BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3671909.2.1
(767 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW350302.1|CW350302 fsbb001f011i17f0 Sorghum methylation... 613 e-173
gb|CW235306.1|CW235306 104_690_11214911_148_37413_088 Sorgh... 517 e-145
gb|CW235305.1|CW235305 104_690_11214911_116_37409_088 Sorgh... 484 e-135
gb|CW065653.1|CW065653 104_312_10523266_114_30129 Sorghum m... 474 e-132
gb|CW350303.1|CW350303 fsbb001f011i17k0 Sorghum methylation... 174 8e-042
gb|CW433885.1|CW433885 fsbb001f149f03k0 Sorghum methylation... 80 3e-013
gb|CN126076.1|CN126076 RHOH1_15_B06.b1_A002 Acid- and alkal... 78 1e-012
gb|CX608661.1|CX608661 ANR1_40_A09.b1_A002 Anaerobic roots ... 78 1e-012
gb|CX610538.1|CX610538 ANR1_19_G09.b1_A002 Anaerobic roots ... 78 1e-012
gb|CX611043.1|CX611043 ANR1_22_G05.b1_A002 Anaerobic roots ... 78 1e-012
gb|CX611163.1|CX611163 ANR1_23_B06.b1_A002 Anaerobic roots ... 78 1e-012
gb|CX622143.1|CX622143 GABR1_62_F09.b2_A002 GA- or brassino... 78 1e-012
gb|BZ693496.1|BZ693496 SP__Ba0035C24.r SP__Ba Sorghum propi... 68 1e-009
gb|CW787486.1|CW787486 SP__Ba0035C24.r SP__Ba Sorghum propi... 68 1e-009
gb|CW164995.1|CW164995 104_573_11152274_116_36471_011 Sorgh... 64 2e-008
gb|CW282233.1|CW282233 104_758_11408605_116_35465_059 Sorgh... 64 2e-008
gb|CW282234.1|CW282234 104_758_11408605_148_35469_059 Sorgh... 64 2e-008
gb|CW490044.1|CW490044 fsbb001f275e17f0 Sorghum methylation... 64 2e-008
gb|CW490045.1|CW490045 fsbb001f275e17k0 Sorghum methylation... 64 2e-008
gb|CW492088.1|CW492088 fsbb001f282d15f0 Sorghum methylation... 64 2e-008
gb|BM328505.1|BM328505 PIC1_30_A06.g1_A002 Pathogen-infecte... 64 2e-008
gb|AC152913.1| Sorghum bicolor clone SB106M24, *** SEQUENCI... 64 2e-008
gb|CW160541.1|CW160541 104_567_11149941_148_36416_093 Sorgh... 62 8e-008
gb|CW217269.1|CW217269 104_650_11195567_116_37133_090 Sorgh... 62 8e-008
gb|CW299767.1|CW299767 104_782_11463292_116_35690_002 Sorgh... 62 8e-008
gb|CD234358.1|CD234358 SS1_27_F09.b1_A012 Salt-stressed see... 62 8e-008
gb|CD235841.1|CD235841 SS1_24_A12.b1_A012 Salt-stressed see... 62 8e-008
gb|CW114112.1|CW114112 104_488_11105818_148_34562_035 Sorgh... 60 3e-007
gb|CW236515.1|CW236515 104_692_11215656_148_37499_088 Sorgh... 60 3e-007
gb|CW495343.1|CW495343 fsbb001f287b06k0 Sorghum methylation... 60 3e-007
gb|CF430968.1|CF430968 NIT1_4_H07.b1_A002 Nitrogen-deficien... 60 3e-007
gb|CX608327.1|CX608327 ANR1_38_A09.b1_A002 Anaerobic roots ... 60 3e-007
gb|CX610385.1|CX610385 ANR1_18_H06.b1_A002 Anaerobic roots ... 60 3e-007
gb|CX621268.1|CX621268 GABR1_57_D03.b1_A002 GA- or brassino... 60 3e-007
gb|CX622848.1|CX622848 GABR1_66_G09.b1_A002 GA- or brassino... 60 3e-007
gb|CW323131.1|CW323131 104_817_11476470_148_35959_027 Sorgh... 58 1e-006
gb|CW209240.1|CW209240 104_639_11189127_148_36990_062 Sorgh... 54 2e-005
gb|CW327211.1|CW327211 104_822_11478626_148_35969_001 Sorgh... 54 2e-005
gb|CW338725.1|CW338725 104_839_11484895_116_36134_030 Sorgh... 54 2e-005
gb|CW338726.1|CW338726 104_839_11484895_148_36135_030 Sorgh... 54 2e-005
gb|CW404591.1|CW404591 fsbb001f096m18k0 Sorghum methylation... 54 2e-005
gb|CD226356.1|CD226356 CCC1_45_B06.b1_A007 Callus culture/c... 54 2e-005
gb|CD425621.1|CD425621 SA1_13_G02.b1_A002 Salicylic acid-tr... 54 2e-005
gb|CD425931.1|CD425931 SA1_15_G02.b1_A002 Salicylic acid-tr... 54 2e-005
gb|CD427687.1|CD427687 SA1_38_D02.b1_A002 Salicylic acid-tr... 54 2e-005
gb|AY675075.1| Sorghum bicolor flavonoid 3'-hydroxylase mRN... 54 2e-005
gb|AY675076.1| Sorghum bicolor flavonoid 3'-hydroxylase gen... 54 2e-005
gb|CL170464.1|CL170464 104_371_10813835_148_31790_155 Sorgh... 52 8e-005
gb|CL195525.1|CL195525 104_421_10942439_114_32308_096 Sorgh... 52 8e-005
gb|CW118551.1|CW118551 104_495_11108272_116_34625_062 Sorgh... 52 8e-005
gb|CW294837.1|CW294837 104_775_11415396_116_36233_034 Sorgh... 52 8e-005
gb|CW294838.1|CW294838 104_775_11415396_148_36234_034 Sorgh... 52 8e-005
gb|CW345966.1|CW345966 104_849_11488777_148_36218_011 Sorgh... 52 8e-005
gb|BE366751.1|BE366751 PI1_3_F06.g1_A002 Pathogen induced 1... 52 8e-005
gb|BM318020.1|BM318020 PI1_36_E06.g9_A002 Pathogen induced ... 52 8e-005
gb|CF427182.1|CF427182 PH1_4_G10.b1_A002 Phosphorous-defici... 52 8e-005
gb|CX609853.1|CX609853 ANR1_15_D06.b1_A002 Anaerobic roots ... 52 8e-005
gb|CW065654.1|CW065654 104_312_10523266_115_30130 Sorghum m... 50 3e-004
gb|CW460451.1|CW460451 fsbb001f207k13f0 Sorghum methylation... 50 3e-004
gb|CF430086.1|CF430086 PH1_26_E06.b1_A002 Phosphorous-defic... 50 3e-004
gb|CL155528.1|CL155528 104_341_10782204_114_31471_300 Sorgh... 48 0.001
gb|CL155529.1|CL155529 104_341_10782204_116_31472_300 Sorgh... 48 0.001
gb|CL162895.1|CL162895 104_355_10806747_114_31832_267 Sorgh... 48 0.001
gb|CW028142.1|CW028142 104_255_10498916_116_30393 Sorghum m... 48 0.001
gb|CW217293.1|CW217293 104_650_11195580_116_37132_040 Sorgh... 48 0.001
gb|CW237418.1|CW237418 104_693_11216154_148_37516_067 Sorgh... 48 0.001
gb|CW318281.1|CW318281 104_810_11473865_148_35869_073 Sorgh... 48 0.001
gb|CW441478.1|CW441478 fsbb001f160k09k0 Sorghum methylation... 48 0.001
gb|CL703376.2|CL703376 SP__Ba0095M14.r SP__Ba Sorghum propi... 48 0.001
gb|AW285279.1|AW285279 LG1_237_B03.g1_A002 Light Grown 1 (L... 48 0.001
gb|AW680035.1|AW680035 WS1_3_H10.g1_A002 Water-stressed 1 (... 48 0.001
gb|BF480873.1|BF480873 FM1_14_D03.g1_A003 Floral-Induced Me... 48 0.001
gb|BF705056.1|BF705056 RHIZ2_1_H06.g1_A003 Rhizome2 (RHIZ2)... 48 0.001
gb|BG052600.1|BG052600 RHIZ2_25_F08.g1_A003 Rhizome2 (RHIZ2... 48 0.001
gb|BG053297.1|BG053297 RHIZ2_25_F08.b1_A003 Rhizome2 (RHIZ2... 48 0.001
gb|BG101809.1|BG101809 RHIZ2_22_F11.g1_A003 Rhizome2 (RHIZ2... 48 0.001
gb|BG102350.1|BG102350 RHIZ2_22_F11.b1_A003 Rhizome2 (RHIZ2... 48 0.001
gb|BG103168.1|BG103168 RHIZ2_19_A04.g1_A003 Rhizome2 (RHIZ2... 48 0.001
gb|BG410862.1|BG410862 EM1_26_H03.g1_A002 Embryo 1 (EM1) So... 48 0.001
gb|CD235671.1|CD235671 SS1_37_E06.b1_A012 Salt-stressed see... 48 0.001
gb|CL179027.1|CL179027 104_387_10895001_116_31906_297 Sorgh... 46 0.005
gb|CL179028.1|CL179028 104_387_10895001_148_31905_297 Sorgh... 46 0.005
gb|CL179129.1|CL179129 104_388_10895098_148_31909_010 Sorgh... 46 0.005
gb|CW114223.1|CW114223 104_488_11105877_148_34561_081 Sorgh... 46 0.005
gb|CW120287.1|CW120287 104_497_11109242_116_34643_005 Sorgh... 46 0.005
gb|CW126787.1|CW126787 104_507_11113083_116_34734_006 Sorgh... 46 0.005
gb|CW179942.1|CW179942 104_594_11160375_148_36632_060 Sorgh... 46 0.005
gb|CW231566.1|CW231566 104_680_11211189_148_37337_081 Sorgh... 46 0.005
gb|CW232735.1|CW232735 104_685_11212981_116_37365_055 Sorgh... 46 0.005
gb|CW328891.1|CW328891 104_825_11479547_116_36006_044 Sorgh... 46 0.005
gb|CW393358.1|CW393358 fsbb001f080g02k0 Sorghum methylation... 46 0.005
gb|CW416553.1|CW416553 fsbb001f117c13k0 Sorghum methylation... 46 0.005
gb|CW448556.1|CW448556 fsbb001f182d20k0 Sorghum methylation... 46 0.005
gb|CW457787.1|CW457787 fsbb001f203m03f0 Sorghum methylation... 46 0.005
gb|BE600290.1|BE600290 PI1_94_F03.g1_A002 Pathogen induced ... 46 0.005
gb|BG048287.1|BG048287 OV1_16_C09.g1_A002 Ovary 1 (OV1) Sor... 46 0.005
gb|BM317850.1|BM317850 OV1_16_C09.b9_A002 Ovary 1 (OV1) Sor... 46 0.005
gb|CN138190.1|CN138190 OX1_62_F08.b1_A002 Oxidatively-stres... 46 0.005
gb|CX609898.1|CX609898 ANR1_15_H11.b1_A002 Anaerobic roots ... 46 0.005
gb|CX617021.1|CX617021 GABR1_31_F03.b1_A002 GA- or brassino... 46 0.005
gb|CW056786.1|CW056786 104_298_10517869_115_30157 Sorghum m... 44 0.019
gb|CW084589.1|CW084589 104_427_10945885_116_32509_055 Sorgh... 44 0.019
gb|CW102225.1|CW102225 104_470_11011227_116_34418_010 Sorgh... 44 0.019
gb|CW132069.1|CW132069 104_515_11116013_148_34794_027 Sorgh... 44 0.019
gb|CW231895.1|CW231895 104_681_11211369_148_37349_041 Sorgh... 44 0.019
gb|CW264501.1|CW264501 104_733_11231332_116_35254_010 Sorgh... 44 0.019
gb|CW282425.1|CW282425 104_758_11408705_116_35465_071 Sorgh... 44 0.019
gb|CW282426.1|CW282426 104_758_11408705_148_35469_071 Sorgh... 44 0.019
gb|CW389731.1|CW389731 fsbb001f075b04k0 Sorghum methylation... 44 0.019
gb|CW423802.1|CW423802 fsbb001f133m22f0 Sorghum methylation... 44 0.019
gb|CN132121.1|CN132121 OX1_4_E09.b1_A002 Oxidatively-stress... 44 0.019
gb|AC169377.3| Sorghum bicolor clone SB_BBc0068O12, WORKING... 44 0.019
gb|AC169379.4| Sorghum bicolor clone SB_BBc0088B22, complet... 44 0.019
gb|BZ339043.1|BZ339043 ic29c07.g1 WGS-SbicolorF (JM107 adap... 42 0.074
gb|CL155931.1|CL155931 104_342_10782507_116_31474_219 Sorgh... 42 0.074
gb|CL166631.1|CL166631 104_362_10809500_114_31798_332 Sorgh... 42 0.074
gb|CL166632.1|CL166632 104_362_10809500_116_31799_332 Sorgh... 42 0.074
gb|CL193600.1|CL193600 104_417_10941045_114_32273_089 Sorgh... 42 0.074
gb|CW101296.1|CW101296 104_469_11004568_148_34411_064 Sorgh... 42 0.074
gb|CW115513.1|CW115513 104_490_11106601_116_34592_003 Sorgh... 42 0.074
gb|CW115514.1|CW115514 104_490_11106601_148_34588_003 Sorgh... 42 0.074
gb|CW122221.1|CW122221 104_501_11110531_116_34677_080 Sorgh... 42 0.074
gb|CW186956.1|CW186956 104_605_11166836_148_36715_078 Sorgh... 42 0.074
gb|CW216764.1|CW216764 104_649_11195288_148_37123_020 Sorgh... 42 0.074
gb|CW221670.1|CW221670 104_656_11198034_148_37170_065 Sorgh... 42 0.074
gb|CW257988.1|CW257988 104_723_11227632_148_35157_086 Sorgh... 42 0.074
gb|CW258921.1|CW258921 104_725_11228142_116_35185_031 Sorgh... 42 0.074
gb|CW420255.1|CW420255 fsbb001f126h21k0 Sorghum methylation... 42 0.074
gb|AW922486.1|AW922486 DG1_19_B12.g1_A002 Dark Grown 1 (DG1... 42 0.074
gb|AW923050.1|AW923050 DG1_48_G09.g1_A002 Dark Grown 1 (DG1... 42 0.074
gb|AW924514.1|AW924514 WS1_70_D03.b1_A002 Water-stressed 1 ... 42 0.074
gb|AW924624.1|AW924624 WS1_70_D03.g1_A002 Water-stressed 1 ... 42 0.074
gb|BE355046.1|BE355046 DG1_10_C09.g1_A002 Dark Grown 1 (DG1... 42 0.074
gb|BE599255.1|BE599255 PI1_87_C08.g1_A002 Pathogen induced ... 42 0.074
gb|BG411884.1|BG411884 OV2_39_C12.g1_A002 Ovary 2 (OV2) Sor... 42 0.074
gb|BG412221.1|BG412221 OV2_39_C12.b1_A002 Ovary 2 (OV2) Sor... 42 0.074
gb|BM318754.1|BM318754 PI1_15_B11.g1_A002 Pathogen induced ... 42 0.074
gb|CD206203.1|CD206203 HS1_21_A02.b1_A012 Heat-shocked seed... 42 0.074
gb|CD424724.1|CD424724 SA1_7_C12.b1_A002 Salicylic acid-tre... 42 0.074
gb|CD425086.1|CD425086 SA1_10_A05.b1_A002 Salicylic acid-tr... 42 0.074
gb|CD427407.1|CD427407 SA1_30_F07.b1_A002 Salicylic acid-tr... 42 0.074
gb|CF761743.1|CF761743 DSAF1_80_D01.g1_A011 Drought-stresse... 42 0.074
gb|CF770506.1|CF770506 DSBF1_8_D11.b1_A010 Drought-stressed... 42 0.074
gb|CF772746.1|CF772746 DSBF1_38_H04.g1_A010 Drought-stresse... 42 0.074
gb|CN133884.1|CN133884 OX1_19_A01.b1_A002 Oxidatively-stres... 42 0.074
gb|CN143955.1|CN143955 WOUND1_19_H05.b1_A002 Wounded leaves... 42 0.074
gb|CN144556.1|CN144556 WOUND1_23_D02.b1_A002 Wounded leaves... 42 0.074
gb|CX607513.1|CX607513 ANR1_29_D09.b1_A002 Anaerobic roots ... 42 0.074
gb|BZ423254.1|BZ423254 id47b10.g1 WGS-SbicolorF (DH5a methy... 40 0.29
gb|CL153773.1|CL153773 104_338_10780950_116_31370_198 Sorgh... 40 0.29
gb|CL170439.1|CL170439 104_371_10813812_148_31790_132 Sorgh... 40 0.29
gb|CW036870.1|CW036870 104_268_10504018_115_30382 Sorghum m... 40 0.29
gb|CW056270.1|CW056270 104_297_10517593_115_30173 Sorghum m... 40 0.29
gb|CW063302.1|CW063302 104_309_10521924_114_30136 Sorghum m... 40 0.29
gb|CW071224.1|CW071224 104_323_10591430_116_30545 Sorghum m... 40 0.29
gb|CW071344.1|CW071344 104_323_10591480_114_30474 Sorghum m... 40 0.29
gb|CW071345.1|CW071345 104_323_10591480_116_30439 Sorghum m... 40 0.29
gb|CW084588.1|CW084588 104_427_10945885_114_32505_055 Sorgh... 40 0.29
gb|CW119823.1|CW119823 104_497_11108979_116_34640_016 Sorgh... 40 0.29
gb|CW150998.1|CW150998 104_551_11143708_148_36313_006 Sorgh... 40 0.29
gb|CW207619.1|CW207619 104_636_11188248_116_36976_082 Sorgh... 40 0.29
gb|CW207620.1|CW207620 104_636_11188248_148_36968_082 Sorgh... 40 0.29
gb|CW306361.1|CW306361 104_792_11466798_148_35716_031 Sorgh... 40 0.29
gb|CW317277.1|CW317277 104_809_11473330_148_35866_047 Sorgh... 40 0.29
gb|CW350845.1|CW350845 fsbb001f012f16k0 Sorghum methylation... 40 0.29
gb|CW360775.1|CW360775 fsbb001f029a12f0 Sorghum methylation... 40 0.29
gb|CW408891.1|CW408891 fsbb001f102p14f0 Sorghum methylation... 40 0.29
gb|CW430164.1|CW430164 fsbb001f143l23k0 Sorghum methylation... 40 0.29
gb|CW455212.1|CW455212 fsbb001f199p21k0 Sorghum methylation... 40 0.29
gb|CW467911.1|CW467911 fsbb001f219m18f0 Sorghum methylation... 40 0.29
gb|CW469510.1|CW469510 fsbb001f222e09k0 Sorghum methylation... 40 0.29
gb|AW565784.1|AW565784 LG1_349_C06.g1_A002 Light Grown 1 (L... 40 0.29
gb|BE364242.1|BE364242 PI1_12_E01.g1_A002 Pathogen induced ... 40 0.29
gb|BG557998.1|BG557998 RHIZ2_65_B12.g1_A003 Rhizome2 (RHIZ2... 40 0.29
gb|BM325510.1|BM325510 PIC1_45_D11.b1_A002 Pathogen-infecte... 40 0.29
gb|BM329960.1|BM329960 PIC1_45_D11.g1_A002 Pathogen-infecte... 40 0.29
>gb|CW350302.1|CW350302 fsbb001f011i17f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f011i17, DNA
sequence
Length = 752
Score = 613 bits (309), Expect = e-173
Identities = 406/437 (92%), Gaps = 6/437 (1%)
Strand = Plus / Plus
Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380
||||||||||||||||| | |||||| |||||||||||||||||||||| || ||||
Sbjct: 255 cggcgattagacaccgg---cggggaggggcacgcggaggatggggcggaggaggaggtt 311
Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440
|||||||||||||||||||||||| |||||||||| |||||||||||||||||| || ||
Sbjct: 312 ggccttccgtctcgcggtgatgccgaacgcctcggtcatgtcgaactcggcgggttcgga 371
Query: 441 cacgccgggcgcctcccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgtt 500
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 372 cacgccgggcgcctcccagtcgaagtggaacagcaggctggcgagcgcgagctcgacgtt 431
Query: 501 ggcgagcccgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctc 560
|||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 432 ggcgagcccgaacgacatccccgggcacatcctccggccggcgccgaacggcaggagctc 491
Query: 561 gaagtcggcgcccttgaactccaccgcgctggcc---tcggcctcgaaccgctcggggcg 617
|||||||||||||||||||||||| ||||||||| |||| ||||||||||||||| ||
Sbjct: 492 gaagtcggcgcccttgaactccacggcgctggcctcgtcggtctcgaaccgctcgggccg 551
Query: 618 gaactcctcggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttcac 677
|||||||||||||||||| | ||||||||| |||||||||||||||||||||||||| ||
Sbjct: 552 gaactcctcggggtcgccggaccagtacctcccgtcgcggcccagcgcccagacgttgac 611
Query: 678 cagcacggtggtgcccgcaggcacgtcgtagcccagcacgcgacgcggctcctgggactg 737
||||||||||||||||| |||||||||||||| |||||||| | |||||||||||||||
Sbjct: 612 gagcacggtggtgcccgccggcacgtcgtagccgagcacgcggcacggctcctgggactg 671
Query: 738 ccgcgggagcagcagcg 754
|||||||||||||||||
Sbjct: 672 ccgcgggagcagcagcg 688
Score = 52.0 bits (26), Expect = 8e-005
Identities = 42/46 (91%), Gaps = 1/46 (2%)
Strand = Plus / Plus
Query: 152 aacaggtaggtccataatgtagatgggctttggacctatcgttctt 197
|||| ||||| ||||||||||||||||| |||||||||| ||||||
Sbjct: 71 aacaagtaggcccataatgtagatgggc-ttggacctattgttctt 115
>gb|CW235306.1|CW235306 104_690_11214911_148_37413_088 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214911, DNA
sequence
Length = 571
Score = 517 bits (261), Expect = e-145
Identities = 346/373 (92%), Gaps = 6/373 (1%)
Strand = Plus / Plus
Query: 321 cggcgattagacaccgggaacagggaggcgcacgcggaggatggggcggagtagcaggtc 380
||||||||||||||||| | |||||| |||||||||||||||||||||| || ||||
Sbjct: 202 cggcgattagacaccgg---cggggaggggcacgcggaggatggggcggaggaggaggtt 258
Query: 381 ggccttccgtctcgcggtgatgccaaacgcctcggccatgtcgaactcggcggggtcaga 440
|||||||||||||||||||||||| |||||||||| |||||||||||||||||| || ||
Sbjct: 259 ggccttccgtctcgcggtgatgccgaacgcctcggtcatgtcgaactcggcgggttcgga 318
Query: 441 cacgccgggcgcctcccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgtt 500
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 319 cacgccgggcgcctcccagtcgaagtggaacagcaggctggcgagcgcgagctcgacgtt 378
Query: 501 ggcgagcccgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctc 560
|||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||
Sbjct: 379 ggcgagcccgaacgacatccccgggcacatcctccggccggcgccgaacggcaggagctc 438
Query: 561 gaagtcggcgcccttgaactccaccgcgctggcc---tcggcctcgaaccgctcggggcg 617
|||||||||||||||||||||||| ||||||||| |||| ||||||||||||||| ||
Sbjct: 439 gaagtcggcgcccttgaactccacggcgctggcctcgtcggtctcgaaccgctcgggccg 498
Query: 618 gaactcctcggggtcgcccggccagtacctgccgtcgcggcccagcgcccagacgttcac 677
|||||||||||||||||| | ||||||||| |||||||||||||||||||||||||| ||
Sbjct: 499 gaactcctcggggtcgccggaccagtacctcccgtcgcggcccagcgcccagacgttgac 558
Query: 678 cagcacggtggtg 690
||||||||||||
Sbjct: 559 gagcacggtggtg 571
Score = 52.0 bits (26), Expect = 8e-005
Identities = 42/46 (91%), Gaps = 1/46 (2%)
Strand = Plus / Plus
Query: 152 aacaggtaggtccataatgtagatgggctttggacctatcgttctt 197
|||| ||||| ||||||||||||||||| |||||||||| ||||||
Sbjct: 18 aacaagtaggcccataatgtagatgggc-ttggacctattgttctt 62
>gb|CW235305.1|CW235305 104_690_11214911_116_37409_088 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214911, DNA
sequence
Length = 577
Score = 484 bits (244), Expect = e-135
Identities = 309/330 (93%), Gaps = 3/330 (0%)
Strand = Plus / Minus
Query: 428 cggcggggtcagacacgccgggcgcctcccagtcgaagtggaacagaaggctggcgagcg 487
||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 577 cggcgggttcggacacgccgggcgcctcccagtcgaagtggaacagcaggctggcgagcg 518
Query: 488 cgagctcgacgttggcgagcccgaacgccatgcccggacacatcctccggccggcgccga 547
||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||
Sbjct: 517 cgagctcgacgttggcgagcccgaacgacatccccgggcacatcctccggccggcgccga 458
Query: 548 acggcaggagctcgaagtcggcgcccttgaactccaccgcgctggcc---tcggcctcga 604
||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||
Sbjct: 457 acggcaggagctcgaagtcggcgcccttgaactccacggcgctggcctcgtcggtctcga 398
Query: 605 accgctcggggcggaactcctcggggtcgcccggccagtacctgccgtcgcggcccagcg 664
|||||||||| |||||||||||||||||||| | ||||||||| ||||||||||||||||
Sbjct: 397 accgctcgggccggaactcctcggggtcgccggaccagtacctcccgtcgcggcccagcg 338
Query: 665 cccagacgttcaccagcacggtggtgcccgcaggcacgtcgtagcccagcacgcgacgcg 724
|||||||||| || ||||||||||||||||| |||||||||||||| |||||||| | ||
Sbjct: 337 cccagacgttgacgagcacggtggtgcccgccggcacgtcgtagccgagcacgcggcacg 278
Query: 725 gctcctgggactgccgcgggagcagcagcg 754
||||||||||||||||||||||||||||||
Sbjct: 277 gctcctgggactgccgcgggagcagcagcg 248
>gb|CW065653.1|CW065653 104_312_10523266_114_30129 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10523266, DNA
sequence
Length = 325
Score = 474 bits (239), Expect = e-132
Identities = 304/325 (93%), Gaps = 3/325 (0%)
Strand = Plus / Plus
Query: 421 tcgaactcggcggggtcagacacgccgggcgcctcccagtcgaagtggaacagaaggctg 480
|||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1 tcgaactcggcgggttcggacacgccgggcgcctcccagtcgaagtggaacagcaggctg 60
Query: 481 gcgagcgcgagctcgacgttggcgagcccgaacgccatgcccggacacatcctccggccg 540
|||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||
Sbjct: 61 gcgagcgcgagctcgacgttggcgagcccgaacgacatccccgggcacatcctccggccg 120
Query: 541 gcgccgaacggcaggagctcgaagtcggcgcccttgaactccaccgcgctggcc---tcg 597
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||
Sbjct: 121 gcgccgaacggcaggagctcgaagtcggcgcccttgaactccacggcgctggcctcgtcg 180
Query: 598 gcctcgaaccgctcggggcggaactcctcggggtcgcccggccagtacctgccgtcgcgg 657
| ||||||||||||||| |||||||||||||||||||| | ||||||||| |||||||||
Sbjct: 181 gtctcgaaccgctcgggccggaactcctcggggtcgccggaccagtacctcccgtcgcgg 240
Query: 658 cccagcgcccagacgttcaccagcacggtggtgcccgcaggcacgtcgtagcccagcacg 717
||||||||||||||||| || ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 241 cccagcgcccagacgttgacgagcacggtggtgcccgccggcacgtcgtagccgagcacg 300
Query: 718 cgacgcggctcctgggactgccgcg 742
|| | ||||||||||||||||||||
Sbjct: 301 cggcacggctcctgggactgccgcg 325
>gb|CW350303.1|CW350303 fsbb001f011i17k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f011i17, DNA
sequence
Length = 611
Score = 174 bits (88), Expect = 8e-042
Identities = 109/116 (93%)
Strand = Plus / Minus
Query: 639 ccagtacctgccgtcgcggcccagcgcccagacgttcaccagcacggtggtgcccgcagg 698
||||||||| |||||||||||||||||||||||||| || ||||||||||||||||| ||
Sbjct: 611 ccagtacctcccgtcgcggcccagcgcccagacgttgacgagcacggtggtgcccgccgg 552
Query: 699 cacgtcgtagcccagcacgcgacgcggctcctgggactgccgcgggagcagcagcg 754
|||||||||||| |||||||| | ||||||||||||||||||||||||||||||||
Sbjct: 551 cacgtcgtagccgagcacgcggcacggctcctgggactgccgcgggagcagcagcg 496
>gb|CW433885.1|CW433885 fsbb001f149f03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f149f03, DNA
sequence
Length = 502
Score = 79.8 bits (40), Expect = 3e-013
Identities = 105/124 (84%), Gaps = 2/124 (1%)
Strand = Plus / Plus
Query: 456 ccagtcgaagtggaacag-aaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514
|||||||||||||||||| || || |||||||||||||||| || || ||||||||||
Sbjct: 219 ccagtcgaagtggaacagcaacgc-cgcgagcgcgagctcgatgtgagccagcccgaacg 277
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccct 574
|||||| || || |||| ||| ||||| |||||||| | || ||||||||||||||||
Sbjct: 278 tcatgccggggcagatccgccgcccggcaccgaacggtatgaactcgaagtcggcgcccc 337
Query: 575 tgaa 578
||||
Sbjct: 338 tgaa 341
>gb|CN126076.1|CN126076 RHOH1_15_B06.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_15_B06_A002 3', mRNA sequence
Length = 816
Score = 77.8 bits (39), Expect = 1e-012
Identities = 108/131 (82%)
Strand = Plus / Minus
Query: 455 cccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514
|||||||||||||||| || ||||| ||||| ||||||| | | |||||| || | ||
Sbjct: 555 cccagtcgaagtggaagaggaggctagcgagaccgagctccatgacggcgagtccaagcg 496
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccct 574
| ||||| || || |||||||| |||||||||||||||| || ||||||||| | ||||
Sbjct: 495 ctatgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtccgtgcccc 436
Query: 575 tgaactccacc 585
|||| ||||||
Sbjct: 435 tgaagtccacc 425
>gb|CX608661.1|CX608661 ANR1_40_A09.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_40_A09_A002 3', mRNA sequence
Length = 587
Score = 77.8 bits (39), Expect = 1e-012
Identities = 108/131 (82%)
Strand = Plus / Minus
Query: 455 cccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514
|||||||||||||||| || ||||| ||||| ||||||| | | |||||| || | ||
Sbjct: 323 cccagtcgaagtggaagaggaggctagcgagaccgagctccatgacggcgagtccaagcg 264
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccct 574
| ||||| || || |||||||| |||||||||||||||| || ||||||||| | ||||
Sbjct: 263 ctatgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtccgtgcccc 204
Query: 575 tgaactccacc 585
|||| ||||||
Sbjct: 203 tgaagtccacc 193
>gb|CX610538.1|CX610538 ANR1_19_G09.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_19_G09_A002 3', mRNA sequence
Length = 743
Score = 77.8 bits (39), Expect = 1e-012
Identities = 108/131 (82%)
Strand = Plus / Minus
Query: 455 cccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514
|||||||||||||||| || ||||| ||||| ||||||| | | |||||| || | ||
Sbjct: 493 cccagtcgaagtggaagaggaggctagcgagaccgagctccatgacggcgagtccaagcg 434
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccct 574
| ||||| || || |||||||| |||||||||||||||| || ||||||||| | ||||
Sbjct: 433 ctatgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtccgtgcccc 374
Query: 575 tgaactccacc 585
|||| ||||||
Sbjct: 373 tgaagtccacc 363
>gb|CX611043.1|CX611043 ANR1_22_G05.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_22_G05_A002 3', mRNA sequence
Length = 777
Score = 77.8 bits (39), Expect = 1e-012
Identities = 108/131 (82%)
Strand = Plus / Minus
Query: 455 cccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514
|||||||||||||||| || ||||| ||||| ||||||| | | |||||| || | ||
Sbjct: 517 cccagtcgaagtggaagaggaggctagcgagaccgagctccatgacggcgagtccaagcg 458
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccct 574
| ||||| || || |||||||| |||||||||||||||| || ||||||||| | ||||
Sbjct: 457 ctatgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtccgtgcccc 398
Query: 575 tgaactccacc 585
|||| ||||||
Sbjct: 397 tgaagtccacc 387
>gb|CX611163.1|CX611163 ANR1_23_B06.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_23_B06_A002 3', mRNA sequence
Length = 778
Score = 77.8 bits (39), Expect = 1e-012
Identities = 108/131 (82%)
Strand = Plus / Minus
Query: 455 cccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514
|||||||||||||||| || ||||| ||||| ||||||| | | |||||| || | ||
Sbjct: 576 cccagtcgaagtggaagaggaggctagcgagaccgagctccatgacggcgagtccaagcg 517
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccct 574
| ||||| || || |||||||| |||||||||||||||| || ||||||||| | ||||
Sbjct: 516 ctatgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtccgtgcccc 457
Query: 575 tgaactccacc 585
|||| ||||||
Sbjct: 456 tgaagtccacc 446
>gb|CX622143.1|CX622143 GABR1_62_F09.b2_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_62_F09_A002 3', mRNA sequence
Length = 735
Score = 77.8 bits (39), Expect = 1e-012
Identities = 108/131 (82%)
Strand = Plus / Minus
Query: 455 cccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccgaacg 514
|||||||||||||||| || ||||| ||||| ||||||| | | |||||| || | ||
Sbjct: 453 cccagtcgaagtggaagaggaggctagcgagaccgagctccatgacggcgagtccaagcg 394
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcggcgccct 574
| ||||| || || |||||||| |||||||||||||||| || ||||||||| | ||||
Sbjct: 393 ctatgccggggcagatcctccgtccggcgccgaacggcacgaactcgaagtccgtgcccc 334
Query: 575 tgaactccacc 585
|||| ||||||
Sbjct: 333 tgaagtccacc 323
>gb|BZ693496.1|BZ693496 SP__Ba0035C24.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0035C24 3', DNA sequence
Length = 1146
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Plus
Query: 509 cgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcgg 568
||||||||||||| || |||||||| || ||||| ||||||||| || ||||||||||
Sbjct: 529 cgaacgccatgccggggcacatcctgcgaccggctccgaacggcgtgaattcgaagtcgg 588
Query: 569 cgcccttgaa 578
||||||||||
Sbjct: 589 cgcccttgaa 598
>gb|CW787486.1|CW787486 SP__Ba0035C24.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0035C24 3', DNA sequence
Length = 862
Score = 67.9 bits (34), Expect = 1e-009
Identities = 61/70 (87%)
Strand = Plus / Plus
Query: 509 cgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcgg 568
||||||||||||| || |||||||| || ||||| ||||||||| || ||||||||||
Sbjct: 514 cgaacgccatgccggggcacatcctgcgaccggctccgaacggcgtgaattcgaagtcgg 573
Query: 569 cgcccttgaa 578
||||||||||
Sbjct: 574 cgcccttgaa 583
>gb|CW164995.1|CW164995 104_573_11152274_116_36471_011 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11152274, DNA
sequence
Length = 535
Score = 63.9 bits (32), Expect = 2e-008
Identities = 38/40 (95%)
Strand = Plus / Minus
Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565
|||||||||| |||||||||||||||||| ||||||||||
Sbjct: 460 cacatcctcctgccggcgccgaacggcagcagctcgaagt 421
>gb|CW282233.1|CW282233 104_758_11408605_116_35465_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11408605, DNA
sequence
Length = 651
Score = 63.9 bits (32), Expect = 2e-008
Identities = 38/40 (95%)
Strand = Plus / Plus
Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565
|||||||||| |||||||||||||||||| ||||||||||
Sbjct: 432 cacatcctcctgccggcgccgaacggcagcagctcgaagt 471
>gb|CW282234.1|CW282234 104_758_11408605_148_35469_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11408605, DNA
sequence
Length = 699
Score = 63.9 bits (32), Expect = 2e-008
Identities = 38/40 (95%)
Strand = Plus / Minus
Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565
|||||||||| |||||||||||||||||| ||||||||||
Sbjct: 522 cacatcctcctgccggcgccgaacggcagcagctcgaagt 483
>gb|CW490044.1|CW490044 fsbb001f275e17f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f275e17, DNA
sequence
Length = 655
Score = 63.9 bits (32), Expect = 2e-008
Identities = 38/40 (95%)
Strand = Plus / Plus
Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565
|||||||||| |||||||||||||||||| ||||||||||
Sbjct: 389 cacatcctcctgccggcgccgaacggcagcagctcgaagt 428
>gb|CW490045.1|CW490045 fsbb001f275e17k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f275e17, DNA
sequence
Length = 600
Score = 63.9 bits (32), Expect = 2e-008
Identities = 38/40 (95%)
Strand = Plus / Minus
Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565
|||||||||| |||||||||||||||||| ||||||||||
Sbjct: 532 cacatcctcctgccggcgccgaacggcagcagctcgaagt 493
>gb|CW492088.1|CW492088 fsbb001f282d15f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f282d15, DNA
sequence
Length = 629
Score = 63.9 bits (32), Expect = 2e-008
Identities = 50/56 (89%)
Strand = Plus / Minus
Query: 456 ccagtcgaagtggaacagaaggctggcgagcgcgagctcgacgttggcgagcccga 511
||||||||||||| | || |||||||| ||| ||||||||| ||||||||||||||
Sbjct: 412 ccagtcgaagtggtagaggaggctggccagcacgagctcgatgttggcgagcccga 357
Score = 44.1 bits (22), Expect = 0.019
Identities = 91/114 (79%)
Strand = Plus / Minus
Query: 599 cctcgaaccgctcggggcggaactcctcggggtcgcccggccagtacctgccgtcgcggc 658
||||||||||||| || | ||||||||||| |||| | ||||||| || ||| ||||
Sbjct: 263 cctcgaaccgctccggcctgaactcctcggcgtcgtcgtcccagtacttggggtcccggc 204
Query: 659 ccagcgcccagacgttcaccagcacggtggtgcccgcaggcacgtcgtagccca 712
|| |||||| ||||| || | ||||| |||||| ||||||||||||||||
Sbjct: 203 acaccgcccacacgttgacgaacacggccgtgcccttgggcacgtcgtagccca 150
>gb|BM328505.1|BM328505 PIC1_30_A06.g1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 606
Score = 63.9 bits (32), Expect = 2e-008
Identities = 38/40 (95%)
Strand = Plus / Minus
Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565
|||||||||| |||||||||||||||||| ||||||||||
Sbjct: 295 cacatcctcctgccggcgccgaacggcagcagctcgaagt 256
>gb|AC152913.1| Sorghum bicolor clone SB106M24, *** SEQUENCING IN PROGRESS ***, 7
ordered pieces
Length = 102187
Score = 63.9 bits (32), Expect = 2e-008
Identities = 38/40 (95%)
Strand = Plus / Plus
Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565
|||||||||| |||||||||||||||||| ||||||||||
Sbjct: 68749 cacatcctcctgccggcgccgaacggcagcagctcgaagt 68788
Score = 63.9 bits (32), Expect = 2e-008
Identities = 38/40 (95%)
Strand = Plus / Minus
Query: 526 cacatcctccggccggcgccgaacggcaggagctcgaagt 565
|||||||||| |||||||||||||||||| ||||||||||
Sbjct: 57972 cacatcctcctgccggcgccgaacggcagcagctcgaagt 57933
Score = 40.1 bits (20), Expect = 0.29
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 455 cccagtcgaagtggaacagaaggctggcgagcgcgagctcgacg 498
|||||||||||||| |||| ||||| || ||| | |||||||||
Sbjct: 82719 cccagtcgaagtggtacagcaggctcgccagcactagctcgacg 82762
Score = 40.1 bits (20), Expect = 0.29
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 455 cccagtcgaagtggaacagaaggctggcgagcgcgagctcgacg 498
||||||||||||| |||| | | | ||||||||||||||||||
Sbjct: 77557 cccagtcgaagtgatacagcaagtttgcgagcgcgagctcgacg 77600
>gb|CW160541.1|CW160541 104_567_11149941_148_36416_093 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11149941, DNA
sequence
Length = 715
Score = 61.9 bits (31), Expect = 8e-008
Identities = 37/39 (94%)
Strand = Plus / Plus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcg 567
||||||||||||||||||||||| | |||||||||||||
Sbjct: 452 atcctccggccggcgccgaacgggatgagctcgaagtcg 490
Score = 42.1 bits (21), Expect = 0.074
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 663 cgcccagacgttcaccagcacggtggtgcccgc 695
|||||| ||||||||||||| |||||||||||
Sbjct: 589 cgcccacacgttcaccagcagcgtggtgcccgc 621
>gb|CW217269.1|CW217269 104_650_11195567_116_37133_090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11195567, DNA
sequence
Length = 675
Score = 61.9 bits (31), Expect = 8e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcg 567
||||||||||||||||||||||| | |||||||||||||
Sbjct: 616 atcctccggccggcgccgaacgggatgagctcgaagtcg 578
Score = 42.1 bits (21), Expect = 0.074
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 663 cgcccagacgttcaccagcacggtggtgcccgc 695
|||||| ||||||||||||| |||||||||||
Sbjct: 479 cgcccacacgttcaccagcagcgtggtgcccgc 447
>gb|CW299767.1|CW299767 104_782_11463292_116_35690_002 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11463292, DNA
sequence
Length = 618
Score = 61.9 bits (31), Expect = 8e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcg 567
||||||||||||||||||||||| | |||||||||||||
Sbjct: 552 atcctccggccggcgccgaacgggatgagctcgaagtcg 514
Score = 42.1 bits (21), Expect = 0.074
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 663 cgcccagacgttcaccagcacggtggtgcccgc 695
|||||| ||||||||||||| |||||||||||
Sbjct: 415 cgcccacacgttcaccagcagcgtggtgcccgc 383
>gb|CD234358.1|CD234358 SS1_27_F09.b1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_27_F09_A012 3', mRNA sequence
Length = 650
Score = 61.9 bits (31), Expect = 8e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcg 567
||||||||||||||||||||||| | |||||||||||||
Sbjct: 220 atcctccggccggcgccgaacgggatgagctcgaagtcg 182
>gb|CD235841.1|CD235841 SS1_24_A12.b1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_24_A12_A012 3', mRNA sequence
Length = 587
Score = 61.9 bits (31), Expect = 8e-008
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcg 567
||||||||||||||||||||||| | |||||||||||||
Sbjct: 292 atcctccggccggcgccgaacgggatgagctcgaagtcg 254
>gb|CW114112.1|CW114112 104_488_11105818_148_34562_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11105818, DNA
sequence
Length = 710
Score = 60.0 bits (30), Expect = 3e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 509 cgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcgg 568
||||||||||||| || |||||||| || || || ||||||||| || ||||||||||
Sbjct: 436 cgaacgccatgccggggcacatcctgcgacctgctccgaacggcgtgaattcgaagtcgg 495
Query: 569 cgcccttgaa 578
||||||||||
Sbjct: 496 cgcccttgaa 505
>gb|CW236515.1|CW236515 104_692_11215656_148_37499_088 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11215656, DNA
sequence
Length = 687
Score = 60.0 bits (30), Expect = 3e-007
Identities = 60/70 (85%)
Strand = Plus / Plus
Query: 509 cgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagtcgg 568
||||||||||||| || |||||||| || || || ||||||||| || ||||||||||
Sbjct: 205 cgaacgccatgccggggcacatcctgcgacctgctccgaacggcgtgaattcgaagtcgg 264
Query: 569 cgcccttgaa 578
||||||||||
Sbjct: 265 cgcccttgaa 274
>gb|CW495343.1|CW495343 fsbb001f287b06k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f287b06, DNA
sequence
Length = 563
Score = 60.0 bits (30), Expect = 3e-007
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtc 566
||||||||||||||||||||||| | ||||||||||||
Sbjct: 371 atcctccggccggcgccgaacgggatgagctcgaagtc 408
>gb|CF430968.1|CF430968 NIT1_4_H07.b1_A002 Nitrogen-deficient seedlings Sorghum bicolor
cDNA clone NIT1_4_H07_A002 3', mRNA sequence
Length = 582
Score = 60.0 bits (30), Expect = 3e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtc 566
||||||||||||||||||||||| | ||||||||||||
Sbjct: 282 atcctccggccggcgccgaacgggatgagctcgaagtc 245
>gb|CX608327.1|CX608327 ANR1_38_A09.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_38_A09_A002 3', mRNA sequence
Length = 509
Score = 60.0 bits (30), Expect = 3e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtc 566
||||||||||||||||||||||| | ||||||||||||
Sbjct: 272 atcctccggccggcgccgaacgggatgagctcgaagtc 235
>gb|CX610385.1|CX610385 ANR1_18_H06.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_18_H06_A002 3', mRNA sequence
Length = 475
Score = 60.0 bits (30), Expect = 3e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtc 566
||||||||||||||||||||||| | ||||||||||||
Sbjct: 127 atcctccggccggcgccgaacgggatgagctcgaagtc 90
>gb|CX621268.1|CX621268 GABR1_57_D03.b1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_57_D03_A002 3', mRNA sequence
Length = 363
Score = 60.0 bits (30), Expect = 3e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtc 566
||||||||||||||||||||||| | ||||||||||||
Sbjct: 149 atcctccggccggcgccgaacgggatgagctcgaagtc 112
>gb|CX622848.1|CX622848 GABR1_66_G09.b1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_66_G09_A002 3', mRNA sequence
Length = 443
Score = 60.0 bits (30), Expect = 3e-007
Identities = 36/38 (94%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtc 566
||||||||||||||||||||||| | ||||||||||||
Sbjct: 153 atcctccggccggcgccgaacgggatgagctcgaagtc 116
>gb|CW323131.1|CW323131 104_817_11476470_148_35959_027 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11476470, DNA
sequence
Length = 686
Score = 58.0 bits (29), Expect = 1e-006
Identities = 41/45 (91%)
Strand = Plus / Minus
Query: 521 ccggacacatcctccggccggcgccgaacggcaggagctcgaagt 565
|||| ||||||| ||| ||||||||||||||||| ||||||||||
Sbjct: 297 ccgggcacatccgccgcccggcgccgaacggcagcagctcgaagt 253
>gb|CW209240.1|CW209240 104_639_11189127_148_36990_062 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11189127, DNA
sequence
Length = 648
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcg 567
||||| ||||||||||||||||| | |||||||||||||
Sbjct: 99 atcctgcggccggcgccgaacgggatgagctcgaagtcg 137
>gb|CW327211.1|CW327211 104_822_11478626_148_35969_001 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11478626, DNA
sequence
Length = 692
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 535 cggccggcgccgaacggcaggagctcgaagt 565
|||||||||||||||||||| ||||||||||
Sbjct: 313 cggccggcgccgaacggcagcagctcgaagt 343
>gb|CW338725.1|CW338725 104_839_11484895_116_36134_030 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484895, DNA
sequence
Length = 660
Score = 54.0 bits (27), Expect = 2e-005
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagt 565
||||||| || ||||||| ||||||| |||||||||||| ||||||||||
Sbjct: 528 ccatgccggggcacatccggcggccggagccgaacggcagcagctcgaagt 578
>gb|CW338726.1|CW338726 104_839_11484895_148_36135_030 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484895, DNA
sequence
Length = 657
Score = 54.0 bits (27), Expect = 2e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagt 565
||||||| || ||||||| ||||||| |||||||||||| ||||||||||
Sbjct: 580 ccatgccggggcacatccggcggccggagccgaacggcagcagctcgaagt 530
>gb|CW404591.1|CW404591 fsbb001f096m18k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f096m18, DNA
sequence
Length = 629
Score = 54.0 bits (27), Expect = 2e-005
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 535 cggccggcgccgaacggcaggagctcgaagt 565
|||||||||||||||||||| ||||||||||
Sbjct: 471 cggccggcgccgaacggcagcagctcgaagt 501
>gb|CD226356.1|CD226356 CCC1_45_B06.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_45_B06_A007 3', mRNA sequence
Length = 635
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcg 567
||||| ||||||||||||||||| | |||||||||||||
Sbjct: 204 atcctgcggccggcgccgaacgggatgagctcgaagtcg 166
>gb|CD425621.1|CD425621 SA1_13_G02.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_13_G02_A002 3', mRNA sequence
Length = 545
Score = 54.0 bits (27), Expect = 2e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagt 565
||||||| || ||||||| ||||||| |||||||||||| ||||||||||
Sbjct: 84 ccatgccggggcacatccggcggccggagccgaacggcagcagctcgaagt 34
>gb|CD425931.1|CD425931 SA1_15_G02.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_15_G02_A002 3', mRNA sequence
Length = 602
Score = 54.0 bits (27), Expect = 2e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagt 565
||||||| || ||||||| ||||||| |||||||||||| ||||||||||
Sbjct: 141 ccatgccggggcacatccggcggccggagccgaacggcagcagctcgaagt 91
>gb|CD427687.1|CD427687 SA1_38_D02.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_38_D02_A002 3', mRNA sequence
Length = 551
Score = 54.0 bits (27), Expect = 2e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 515 ccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaagt 565
||||||| || ||||||| ||||||| |||||||||||| ||||||||||
Sbjct: 89 ccatgccggggcacatccggcggccggagccgaacggcagcagctcgaagt 39
>gb|AY675075.1| Sorghum bicolor flavonoid 3'-hydroxylase mRNA, complete cds
Length = 1554
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcg 567
||||| ||||||||||||||||| | |||||||||||||
Sbjct: 1349 atcctgcggccggcgccgaacgggatgagctcgaagtcg 1311
>gb|AY675076.1| Sorghum bicolor flavonoid 3'-hydroxylase gene, complete cds
Length = 2771
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 529 atcctccggccggcgccgaacggcaggagctcgaagtcg 567
||||| ||||||||||||||||| | |||||||||||||
Sbjct: 1756 atcctgcggccggcgccgaacgggatgagctcgaagtcg 1718
>gb|CL170464.1|CL170464 104_371_10813835_148_31790_155 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10813835, DNA
sequence
Length = 592
Score = 52.0 bits (26), Expect = 8e-005
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 505 agcccgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaag 564
||||| |||||||||||||| |||||||| || || || |||||||||| | |||||||
Sbjct: 134 agcccaaacgccatgcccgggcacatccttcgtcctgccccgaacggcacgtactcgaag 193
Query: 565 tc 566
||
Sbjct: 194 tc 195
>gb|CL195525.1|CL195525 104_421_10942439_114_32308_096 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10942439, DNA
sequence
Length = 601
Score = 52.0 bits (26), Expect = 8e-005
Identities = 53/62 (85%)
Strand = Plus / Minus
Query: 505 agcccgaacgccatgcccggacacatcctccggccggcgccgaacggcaggagctcgaag 564
||||| |||||||||||||| |||||||| || || || |||||||||| | |||||||
Sbjct: 495 agcccaaacgccatgcccgggcacatccttcgtcctgccccgaacggcacgtactcgaag 436
Query: 565 tc 566
||
Sbjct: 435 tc 434
>gb|CW118551.1|CW118551 104_495_11108272_116_34625_062 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11108272, DNA
sequence
Length = 579
Score = 52.0 bits (26), Expect = 8e-005
Identities = 92/114 (80%)
Strand = Plus / Plus
Query: 599 cctcgaaccgctcggggcggaactcctcggggtcgcccggccagtacctgccgtcgcggc 658
||||||||||||| || | ||||||||||| |||| | | ||||||| || ||| ||||
Sbjct: 48 cctcgaaccgctccggcctgaactcctcggcgtcgtcggcccagtacttggggtcccggc 107
Query: 659 ccagcgcccagacgttcaccagcacggtggtgcccgcaggcacgtcgtagccca 712
|| |||||| ||||| || | ||||| |||||| ||||||||||||||||
Sbjct: 108 acaccgcccacacgttgactaacacggccgtgcccttgggcacgtcgtagccca 161
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 202,713
Number of Sequences: 832831
Number of extensions: 202713
Number of successful extensions: 57976
Number of sequences better than 0.5: 176
Number of HSP's better than 0.5 without gapping: 175
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 57596
Number of HSP's gapped (non-prelim): 361
length of query: 767
length of database: 491,359,669
effective HSP length: 20
effective length of query: 747
effective length of database: 474,703,049
effective search space: 354603177603
effective search space used: 354603177603
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)