatcccagcagccctggcggtgccggacagcatg 318
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 317 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 263
>gb|BE361845.1|BE361845 DG1_82_D08.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 588
Score = 119 bits (60), Expect = 3e-025
Identities = 149/178 (83%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 437 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 378
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| ||||| ||||||||||| | | |||| || ||||||||||
Sbjct: 377 gggatggtaatggcgacctccggcttgatcccagcagccctggcggtgccggacagcatg 318
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 317 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 263
>gb|BE592322.1|BE592322 WS1_93_C05.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 474
Score = 119 bits (60), Expect = 3e-025
Identities = 149/178 (83%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 304 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 245
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| ||||| ||||||||||| | | |||| || ||||||||||
Sbjct: 244 gggatggtaatggcgacctccggcttgatcccagcagccctggcggtgccggacagcatg 185
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 184 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 130
>gb|BM328467.1|BM328467 PIC1_29_F01.g1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 616
Score = 119 bits (60), Expect = 3e-025
Identities = 149/178 (83%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 424 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 365
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| ||||| ||||||||||| | | |||| || ||||||||||
Sbjct: 364 gggatggtaatggcgacctccggcttgatcccagcagccctggcggtgccggacagcatg 305
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 304 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 250
>gb|CX607163.1|CX607163 ANR1_7_C01.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_7_C01_A002 3', mRNA sequence
Length = 629
Score = 119 bits (60), Expect = 3e-025
Identities = 84/92 (91%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 443 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 384
Query: 362 gggatggtgatggccacctcgggcttgatccc 393
|||||||| ||||| ||||| |||||||||||
Sbjct: 383 gggatggtaatggcgacctccggcttgatccc 352
>gb|CX607254.1|CX607254 ANR1_7_C01.g1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_7_C01_A002 5', mRNA sequence
Length = 642
Score = 119 bits (60), Expect = 3e-025
Identities = 149/178 (83%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 432 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 373
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| ||||| ||||||||||| | | |||| || ||||||||||
Sbjct: 372 gggatggtaatggcgacctccggcttgatcccagcagccctggcggtgccggacagcatg 313
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 312 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 258
>gb|BE356984.1|BE356984 DG1_146_B06.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 448
Score = 103 bits (52), Expect = 2e-020
Identities = 147/178 (82%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||| ||| | | |||||||||||||
Sbjct: 444 ggcagcgtgtaatctccgcacttgtagccgacggggcgatcggccatgttgcagcgcttg 385
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||| ||||| || | ||||||||||| | | |||| || ||||||||||
Sbjct: 384 gggatggtaatggcgactcccggcttgatcccagcagccctggcggtgccggacagcatg 325
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||| |||||| || | ||||||||
Sbjct: 324 acggcgcacaggcagctggggctctg---cccgatggcgtgcacggcggagcagcagc 270
>gb|CL191658.1|CL191658 104_410_10906963_114_32532_066 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10906963, DNA
sequence
Length = 677
Score = 101 bits (51), Expect = 8e-020
Identities = 101/114 (88%), Gaps = 4/114 (3%)
Strand = Plus / Minus
Query: 205 cacacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactccgacgga 263
|||||| |||||||||| ||||||||||||||| | |||||||||||||||||||||||
Sbjct: 234 cacacacacactgacacagtcaccgtcacttcccacagacgtcgtgctaactccgacgga 175
Query: 264 tcatgcacatgtgctcaag-cagctctcgcgcagctcatggcagagtgtaatct 316
|||||||| ||||||||| |||||| | ||||||||||||||||||||||
Sbjct: 174 tcatgcactggtgctcaagtaagctct--caaagctcatggcagagtgtaatct 123
Score = 77.8 bits (39), Expect = 1e-012
Identities = 48/51 (94%)
Strand = Plus / Minus
Query: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaac 85
|||||||| ||||||||||||| |||||||||||||||||||||||||||
Sbjct: 404 gtccaagacaacaagttttatttggaggatgcaggacagcatctctggaac 354
Score = 61.9 bits (31), Expect = 7e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 131 tgagacactcatatcacactggacttccacatgtatggtaatcacaa 177
|||||||| | ||||| |||||| |||||||||||||||||||||||
Sbjct: 302 tgagacacccgtatcatactggagttccacatgtatggtaatcacaa 256
>gb|CL178425.1|CL178425 104_386_10894579_148_31911_259 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894579, DNA
sequence
Length = 692
Score = 79.8 bits (40), Expect = 3e-013
Identities = 106/128 (82%)
Strand = Plus / Plus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 220 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggcg 279
Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436
|| | ||||||| |||| |||| || || | |||||||||||||||||| ||||||
Sbjct: 280 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 339
Query: 437 tgggggct 444
| ||||||
Sbjct: 340 ttggggct 347
>gb|CW436887.1|CW436887 fsbb001f153l16k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f153l16, DNA
sequence
Length = 626
Score = 79.8 bits (40), Expect = 3e-013
Identities = 106/128 (82%)
Strand = Plus / Plus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 227 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggcg 286
Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436
|| | ||||||| |||| |||| || || | |||||||||||||||||| ||||||
Sbjct: 287 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 346
Query: 437 tgggggct 444
| ||||||
Sbjct: 347 ttggggct 354
>gb|AW679561.1|AW679561 WS1_2_E01.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 506
Score = 79.8 bits (40), Expect = 3e-013
Identities = 106/128 (82%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 307 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggcg 248
Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436
|| | ||||||| |||| |||| || || | |||||||||||||||||| ||||||
Sbjct: 247 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 188
Query: 437 tgggggct 444
| ||||||
Sbjct: 187 ttggggct 180
>gb|AW746460.1|AW746460 WS1_53_D10.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 548
Score = 79.8 bits (40), Expect = 3e-013
Identities = 106/128 (82%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 417 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggcg 358
Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436
|| | ||||||| |||| |||| || || | |||||||||||||||||| ||||||
Sbjct: 357 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 298
Query: 437 tgggggct 444
| ||||||
Sbjct: 297 ttggggct 290
>gb|BG933440.1|BG933440 WS1_2_E01.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA, mRNA
sequence
Length = 334
Score = 79.8 bits (40), Expect = 3e-013
Identities = 106/128 (82%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 307 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggcg 248
Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436
|| | ||||||| |||| |||| || || | |||||||||||||||||| ||||||
Sbjct: 247 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 188
Query: 437 tgggggct 444
| ||||||
Sbjct: 187 ttggggct 180
>gb|CF757574.1|CF757574 DSAF1_19_F06.g1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_19_F06_A011 3', mRNA sequence
Length = 474
Score = 79.8 bits (40), Expect = 3e-013
Identities = 106/128 (82%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 237 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggcg 178
Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436
|| | ||||||| |||| |||| || || | |||||||||||||||||| ||||||
Sbjct: 177 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 118
Query: 437 tgggggct 444
| ||||||
Sbjct: 117 ttggggct 110
>gb|CF771096.1|CF771096 DSBF1_13_H05.g1_A010 Drought-stressed before flowering Sorghum
bicolor cDNA clone DSBF1_13_H05_A010 3', mRNA sequence
Length = 334
Score = 79.8 bits (40), Expect = 3e-013
Identities = 106/128 (82%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 140 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggcg 81
Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcac 436
|| | ||||||| |||| |||| || || | |||||||||||||||||| ||||||
Sbjct: 80 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgcacaggcac 21
Query: 437 tgggggct 444
| ||||||
Sbjct: 20 ttggggct 13
>gb|CL191659.1|CL191659 104_410_10906963_116_32536_066 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10906963, DNA
sequence
Length = 700
Score = 77.8 bits (39), Expect = 1e-012
Identities = 48/51 (94%)
Strand = Plus / Plus
Query: 35 gtccaagaagacaagttttatttcgaggatgcaggacagcatctctggaac 85
|||||||| ||||||||||||| |||||||||||||||||||||||||||
Sbjct: 505 gtccaagacaacaagttttatttggaggatgcaggacagcatctctggaac 555
Score = 61.9 bits (31), Expect = 7e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 131 tgagacactcatatcacactggacttccacatgtatggtaatcacaa 177
|||||||| | ||||| |||||| |||||||||||||||||||||||
Sbjct: 607 tgagacacccgtatcatactggagttccacatgtatggtaatcacaa 653
>gb|CF758510.1|CF758510 DSAF1_32_H01.g1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_32_H01_A011 3', mRNA sequence
Length = 258
Score = 73.8 bits (37), Expect = 2e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 45 acaagttttatttcgaggatgcaggacagcatctctggaac 85
||||||||||||| |||||||||||||||||||||||||||
Sbjct: 249 acaagttttatttggaggatgcaggacagcatctctggaac 209
Score = 54.0 bits (27), Expect = 2e-005
Identities = 56/63 (88%), Gaps = 2/63 (3%)
Strand = Plus / Minus
Query: 206 acacatacactgacac-gtcaccgtcacttcctgcggacgtcgtgctaactc-cgacgga 263
||||| |||||||||| || |||||||||||| | |||||||||||||||| |||||||
Sbjct: 95 acacagacactgacacagttaccgtcacttcccacagacgtcgtgctaactctcgacgga 36
Query: 264 tca 266
|||
Sbjct: 35 tca 33
>gb|CF757475.1|CF757475 DSAF1_18_D05.g1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_18_D05_A011 3', mRNA sequence
Length = 307
Score = 65.9 bits (33), Expect = 4e-009
Identities = 93/113 (82%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 114 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggcg 55
Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgca 429
|| | ||||||| |||| |||| || || | ||||||||||||||||||
Sbjct: 54 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgca 2
>gb|CF757998.1|CF757998 DSAF1_26_A05.g1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_26_A05_A011 3', mRNA sequence
Length = 309
Score = 65.9 bits (33), Expect = 4e-009
Identities = 93/113 (82%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 114 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggcg 55
Query: 377 acctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgca 429
|| | ||||||| |||| |||| || || | ||||||||||||||||||
Sbjct: 54 acggcaggcttgacgccggccttccgcgcggtgtcggacagcatgacggcgca 2
>gb|CF759184.1|CF759184 DSAF1_42_A05.b1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_42_A05_A011 5', mRNA sequence
Length = 291
Score = 61.9 bits (31), Expect = 7e-008
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggc 375
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 72 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggc 14
>gb|CF769999.1|CF769999 DSBF1_5_C09.b1_A010 Drought-stressed before flowering Sorghum
bicolor cDNA clone DSBF1_5_C09_A010 5', mRNA sequence
Length = 293
Score = 61.9 bits (31), Expect = 7e-008
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggc 375
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 72 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggc 14
>gb|CF770084.1|CF770084 DSBF1_5_C09.g1_A010 Drought-stressed before flowering Sorghum
bicolor cDNA clone DSBF1_5_C09_A010 3', mRNA sequence
Length = 267
Score = 61.9 bits (31), Expect = 7e-008
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggc 375
||||||||||||||||||||||||| | | | | |||||||||||||||||| |||||
Sbjct: 72 ccgcacttgtagccgacggggcggttggctatggcgcagcgcttggggatggtcatggc 14
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 188,134
Number of Sequences: 832831
Number of extensions: 188134
Number of successful extensions: 53505
Number of sequences better than 0.5: 56
Number of HSP's better than 0.5 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53354
Number of HSP's gapped (non-prelim): 129
length of query: 673
length of database: 491,359,669
effective HSP length: 19
effective length of query: 654
effective length of database: 475,535,880
effective search space: 311000465520
effective search space used: 311000465520
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)