BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3696537.2.1
(592 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CX609224.1|CX609224 ANR1_11_H11.b1_A002 Anaerobic roots ... 511 e-143
gb|BG947750.1|BG947750 IP1_8_F07.g1_A002 Immature pannicle ... 460 e-128
gb|CL169394.1|CL169394 104_368_10812593_116_31809_065 Sorgh... 202 3e-050
gb|AW745934.1|AW745934 WS1_38_G07.b1_A002 Water-stressed 1 ... 182 2e-044
gb|CN134411.1|CN134411 OX1_26_E07.b1_A002 Oxidatively-stres... 174 6e-042
gb|CN148546.1|CN148546 WOUND1_57_F11.b1_A002 Wounded leaves... 174 6e-042
gb|AW745330.1|AW745330 WS1_33_F10.b1_A002 Water-stressed 1 ... 170 9e-041
gb|BE593477.1|BE593477 WS1_98_C11.b1_A002 Water-stressed 1 ... 170 9e-041
gb|BE593763.1|BE593763 WS1_101_H05.g1_A002 Water-stressed 1... 155 6e-036
gb|CD211305.1|CD211305 HS1_59_D10.b1_A012 Heat-shocked seed... 155 6e-036
gb|BE597244.1|BE597244 PI1_69_H07.g1_A002 Pathogen induced ... 147 1e-033
gb|CN148626.1|CN148626 WOUND1_57_F11.g1_A002 Wounded leaves... 147 1e-033
gb|BE592089.1|BE592089 LG1_224_B09.b2_A002 Light Grown 1 (L... 145 5e-033
gb|BE597470.1|BE597470 PI1_69_H07.b1_A002 Pathogen induced ... 145 5e-033
gb|AW678525.1|AW678525 WS1_16_A09.g1_A002 Water-stressed 1 ... 143 2e-032
gb|AW679919.1|AW679919 WS1_33_F10.g1_A002 Water-stressed 1 ... 143 2e-032
gb|BE367648.1|BE367648 PI1_9_C11.g1_A002 Pathogen induced 1... 143 2e-032
gb|BE593166.1|BE593166 WS1_98_C11.g1_A002 Water-stressed 1 ... 143 2e-032
gb|BG356317.1|BG356317 EM1_21_A08.g1_A002 Embryo 1 (EM1) So... 143 2e-032
gb|AW283184.2|AW283184 LG1_224_B09.g1_A002 Light Grown 1 (L... 143 2e-032
gb|CD223141.1|CD223141 CCC1_26_H01.b1_A007 Callus culture/c... 143 2e-032
gb|CW186294.1|CW186294 104_604_11166493_148_36706_059 Sorgh... 119 3e-025
gb|CW384032.1|CW384032 fsbb001f066n22k0 Sorghum methylation... 119 3e-025
gb|CW410773.1|CW410773 fsbb001f105k18f0 Sorghum methylation... 119 3e-025
gb|AW679840.1|AW679840 WS1_32_H03.g1_A002 Water-stressed 1 ... 117 1e-024
gb|BG463181.1|BG463181 EM1_47_E02.g1_A002 Embryo 1 (EM1) So... 117 1e-024
gb|CW410774.1|CW410774 fsbb001f105k18k0 Sorghum methylation... 111 7e-023
gb|CD229393.1|CD229393 CCC1_15_C04.b1_A007 Callus culture/c... 109 3e-022
gb|BE367552.1|BE367552 PI1_9_C11.b1_A002 Pathogen induced 1... 107 1e-021
gb|BE592989.1|BE592989 WS1_93_A01.b1_A002 Water-stressed 1 ... 107 1e-021
gb|BG487641.1|BG487641 EM1_65_E06.g1_A002 Embryo 1 (EM1) So... 105 5e-021
gb|CD207550.1|CD207550 HS1_33_G01.b1_A012 Heat-shocked seed... 103 2e-020
gb|CD211586.1|CD211586 HS1_63_G09.b1_A012 Heat-shocked seed... 103 2e-020
gb|CD212555.1|CD212555 HS1_6_D03.b1_A012 Heat-shocked seedl... 103 2e-020
gb|AW677890.1|AW677890 WS1_11_C05.g1_A002 Water-stressed 1 ... 96 4e-018
gb|AW745466.1|AW745466 WS1_35_G03.b1_A002 Water-stressed 1 ... 96 4e-018
gb|AW745580.1|AW745580 WS1_35_G03.g1_A002 Water-stressed 1 ... 96 4e-018
gb|AW746007.1|AW746007 WS1_38_G07.g1_A002 Water-stressed 1 ... 96 4e-018
gb|BF176779.1|BF176779 EM1_1_C01.g1_A002 Embryo 1 (EM1) Sor... 96 4e-018
gb|BG556553.1|BG556553 EM1_38_F11.g1_A002 Embryo 1 (EM1) So... 96 4e-018
gb|BM329475.1|BM329475 PIC1_38_E05.g1_A002 Pathogen-infecte... 96 4e-018
gb|CD206377.1|CD206377 HS1_22_H09.b1_A012 Heat-shocked seed... 96 4e-018
gb|CD208214.1|CD208214 HS1_32_H02.b1_A012 Heat-shocked seed... 96 4e-018
gb|CD210866.1|CD210866 HS1_66_E04.b1_A012 Heat-shocked seed... 96 4e-018
gb|CB927927.1|CB927927 ABA1_35_B03.b1_A012 Abscisic acid-tr... 94 2e-017
gb|CD229448.1|CD229448 CCC1_15_C04.g1_A007 Callus culture/c... 90 3e-016
gb|BG557713.1|BG557713 EM1_55_H03.g1_A002 Embryo 1 (EM1) So... 88 1e-015
gb|CD227529.1|CD227529 CCC1_52_F07.b1_A007 Callus culture/c... 88 1e-015
gb|CN134496.1|CN134496 OX1_26_E07.g1_A002 Oxidatively-stres... 88 1e-015
gb|AW678450.1|AW678450 WS1_16_A05.b1_A002 Water-stressed 1 ... 82 7e-014
gb|AW678610.1|AW678610 WS1_16_A05.g1_A002 Water-stressed 1 ... 82 7e-014
gb|BG556794.1|BG556794 EM1_38_F11.b1_A002 Embryo 1 (EM1) So... 80 3e-013
gb|CL172544.1|CL172544 104_375_10890238_116_31797_142 Sorgh... 78 1e-012
gb|CL191671.1|CL191671 104_410_10906972_114_32535_002 Sorgh... 78 1e-012
gb|CW195061.1|CW195061 104_618_11180437_116_37427_055 Sorgh... 78 1e-012
gb|CW195062.1|CW195062 104_618_11180437_148_37428_055 Sorgh... 78 1e-012
gb|AW677923.1|AW677923 WS1_12_F01.b1_A002 Water-stressed 1 ... 78 1e-012
gb|AW678010.1|AW678010 WS1_12_F01.g1_A002 Water-stressed 1 ... 78 1e-012
gb|BE358631.1|BE358631 DG1_30_E09.g1_A002 Dark Grown 1 (DG1... 78 1e-012
gb|BG557769.1|BG557769 EM1_56_H02.g1_A002 Embryo 1 (EM1) So... 76 4e-012
gb|CX610090.1|CX610090 ANR1_16_C06.g1_A002 Anaerobic roots ... 72 6e-011
gb|BE594074.1|BE594074 WS1_101_H05.b1_A002 Water-stressed 1... 64 2e-008
gb|BM324999.1|BM324999 PIC1_38_E05.b1_A002 Pathogen-infecte... 64 2e-008
gb|CW446774.1|CW446774 fsbb001f179j13k0 Sorghum methylation... 62 6e-008
gb|CD211330.1|CD211330 HS1_59_D10.g1_A012 Heat-shocked seed... 60 2e-007
gb|BE594085.1|BE594085 WS1_102_A06.b1_A002 Water-stressed 1... 58 1e-006
gb|BE592299.1|BE592299 WS1_93_A01.g1_A002 Water-stressed 1 ... 56 4e-006
gb|BM326697.1|BM326697 PIC1_1_E04.g1_A002 Pathogen-infected... 56 4e-006
gb|CF770360.1|CF770360 DSBF1_7_F12.b1_A010 Drought-stressed... 56 4e-006
gb|CF770444.1|CF770444 DSBF1_7_F12.g1_A010 Drought-stressed... 56 4e-006
gb|CD222882.1|CD222882 CCC1_24_G10.g1_A007 Callus culture/c... 54 1e-005
gb|CL172545.1|CL172545 104_375_10890238_148_31796_142 Sorgh... 48 0.001
gb|CW285475.1|CW285475 104_762_11410352_148_35500_020 Sorgh... 48 0.001
gb|CW330371.1|CW330371 104_827_11480339_116_36007_044 Sorgh... 48 0.001
gb|CW330372.1|CW330372 104_827_11480339_148_36008_044 Sorgh... 48 0.001
gb|CW446773.1|CW446773 fsbb001f179j13f0 Sorghum methylation... 48 0.001
gb|CW142269.1|CW142269 104_533_11136764_148_34943_072 Sorgh... 40 0.22
gb|CW284708.1|CW284708 104_761_11409934_148_35496_085 Sorgh... 40 0.22
>gb|CX609224.1|CX609224 ANR1_11_H11.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_11_H11_A002 3', mRNA sequence
Length = 753
Score = 511 bits (258), Expect = e-143
Identities = 339/366 (92%)
Strand = Plus / Minus
Query: 227 actctagagcatgcggctggatcgcccctcgtctgccgggtgttgtaagagctgcatcca 286
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 528 actctggagcatgcagctggatcgcccctcgtctgccgggtgttgtaagagctgcatcca 469
Query: 287 gggcacttgtgcgccaagatgtggaactgcacgttggacgtcacgccacagtcgttgcaa 346
||||||||||||||||| ||||||||||||||||| | ||||| |||||||||||||||
Sbjct: 468 gggcacttgtgcgccaatatgtggaactgcacgttcgccgtcatgccacagtcgttgcac 409
Query: 347 aggatccataccatcttcttctgatagatcgctggcatcggggacgctgcaacctgctga 406
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||
Sbjct: 408 aggatccatatcatcttcttctgatagatcgccggcatcggggacgctgcaacctcttga 349
Query: 407 tccagcttttgccagatgtcggacatgttgcaggcagacctcaggcacaccgggcatgaa 466
|||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 348 tccagcttttgccatatgtcggacatgttgcaggcagacctcaggcaaaccgggcatgag 289
Query: 467 aactgctggtgcgctctcatctcgtaaaggcattccaggtggatggtgtgtccgcagtgg 526
|||||||| ||||||||||||||||| |||||||||||||| || |||||||| || ||
Sbjct: 288 aactgctgatgcgctctcatctcgtacaggcattccaggtgaatcgtgtgtccacaatga 229
Query: 527 agcacgctgatagctttcatcgagtcgaatagatactccatgcagacagggcagttgtga 586
||||| |||||||||||| ||||||||||||||||||| ||||| || |||||||||| |
Sbjct: 228 agcacactgatagctttcgtcgagtcgaatagatactcaatgcatacggggcagttgtta 169
Query: 587 tgcata 592
||||||
Sbjct: 168 tgcata 163
>gb|BG947750.1|BG947750 IP1_8_F07.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 563
Score = 460 bits (232), Expect = e-128
Identities = 301/324 (92%)
Strand = Plus / Minus
Query: 227 actctagagcatgcggctggatcgcccctcgtctgccgggtgttgtaagagctgcatcca 286
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 324 actctggagcatgcagctggatcgcccctcgtctgccgggtgttgtaagagctgcatcca 265
Query: 287 gggcacttgtgcgccaagatgtggaactgcacgttggacgtcacgccacagtcgttgcaa 346
||||||||||||||||| ||||||||||||||||| | ||||| |||||||||||||||
Sbjct: 264 gggcacttgtgcgccaatatgtggaactgcacgttcgccgtcatgccacagtcgttgcac 205
Query: 347 aggatccataccatcttcttctgatagatcgctggcatcggggacgctgcaacctgctga 406
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||
Sbjct: 204 aggatccatatcatcttcttctgatagatcgccggcatcggggacgctgcaacctcttga 145
Query: 407 tccagcttttgccagatgtcggacatgttgcaggcagacctcaggcacaccgggcatgaa 466
|||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 144 tccagcttttgccatatgtcggacatgttgcaggcagacctcaggcaaaccgggcatgag 85
Query: 467 aactgctggtgcgctctcatctcgtaaaggcattccaggtggatggtgtgtccgcagtgg 526
|||||||| ||||||||||||||||| |||||||||||||| || |||||||| || ||
Sbjct: 84 aactgctgatgcgctctcatctcgtacaggcattccaggtgaatcgtgtgtccacaatga 25
Query: 527 agcacgctgatagctttcatcgag 550
||||| |||||||||||| |||||
Sbjct: 24 agcacactgatagctttcgtcgag 1
>gb|CL169394.1|CL169394 104_368_10812593_116_31809_065 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10812593, DNA
sequence
Length = 629
Score = 202 bits (102), Expect = 3e-050
Identities = 123/130 (94%)
Strand = Plus / Plus
Query: 227 actctagagcatgcggctggatcgcccctcgtctgccgggtgttgtaagagctgcatcca 286
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 328 actctggagcatgcagctggatcgcccctcgtctgccgggtgttgtaagagctgcatcca 387
Query: 287 gggcacttgtgcgccaagatgtggaactgcacgttggacgtcacgccacagtcgttgcaa 346
||||||||||||||||| ||||||||||||||||| | ||||| |||||||||||||||
Sbjct: 388 gggcacttgtgcgccaatatgtggaactgcacgttcgccgtcatgccacagtcgttgcac 447
Query: 347 aggatccata 356
||||||||||
Sbjct: 448 aggatccata 457
Score = 87.7 bits (44), Expect = 1e-015
Identities = 47/48 (97%)
Strand = Plus / Plus
Query: 355 taccatcttcttctgatagatcgctggcatcggggacgctgcaacctg 402
|||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 552 taccatcttcttctgatagatcgccggcatcggggacgctgcaacctg 599
>gb|AW745934.1|AW745934 WS1_38_G07.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 476
Score = 182 bits (92), Expect = 2e-044
Identities = 278/340 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 391 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 332
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 331 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 272
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 271 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 212
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 211 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 152
Query: 492 aaaggcattccaggtggatggtgtgtccgcagtggagcacgctgatagctttcatcgagt 551
| ||| ||||| || || ||||| ||||| || ||||| ||||| | || | ||||
Sbjct: 151 tcatgcactccagatgaattgtgtgcccgcattgcagcacactgatgtcctttgtggagt 92
Query: 552 cgaatagatactccatgcagacagggcagttgtgatgcat 591
|||| |||||||| | ||||||||||||||||||||||||
Sbjct: 91 cgaacagatactcgaagcagacagggcagttgtgatgcat 52
>gb|CN134411.1|CN134411 OX1_26_E07.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_26_E07_A002 3', mRNA sequence
Length = 812
Score = 174 bits (88), Expect = 6e-042
Identities = 277/340 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 425 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 366
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 365 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 306
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 305 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 246
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 245 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 186
Query: 492 aaaggcattccaggtggatggtgtgtccgcagtggagcacgctgatagctttcatcgagt 551
| ||| ||||| || || ||||| ||||| || ||||| ||||| | || | ||||
Sbjct: 185 tcatgcactccagatgaattgtgtgcccgcattgcagcacactgatgtcctttgtggagt 126
Query: 552 cgaatagatactccatgcagacagggcagttgtgatgcat 591
|||| |||||||| | ||| ||||||||||||||||||||
Sbjct: 125 cgaacagatactcgaagcaaacagggcagttgtgatgcat 86
>gb|CN148546.1|CN148546 WOUND1_57_F11.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_57_F11_A002 3', mRNA sequence
Length = 828
Score = 174 bits (88), Expect = 6e-042
Identities = 277/340 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 444 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 385
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 384 gccgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 325
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 324 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 265
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 264 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 205
Query: 492 aaaggcattccaggtggatggtgtgtccgcagtggagcacgctgatagctttcatcgagt 551
| ||| ||||| || || ||||| ||||| || ||||| ||||| | || | ||||
Sbjct: 204 tcatgcactccagatgaattgtgtgcccgcattgcagcacactgatgtcctttgtggagt 145
Query: 552 cgaatagatactccatgcagacagggcagttgtgatgcat 591
|||| |||||||| | ||||||||||||||||||||||||
Sbjct: 144 cgaacagatactcgaagcagacagggcagttgtgatgcat 105
>gb|AW745330.1|AW745330 WS1_33_F10.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 580
Score = 170 bits (86), Expect = 9e-041
Identities = 269/330 (81%)
Strand = Plus / Minus
Query: 262 ccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtggaactgcacgtt 321
|||||||||||| |||||||| || |||||||| ||| ||| | ||||||| ||||| |
Sbjct: 580 ccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtggaaccgcacgct 521
Query: 322 ggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgatagatcgctgg 381
|| ||| ||| ||||||||||| |||||||||||||| |||||| ||||||| | ||
Sbjct: 520 cgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagatagatgtcagg 461
Query: 382 catcggggacgctgcaacctgctgatccagcttttgccagatgtcggacatgttgcaggc 441
||| || | ||| ||||||| || ||| ||||| |||| || ||||||||| ||||||
Sbjct: 460 cattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggacatgtcgcaggc 401
Query: 442 agacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgtaaaggcattc 501
|||||| |||||||||||| || || || ||||||||||||||||||| | ||| ||
Sbjct: 400 ggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgttcatgcactc 341
Query: 502 caggtggatggtgtgtccgcagtggagcacgctgatagctttcatcgagtcgaatagata 561
||| || || ||||| ||||| || ||||| ||||| | || | |||||||| |||||
Sbjct: 340 cagatgaattgtgtgcccgcattgcagcacactgatgtcctttgtggagtcgaacagata 281
Query: 562 ctccatgcagacagggcagttgtgatgcat 591
||| | ||||||||||||||||||||||||
Sbjct: 280 ctcgaagcagacagggcagttgtgatgcat 251
>gb|BE593477.1|BE593477 WS1_98_C11.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 581
Score = 170 bits (86), Expect = 9e-041
Identities = 269/330 (81%)
Strand = Plus / Minus
Query: 262 ccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtggaactgcacgtt 321
|||||||||||| |||||||| || |||||||| ||| ||| | ||||||| ||||| |
Sbjct: 580 ccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtggaaccgcacgct 521
Query: 322 ggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgatagatcgctgg 381
|| ||| ||| ||||||||||| |||||||||||||| |||||| ||||||| | ||
Sbjct: 520 cgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagatagatgtcagg 461
Query: 382 catcggggacgctgcaacctgctgatccagcttttgccagatgtcggacatgttgcaggc 441
||| || | ||| ||||||| || ||| ||||| |||| || ||||||||| ||||||
Sbjct: 460 cattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggacatgtcgcaggc 401
Query: 442 agacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgtaaaggcattc 501
|||||| |||||||||||| || || || ||||||||||||||||||| | ||| ||
Sbjct: 400 ggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgttcatgcactc 341
Query: 502 caggtggatggtgtgtccgcagtggagcacgctgatagctttcatcgagtcgaatagata 561
||| || || ||||| ||||| || ||||| ||||| | || | |||||||| |||||
Sbjct: 340 cagatgaattgtgtgcccgcattgcagcacactgatgtcctttgtggagtcgaacagata 281
Query: 562 ctccatgcagacagggcagttgtgatgcat 591
||| | ||||||||||||||||||||||||
Sbjct: 280 ctcgaagcagacagggcagttgtgatgcat 251
>gb|BE593763.1|BE593763 WS1_101_H05.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 675
Score = 155 bits (78), Expect = 6e-036
Identities = 234/286 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 297 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 238
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 237 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 178
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 177 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 118
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| ||||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 117 tgtcgcaggcggacctcaagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 58
Query: 492 aaaggcattccaggtggatggtgtgtccgcagtggagcacgctgat 537
| ||| ||||| || || ||||| ||||| || ||||| |||||
Sbjct: 57 tcatgcactccagatgaattgtgtgcccgcattgcagcacactgat 12
>gb|CD211305.1|CD211305 HS1_59_D10.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_59_D10_A012 3', mRNA sequence
Length = 697
Score = 155 bits (78), Expect = 6e-036
Identities = 234/286 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 293 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 234
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| ||||||||||||||||||||| |||
Sbjct: 233 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccatcttcttcagat 174
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 173 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 114
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 113 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 54
Query: 492 aaaggcattccaggtggatggtgtgtccgcagtggagcacgctgat 537
| ||| ||||| || || ||||| ||||| || ||||| |||||
Sbjct: 53 tcatgcactccagatgaattgtgtgcccgcattgcagcacactgat 8
>gb|BE597244.1|BE597244 PI1_69_H07.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 655
Score = 147 bits (74), Expect = 1e-033
Identities = 233/286 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 290 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 231
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 230 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 171
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 170 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 111
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 110 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 51
Query: 492 aaaggcattccaggtggatggtgtgtccgcagtggagcacgctgat 537
| ||| ||||| || || ||||| ||||| || ||||| |||||
Sbjct: 50 tcatgcactccagatgaattgtgtgcccgcattgcagcacactgat 5
>gb|CN148626.1|CN148626 WOUND1_57_F11.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_57_F11_A002 5', mRNA sequence
Length = 895
Score = 147 bits (74), Expect = 1e-033
Identities = 211/257 (82%)
Strand = Plus / Minus
Query: 335 cagtcgttgcaaaggatccataccatcttcttctgatagatcgctggcatcggggacgct 394
||||||||||| |||||||||||||| |||||| ||||||| | ||||| || | |||
Sbjct: 874 cagtcgttgcacaggatccataccattttcttcagatagatgtcaggcatnggcgtcgcc 815
Query: 395 gcaacctgctgatccagcttttgccagatgtcggacatgttgcaggcagacctcaggcac 454
||||||| || ||| ||||| |||| || ||||||||| |||||| |||||| ||||
Sbjct: 814 gcaacctcctcatcgagcttccgccatgtggcggacatgtcgcaggcggacctcgagcac 755
Query: 455 accgggcatgaaaactgctggtgcgctctcatctcgtaaaggcattccaggtggatggtg 514
|||||||| || || || ||||||||||||||||||| | ||| ||||| || || |||
Sbjct: 754 accgggcacgagaagtgatggtgcgctctcatctcgttcatgcactccagatgaattgtg 695
Query: 515 tgtccgcagtggagcacgctgatagctttcatcgagtcgaatagatactccatgcagaca 574
|| ||||| || ||||| ||||| | || | |||||||| |||||||| | |||||||
Sbjct: 694 tgcccgcattgcagcacactgatgtcctttgtggagtcgaacagatactcgaagcagaca 635
Query: 575 gggcagttgtgatgcat 591
|||||||||||||||||
Sbjct: 634 gggcagttgtgatgcat 618
>gb|BE592089.1|BE592089 LG1_224_B09.b2_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 476
Score = 145 bits (73), Expect = 5e-033
Identities = 211/257 (82%)
Strand = Plus / Minus
Query: 335 cagtcgttgcaaaggatccataccatcttcttctgatagatcgctggcatcggggacgct 394
||||||||||| |||||||||||||| |||||| ||||||| | ||||| || | |||
Sbjct: 465 cagtcgttgcacaggatccataccattttcttcagatagatgtcaggcattggcgtcgcc 406
Query: 395 gcaacctgctgatccagcttttgccagatgtcggacatgttgcaggcagacctcaggcac 454
||||||| || ||| ||||| |||| || ||||||||| |||||| |||||| ||||
Sbjct: 405 gcaacctcctcatcgagcttccgccatgtggcggacatgtcgcaggcggacctcgagcac 346
Query: 455 accgggcatgaaaactgctggtgcgctctcatctcgtaaaggcattccaggtggatggtg 514
|||||||| || || || ||||||||||||||||||| | ||| ||||| || || |||
Sbjct: 345 accgggcacgagaagtgatggtgcgctctcatctcgttcatgcactccagatgaattgtg 286
Query: 515 tgtccgcagtggagcacgctgatagctttcatcgagtcgaatagatactccatgcagaca 574
|| ||||| || ||||| ||||| | || | |||||||| |||||||| | |||||||
Sbjct: 285 tgcccgcattgcagcacactgatgtcctttgtggagtcgaacagatactcgaagcagaca 226
Query: 575 gggcagttgtgatgcat 591
|||||||||||||||||
Sbjct: 225 gggcagttgtgatgcat 209
>gb|BE597470.1|BE597470 PI1_69_H07.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 485
Score = 145 bits (73), Expect = 5e-033
Identities = 211/257 (82%)
Strand = Plus / Minus
Query: 335 cagtcgttgcaaaggatccataccatcttcttctgatagatcgctggcatcggggacgct 394
||||||||||| |||||||||||||| |||||| ||||||| | ||||| || | |||
Sbjct: 474 cagtcgttgcacaggatccataccattttcttcagatagatgtcaggcattggcgtcgcc 415
Query: 395 gcaacctgctgatccagcttttgccagatgtcggacatgttgcaggcagacctcaggcac 454
||||||| || ||| ||||| |||| || ||||||||| |||||| |||||| ||||
Sbjct: 414 gcaacctcctcatcgagcttccgccatgtggcggacatgtcgcaggcggacctcgagcac 355
Query: 455 accgggcatgaaaactgctggtgcgctctcatctcgtaaaggcattccaggtggatggtg 514
|||||||| || || || ||||||||||||||||||| | ||| ||||| || || |||
Sbjct: 354 accgggcacgagaagtgatggtgcgctctcatctcgttcatgcactccagatgaattgtg 295
Query: 515 tgtccgcagtggagcacgctgatagctttcatcgagtcgaatagatactccatgcagaca 574
|| ||||| || ||||| ||||| | || | |||||||| |||||||| | |||||||
Sbjct: 294 tgcccgcattgcagcacactgatgtcctttgtggagtcgaacagatactcgaagcagaca 235
Query: 575 gggcagttgtgatgcat 591
|||||||||||||||||
Sbjct: 234 gggcagttgtgatgcat 218
>gb|AW678525.1|AW678525 WS1_16_A09.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 638
Score = 143 bits (72), Expect = 2e-032
Identities = 198/240 (82%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 247 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 188
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 187 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 128
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 127 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 68
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 67 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 8
>gb|AW679919.1|AW679919 WS1_33_F10.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 639
Score = 143 bits (72), Expect = 2e-032
Identities = 198/240 (82%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 250 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 191
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 190 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 131
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 130 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 71
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 70 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 11
>gb|BE367648.1|BE367648 PI1_9_C11.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 639
Score = 143 bits (72), Expect = 2e-032
Identities = 198/240 (82%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 252 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 193
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 192 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 133
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 132 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 73
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 72 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 13
>gb|BE593166.1|BE593166 WS1_98_C11.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 614
Score = 143 bits (72), Expect = 2e-032
Identities = 198/240 (82%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 248 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 189
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 188 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 129
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 128 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 69
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 68 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 9
>gb|BG356317.1|BG356317 EM1_21_A08.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 628
Score = 143 bits (72), Expect = 2e-032
Identities = 198/240 (82%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 251 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 192
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 191 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 132
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 131 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 72
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 71 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 12
>gb|AW283184.2|AW283184 LG1_224_B09.g1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 643
Score = 143 bits (72), Expect = 2e-032
Identities = 198/240 (82%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 253 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 194
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 193 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 134
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 133 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 74
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 73 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 14
>gb|CD223141.1|CD223141 CCC1_26_H01.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_26_H01_A007 3', mRNA sequence
Length = 659
Score = 143 bits (72), Expect = 2e-032
Identities = 198/240 (82%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 274 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 215
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 214 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 155
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 154 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 95
Query: 432 tgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctcatctcgt 491
||| |||||| |||||| |||||||||||| || || || |||||||||||||||||||
Sbjct: 94 tgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctcatctcgt 35
>gb|CW186294.1|CW186294 104_604_11166493_148_36706_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11166493, DNA
sequence
Length = 680
Score = 119 bits (60), Expect = 3e-025
Identities = 87/96 (90%)
Strand = Plus / Plus
Query: 468 actgctggtgcgctctcatctcgtaaaggcattccaggtggatggtgtgtccgcagtgga 527
||||||| ||||||||||||||||| |||||||||||||| || |||||||| || || |
Sbjct: 413 actgctgatgcgctctcatctcgtacaggcattccaggtgaatcgtgtgtccacaatgaa 472
Query: 528 gcacgctgatagctttcatcgagtcgaatagatact 563
|||| |||||||||||| ||||||||||||||||||
Sbjct: 473 gcacactgatagctttcgtcgagtcgaatagatact 508
Score = 107 bits (54), Expect = 1e-021
Identities = 60/62 (96%)
Strand = Plus / Plus
Query: 404 tgatccagcttttgccagatgtcggacatgttgcaggcagacctcaggcacaccgggcat 463
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 251 tgatccagcttttgccatatgtcggacatgttgcaggcagacctcaggcaaaccgggcat 310
Query: 464 ga 465
||
Sbjct: 311 ga 312
Score = 87.7 bits (44), Expect = 1e-015
Identities = 47/48 (97%)
Strand = Plus / Plus
Query: 355 taccatcttcttctgatagatcgctggcatcggggacgctgcaacctg 402
|||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 123 taccatcttcttctgatagatcgccggcatcggggacgctgcaacctg 170
Score = 44.1 bits (22), Expect = 0.014
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 331 gccacagtcgttgcaaaggatccata 356
||||||||||||||| ||||||||||
Sbjct: 3 gccacagtcgttgcacaggatccata 28
>gb|CW384032.1|CW384032 fsbb001f066n22k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f066n22, DNA
sequence
Length = 760
Score = 119 bits (60), Expect = 3e-025
Identities = 87/96 (90%)
Strand = Plus / Plus
Query: 468 actgctggtgcgctctcatctcgtaaaggcattccaggtggatggtgtgtccgcagtgga 527
||||||| ||||||||||||||||| |||||||||||||| || |||||||| || || |
Sbjct: 233 actgctgatgcgctctcatctcgtacaggcattccaggtgaatcgtgtgtccacaatgaa 292
Query: 528 gcacgctgatagctttcatcgagtcgaatagatact 563
|||| |||||||||||| ||||||||||||||||||
Sbjct: 293 gcacactgatagctttcgtcgagtcgaatagatact 328
Score = 107 bits (54), Expect = 1e-021
Identities = 60/62 (96%)
Strand = Plus / Plus
Query: 404 tgatccagcttttgccagatgtcggacatgttgcaggcagacctcaggcacaccgggcat 463
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 71 tgatccagcttttgccatatgtcggacatgttgcaggcagacctcaggcaaaccgggcat 130
Query: 464 ga 465
||
Sbjct: 131 ga 132
>gb|CW410773.1|CW410773 fsbb001f105k18f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f105k18, DNA
sequence
Length = 707
Score = 119 bits (60), Expect = 3e-025
Identities = 87/96 (90%)
Strand = Plus / Plus
Query: 468 actgctggtgcgctctcatctcgtaaaggcattccaggtggatggtgtgtccgcagtgga 527
||||||| ||||||||||||||||| |||||||||||||| || |||||||| || || |
Sbjct: 233 actgctgatgcgctctcatctcgtacaggcattccaggtgaatcgtgtgtccacaatgaa 292
Query: 528 gcacgctgatagctttcatcgagtcgaatagatact 563
|||| |||||||||||| ||||||||||||||||||
Sbjct: 293 gcacactgatagctttcgtcgagtcgaatagatact 328
Score = 99.6 bits (50), Expect = 3e-019
Identities = 59/62 (95%)
Strand = Plus / Plus
Query: 404 tgatccagcttttgccagatgtcggacatgttgcaggcagacctcaggcacaccgggcat 463
||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||
Sbjct: 71 tgatccagcttttgccatatgtcggacatggtgcaggcagacctcaggcaaaccgggcat 130
Query: 464 ga 465
||
Sbjct: 131 ga 132
>gb|AW679840.1|AW679840 WS1_32_H03.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 605
Score = 117 bits (59), Expect = 1e-024
Identities = 173/211 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 219 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 160
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 159 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 100
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 99 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 40
Query: 432 tgttgcaggcagacctcaggcacaccgggca 462
||| |||||| |||||| ||||||||||||
Sbjct: 39 tgtcgcaggcggacctcgagcacaccgggca 9
>gb|BG463181.1|BG463181 EM1_47_E02.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 592
Score = 117 bits (59), Expect = 1e-024
Identities = 173/211 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 213 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 154
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 153 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 94
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 93 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 34
Query: 432 tgttgcaggcagacctcaggcacaccgggca 462
||| |||||| |||||| ||||||||||||
Sbjct: 33 tgtcgcaggcggacctcgagcacaccgggca 3
>gb|CW410774.1|CW410774 fsbb001f105k18k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f105k18, DNA
sequence
Length = 828
Score = 111 bits (56), Expect = 7e-023
Identities = 86/96 (89%)
Strand = Plus / Minus
Query: 468 actgctggtgcgctctcatctcgtaaaggcattccaggtggatggtgtgtccgcagtgga 527
||||||| ||||||||||||||||| || ||||||||||| || |||||||| || || |
Sbjct: 785 actgctgatgcgctctcatctcgtacagccattccaggtgaatcgtgtgtccacaatgaa 726
Query: 528 gcacgctgatagctttcatcgagtcgaatagatact 563
|||| |||||||||||| ||||||||||||||||||
Sbjct: 725 gcacactgatagctttcgtcgagtcgaatagatact 690
>gb|CD229393.1|CD229393 CCC1_15_C04.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_15_C04_A007 3', mRNA sequence
Length = 621
Score = 109 bits (55), Expect = 3e-022
Identities = 172/211 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 213 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 154
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||| ||||||| |||||| |||
Sbjct: 153 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatcaataccattttcttcagat 94
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 93 agatgacaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 34
Query: 432 tgttgcaggcagacctcaggcacaccgggca 462
||| |||||| |||||| ||||||||||||
Sbjct: 33 tgtcgcaggcggacctcgagcacaccgggca 3
>gb|BE367552.1|BE367552 PI1_9_C11.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 471
Score = 107 bits (54), Expect = 1e-021
Identities = 138/166 (83%)
Strand = Plus / Minus
Query: 426 cggacatgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctca 485
||||||||| |||||| |||||| |||||||||||| || || || |||||||||||||
Sbjct: 441 cggacatgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctca 382
Query: 486 tctcgtaaaggcattccaggtggatggtgtgtccgcagtggagcacgctgatagctttca 545
|||||| | ||| ||||| || || ||||| ||||| || ||||| ||||| | ||
Sbjct: 381 tctcgttcatgcactccagatgaattgtgtgcccgcattgcagcacactgatgtcctttg 322
Query: 546 tcgagtcgaatagatactccatgcagacagggcagttgtgatgcat 591
| |||||||| |||||||| | ||||||||||||||||||||||||
Sbjct: 321 tggagtcgaacagatactcgaagcagacagggcagttgtgatgcat 276
>gb|BE592989.1|BE592989 WS1_93_A01.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 535
Score = 107 bits (54), Expect = 1e-021
Identities = 138/166 (83%)
Strand = Plus / Minus
Query: 426 cggacatgttgcaggcagacctcaggcacaccgggcatgaaaactgctggtgcgctctca 485
||||||||| |||||| |||||| |||||||||||| || || || |||||||||||||
Sbjct: 470 cggacatgtcgcaggcggacctcgagcacaccgggcacgagaagtgatggtgcgctctca 411
Query: 486 tctcgtaaaggcattccaggtggatggtgtgtccgcagtggagcacgctgatagctttca 545
|||||| | ||| ||||| || || ||||| ||||| || ||||| ||||| | ||
Sbjct: 410 tctcgttcatgcactccagatgaattgtgtgcccgcattgcagcacactgatgtcctttg 351
Query: 546 tcgagtcgaatagatactccatgcagacagggcagttgtgatgcat 591
| |||||||| |||||||| | ||||||||||||||||||||||||
Sbjct: 350 tggagtcgaacagatactcgaagcagacagggcagttgtgatgcat 305
>gb|BG487641.1|BG487641 EM1_65_E06.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 573
Score = 105 bits (53), Expect = 5e-021
Identities = 161/197 (81%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 206 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 147
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 146 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 87
Query: 372 agatcgctggcatcggggacgctgcaacctgctgatccagcttttgccagatgtcggaca 431
|||| | ||||| || | ||| ||||||| || ||| ||||| |||| || ||||||
Sbjct: 86 agatgtcaggcattggcgtcgccgcaacctcctcatcgagcttccgccatgtggcggaca 27
Query: 432 tgttgcaggcagacctc 448
||| |||||| ||||||
Sbjct: 26 tgtcgcaggcggacctc 10
>gb|CD207550.1|CD207550 HS1_33_G01.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_33_G01_A012 3', mRNA sequence
Length = 554
Score = 103 bits (52), Expect = 2e-020
Identities = 106/124 (85%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 156 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 97
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| ||||||||||||||||||||| |||
Sbjct: 96 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccatcttcttcagat 37
Query: 372 agat 375
||||
Sbjct: 36 agat 33
>gb|CD211586.1|CD211586 HS1_63_G09.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_63_G09_A012 3', mRNA sequence
Length = 580
Score = 103 bits (52), Expect = 2e-020
Identities = 106/124 (85%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 171 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 112
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| ||||||||||||||||||||| |||
Sbjct: 111 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccatcttcttcagat 52
Query: 372 agat 375
||||
Sbjct: 51 agat 48
>gb|CD212555.1|CD212555 HS1_6_D03.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA clone
HS1_6_D03_A012 3', mRNA sequence
Length = 585
Score = 103 bits (52), Expect = 2e-020
Identities = 106/124 (85%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 184 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 125
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| ||||||||||||||||||||| |||
Sbjct: 124 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccatcttcttcagat 65
Query: 372 agat 375
||||
Sbjct: 64 agat 61
>gb|AW677890.1|AW677890 WS1_11_C05.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 550
Score = 95.6 bits (48), Expect = 4e-018
Identities = 105/124 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 158 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 99
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 98 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 39
Query: 372 agat 375
||||
Sbjct: 38 agat 35
>gb|AW745466.1|AW745466 WS1_35_G03.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 490
Score = 95.6 bits (48), Expect = 4e-018
Identities = 105/124 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 248 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 189
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 188 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 129
Query: 372 agat 375
||||
Sbjct: 128 agat 125
>gb|AW745580.1|AW745580 WS1_35_G03.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 522
Score = 95.6 bits (48), Expect = 4e-018
Identities = 105/124 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 136 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 77
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 76 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 17
Query: 372 agat 375
||||
Sbjct: 16 agat 13
>gb|AW746007.1|AW746007 WS1_38_G07.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 577
Score = 95.6 bits (48), Expect = 4e-018
Identities = 105/124 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 184 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 125
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 124 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 65
Query: 372 agat 375
||||
Sbjct: 64 agat 61
>gb|BF176779.1|BF176779 EM1_1_C01.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 523
Score = 95.6 bits (48), Expect = 4e-018
Identities = 105/124 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 165 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 106
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 105 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 46
Query: 372 agat 375
||||
Sbjct: 45 agat 42
>gb|BG556553.1|BG556553 EM1_38_F11.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 380
Score = 95.6 bits (48), Expect = 4e-018
Identities = 105/124 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 181 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 122
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 121 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 62
Query: 372 agat 375
||||
Sbjct: 61 agat 58
>gb|BM329475.1|BM329475 PIC1_38_E05.g1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 579
Score = 95.6 bits (48), Expect = 4e-018
Identities = 105/124 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 187 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 128
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| |||||| |||
Sbjct: 127 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttcagat 68
Query: 372 agat 375
||||
Sbjct: 67 agat 64
>gb|CD206377.1|CD206377 HS1_22_H09.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_22_H09_A012 3', mRNA sequence
Length = 508
Score = 95.6 bits (48), Expect = 4e-018
Identities = 99/116 (85%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 116 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 57
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttc 367
|| ||||| | || ||| ||| ||||||||||| |||||||||||||||||||||
Sbjct: 56 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccatcttcttc 1
>gb|CD208214.1|CD208214 HS1_32_H02.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_32_H02_A012 3', mRNA sequence
Length = 519
Score = 95.6 bits (48), Expect = 4e-018
Identities = 99/116 (85%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 116 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 57
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttc 367
|| ||||| | || ||| ||| ||||||||||| |||||||||||||||||||||
Sbjct: 56 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccatcttcttc 1
>gb|CD210866.1|CD210866 HS1_66_E04.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_66_E04_A012 3', mRNA sequence
Length = 582
Score = 95.6 bits (48), Expect = 4e-018
Identities = 105/124 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||| ||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 170 ccctcgtctcccgggtgtcgtaggagctgcacccggggcacttctgccccagcacgtgga 111
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| ||||||||||||||||||||| |||
Sbjct: 110 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccatcttcttcagat 51
Query: 372 agat 375
||||
Sbjct: 50 agat 47
>gb|CB927927.1|CB927927 ABA1_35_B03.b1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_35_B03_A012 3', mRNA sequence
Length = 536
Score = 93.7 bits (47), Expect = 2e-017
Identities = 98/115 (85%)
Strand = Plus / Minus
Query: 253 cctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtggaa 312
|||||||| |||||||||||| |||||||| || |||||||| ||| ||| | ||||||
Sbjct: 117 cctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtggaa 58
Query: 313 ctgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttc 367
| ||||| | || ||| ||| ||||||||||| |||||||||||||||||||||
Sbjct: 57 ccgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccatcttcttc 3
>gb|CD229448.1|CD229448 CCC1_15_C04.g1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_15_C04_A007 5', mRNA sequence
Length = 623
Score = 89.7 bits (45), Expect = 3e-016
Identities = 117/141 (82%)
Strand = Plus / Minus
Query: 451 gcacaccgggcatgaaaactgctggtgcgctctcatctcgtaaaggcattccaggtggat 510
|||||||||||| || || || ||||||||||||||||||| | ||| ||||| || ||
Sbjct: 622 gcacaccgggcacgagaagtgatggtgcgctctcatctcgttcatgcactccagatgaat 563
Query: 511 ggtgtgtccgcagtggagcacgctgatagctttcatcgagtcgaatagatactccatgca 570
||||| ||||| || ||||| ||||| | || | |||||||| |||||||| | |||
Sbjct: 562 tgtgtgcccgcattgcagcacactgatgtcctttgtggagtcgaacagatactcgaagca 503
Query: 571 gacagggcagttgtgatgcat 591
|||||||||||||||||||||
Sbjct: 502 gacagggcagttgtgatgcat 482
>gb|BG557713.1|BG557713 EM1_55_H03.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 463
Score = 87.7 bits (44), Expect = 1e-015
Identities = 98/116 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 119 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 60
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttc 367
|| ||||| | || ||| ||| ||||||||||| |||||||||||||| ||||||
Sbjct: 59 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccattttcttc 4
>gb|CD227529.1|CD227529 CCC1_52_F07.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_52_F07_A007 3', mRNA sequence
Length = 596
Score = 87.7 bits (44), Expect = 1e-015
Identities = 104/124 (83%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 184 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 125
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccatcttcttctgat 371
|| ||||| | || ||| ||| ||||||||||| |||||| ||||||| |||||| |||
Sbjct: 124 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatcaataccattttcttcagat 65
Query: 372 agat 375
||||
Sbjct: 64 agat 61
>gb|CN134496.1|CN134496 OX1_26_E07.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_26_E07_A002 5', mRNA sequence
Length = 746
Score = 87.7 bits (44), Expect = 1e-015
Identities = 116/140 (82%)
Strand = Plus / Minus
Query: 452 cacaccgggcatgaaaactgctggtgcgctctcatctcgtaaaggcattccaggtggatg 511
||||||||||| || || || ||||||||||||||||||| | ||| ||||| || ||
Sbjct: 746 cacaccgggcacgagaagtgatggtgcgctctcatctcgttcatgcactccagatgaatt 687
Query: 512 gtgtgtccgcagtggagcacgctgatagctttcatcgagtcgaatagatactccatgcag 571
||||| ||||| || ||||| ||||| | || | |||||||| |||||||| | ||||
Sbjct: 686 gtgtgcccgcattgcagcacactgatgtcctttgtggagtcgaacagatactcgaagcag 627
Query: 572 acagggcagttgtgatgcat 591
||||||||||||||||||||
Sbjct: 626 acagggcagttgtgatgcat 607
>gb|AW678450.1|AW678450 WS1_16_A05.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 531
Score = 81.8 bits (41), Expect = 7e-014
Identities = 92/109 (84%)
Strand = Plus / Minus
Query: 252 ccctcgtctgccgggtgttgtaagagctgcatccagggcacttgtgcgccaagatgtgga 311
||||||||| |||||||||||| |||||||| || |||||||| ||| ||| | |||||
Sbjct: 121 ccctcgtctcccgggtgttgtaggagctgcacccggggcacttctgccccagcacgtgga 62
Query: 312 actgcacgttggacgtcacgccacagtcgttgcaaaggatccataccat 360
|| ||||| | || ||| ||| ||||||||||| ||||||||||||||
Sbjct: 61 accgcacgctcgaggtcgcgctgcagtcgttgcacaggatccataccat 13
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 122,559
Number of Sequences: 832831
Number of extensions: 122559
Number of successful extensions: 33421
Number of sequences better than 0.5: 78
Number of HSP's better than 0.5 without gapping: 78
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33313
Number of HSP's gapped (non-prelim): 92
length of query: 592
length of database: 491,359,669
effective HSP length: 19
effective length of query: 573
effective length of database: 475,535,880
effective search space: 272482059240
effective search space used: 272482059240
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)