BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3642920.2.1
(570 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW374401.1|CW374401 fsbb001f051e01f0 Sorghum methylation... 242 3e-062
gb|BI139893.1|BI139893 IP1_47_A12.b1_A002 Immature pannicle... 54 1e-005
gb|CL179386.1|CL179386 104_388_10895272_148_31909_184 Sorgh... 46 0.004
gb|CL179385.1|CL179385 104_388_10895272_116_31910_184 Sorgh... 42 0.055
>gb|CW374401.1|CW374401 fsbb001f051e01f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f051e01, DNA
sequence
Length = 432
Score = 242 bits (122), Expect = 3e-062
Identities = 161/174 (92%)
Strand = Plus / Plus
Query: 397 tgttcccaagcctcaacaaagtcgtatttcttgatgatgatgttgttgtccagcatgacc 456
||||||||| ||||||||| | || ||||||||||||||||||||||||||| |||||||
Sbjct: 72 tgttcccaaacctcaacaaggccggatttcttgatgatgatgttgttgtccaacatgacc 131
Query: 457 tatcaccactttgggatattgatctatctgggaaggttaatggcgctgttgagacttgca 516
||||||||||||||||||| |||||| ||||||||| |||||| ||||||||||||||||
Sbjct: 132 tatcaccactttgggatatcgatctagctgggaaggctaatggtgctgttgagacttgca 191
Query: 517 gaggtggagatagttgggtgatgtctaagaggttcaggaattatttaaactttt 570
|||||||||||||||||||||||||||||| ||||| |||||||| |||||||
Sbjct: 192 gaggtggagatagttgggtgatgtctaagaagttcaaaaattatttcaactttt 245
>gb|BI139893.1|BI139893 IP1_47_A12.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 598
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 486 gggaaggttaatggcgctgttgagacttgcagaggtggagatagttgggtgatgtctaag 545
|||||||| ||||| ||||| || || |||||||| | ||| || |||||||||||||||
Sbjct: 74 gggaaggtgaatggagctgtggaaacatgcagaggggaagacagctgggtgatgtctaag 133
Query: 546 aggttcaggaattatttaaactt 568
| ||||||| ||||| |||||
Sbjct: 134 cgtttcaggacgtatttcaactt 156
>gb|CL179386.1|CL179386 104_388_10895272_148_31909_184 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10895272, DNA
sequence
Length = 735
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 423 tttcttgatgatgatgttgttgt 445
|||||||||||||||||||||||
Sbjct: 37 tttcttgatgatgatgttgttgt 15
Score = 42.1 bits (21), Expect = 0.055
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 33 cttgcagcctcagttgtggtcagatcaac 61
|||||||||||||| || |||||||||||
Sbjct: 409 cttgcagcctcagtagttgtcagatcaac 381
>gb|CL179385.1|CL179385 104_388_10895272_116_31910_184 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10895272, DNA
sequence
Length = 681
Score = 42.1 bits (21), Expect = 0.055
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 33 cttgcagcctcagttgtggtcagatcaac 61
|||||||||||||| || |||||||||||
Sbjct: 558 cttgcagcctcagtagttgtcagatcaac 586
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 157,215
Number of Sequences: 832831
Number of extensions: 157215
Number of successful extensions: 41113
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41106
Number of HSP's gapped (non-prelim): 7
length of query: 570
length of database: 491,359,669
effective HSP length: 19
effective length of query: 551
effective length of database: 475,535,880
effective search space: 262020269880
effective search space used: 262020269880
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)