BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3071418.2.1
(1432 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW792366.1|CW792366 SP__Ba0092A24.f SP__Ba Sorghum propi... 458 e-127
gb|CW294913.1|CW294913 104_776_11460652_148_35615_016 Sorgh... 349 4e-094
gb|BZ341570.1|BZ341570 ic46c10.g1 WGS-SbicolorF (JM107 adap... 281 9e-074
gb|CD432576.1|CD432576 ETH1_30_F07.g1_A002 Ethylene-treated... 281 9e-074
gb|CW063113.1|CW063113 104_308_10521721_1_30092 Sorghum met... 276 5e-072
gb|CW365557.1|CW365557 fsbb001f038c08k0 Sorghum methylation... 274 2e-071
gb|CW412274.1|CW412274 fsbb001f107n06k0 Sorghum methylation... 274 2e-071
gb|CD432476.1|CD432476 ETH1_30_F07.b1_A002 Ethylene-treated... 180 2e-043
gb|BZ340811.1|BZ340811 ic41b10.g1 WGS-SbicolorF (JM107 adap... 165 1e-038
gb|CF431021.1|CF431021 NIT1_4_H02.b1_A002 Nitrogen-deficien... 94 4e-017
gb|CN135321.1|CN135321 OX1_32_B07.b1_A002 Oxidatively-stres... 94 4e-017
gb|CN151211.1|CN151211 WOUND1_74_C10.b1_A002 Wounded leaves... 94 4e-017
gb|BE596903.1|BE596903 PI1_60_A01.g1_A002 Pathogen induced ... 86 1e-014
gb|CB925746.1|CB925746 ABA1_23_E12.b1_A012 Abscisic acid-tr... 84 4e-014
gb|CW063049.1|CW063049 104_308_10521687_1_30092 Sorghum met... 82 2e-013
gb|CW152280.1|CW152280 104_553_11144405_116_36323_023 Sorgh... 82 2e-013
gb|BG558734.1|BG558734 RHIZ2_59_G10.g1_A003 Rhizome2 (RHIZ2... 82 2e-013
gb|CF490081.1|CF490081 POL1_62_H01.b1_A002 Pollen Sorghum b... 82 2e-013
gb|CF431162.1|CF431162 NIT1_6_C08.b1_A002 Nitrogen-deficien... 80 6e-013
gb|CW353559.1|CW353559 fsbb001f016f20k0 Sorghum methylation... 76 1e-011
gb|CW392630.1|CW392630 fsbb001f079f09f0 Sorghum methylation... 72 2e-010
gb|CD235375.1|CD235375 SS1_29_H10.b1_A012 Salt-stressed see... 72 2e-010
gb|CF433158.1|CF433158 NIT1_25_E08.b1_A002 Nitrogen-deficie... 72 2e-010
gb|CN148575.1|CN148575 WOUND1_57_A09.g1_A002 Wounded leaves... 72 2e-010
gb|BG463547.1|BG463547 EM1_49_H04.g1_A002 Embryo 1 (EM1) So... 70 6e-010
gb|CL179753.1|CL179753 104_389_10895528_148_31907_056 Sorgh... 68 2e-009
gb|CN129547.1|CN129547 RHOH1_36_B08.b3_A002 Acid- and alkal... 68 2e-009
gb|CX606124.1|CX606124 ANR1_1_F10.b1_A002 Anaerobic roots S... 68 2e-009
gb|CX607042.1|CX607042 ANR1_6_H06.b1_A002 Anaerobic roots S... 68 2e-009
gb|CX608050.1|CX608050 ANR1_32_G10.b1_A002 Anaerobic roots ... 68 2e-009
gb|CX620993.1|CX620993 GABR1_55_G09.b1_A002 GA- or brassino... 68 2e-009
gb|CW364958.1|CW364958 fsbb001f037d22f0 Sorghum methylation... 66 1e-008
gb|CL152122.1|CL152122 104_335_10779735_116_31364_135 Sorgh... 64 4e-008
gb|CL152965.1|CL152965 104_337_10780377_116_31368_009 Sorgh... 64 4e-008
gb|CW124854.1|CW124854 104_504_11112012_116_34706_034 Sorgh... 64 4e-008
gb|CW255681.1|CW255681 104_720_11226371_148_35403_042 Sorgh... 64 4e-008
gb|AW923055.1|AW923055 DG1_48_G01.g1_A002 Dark Grown 1 (DG1... 64 4e-008
gb|CD234204.1|CD234204 SS1_26_B02.b1_A012 Salt-stressed see... 64 4e-008
gb|CD236143.1|CD236143 SS1_32_H03.b1_A012 Salt-stressed see... 64 4e-008
gb|CF429614.1|CF429614 PH1_23_D07.b1_A002 Phosphorous-defic... 64 4e-008
gb|CF432260.1|CF432260 NIT1_15_D05.b1_A002 Nitrogen-deficie... 64 4e-008
gb|CN124677.1|CN124677 RHOH1_6_F06.b1_A002 Acid- and alkali... 64 4e-008
gb|CN129718.1|CN129718 RHOH1_37_B03.b1_A002 Acid- and alkal... 64 4e-008
gb|CN130050.1|CN130050 RHOH1_39_A12.b1_A002 Acid- and alkal... 64 4e-008
gb|CN135665.1|CN135665 OX1_38_F05.b1_A002 Oxidatively-stres... 64 4e-008
gb|CN141678.1|CN141678 WOUND1_1_E01.b1_A002 Wounded leaves ... 64 4e-008
gb|CN145288.1|CN145288 WOUND1_28_A10.b2_A002 Wounded leaves... 64 4e-008
gb|CN146677.1|CN146677 WOUND1_43_B07.b1_A002 Wounded leaves... 64 4e-008
gb|CN149045.1|CN149045 WOUND1_60_H10.b1_A002 Wounded leaves... 64 4e-008
gb|CN150014.1|CN150014 WOUND1_66_H05.b1_A002 Wounded leaves... 64 4e-008
gb|CN150018.1|CN150018 WOUND1_66_H09.b1_A002 Wounded leaves... 64 4e-008
gb|CX606217.1|CX606217 ANR1_1_F10.g1_A002 Anaerobic roots S... 64 4e-008
gb|CX606431.1|CX606431 ANR1_3_B02.b1_A002 Anaerobic roots S... 64 4e-008
gb|CX606801.1|CX606801 ANR1_5_B12.b1_A002 Anaerobic roots S... 64 4e-008
gb|CX608043.1|CX608043 ANR1_32_F11.b1_A002 Anaerobic roots ... 64 4e-008
gb|CX610703.1|CX610703 ANR1_20_G07.b1_A002 Anaerobic roots ... 64 4e-008
gb|CX614913.1|CX614913 GABR1_17_C07.b1_A002 GA- or brassino... 64 4e-008
gb|CX616691.1|CX616691 GABR1_29_H04.b1_A002 GA- or brassino... 64 4e-008
gb|CX618728.1|CX618728 GABR1_41_G07.b1_A002 GA- or brassino... 64 4e-008
gb|CX621118.1|CX621118 GABR1_56_D04.b1_A002 GA- or brassino... 64 4e-008
gb|CX622109.1|CX622109 GABR1_62_C09.b2_A002 GA- or brassino... 64 4e-008
gb|CL179752.1|CL179752 104_389_10895528_116_31908_056 Sorgh... 60 6e-007
gb|CL192770.1|CL192770 104_415_10940474_114_32259_001 Sorgh... 60 6e-007
gb|CL192771.1|CL192771 104_415_10940474_116_32263_001 Sorgh... 60 6e-007
gb|CW469992.1|CW469992 fsbb001f222p16f0 Sorghum methylation... 60 6e-007
gb|CW478890.1|CW478890 fsbb001f237a04f0 Sorghum methylation... 60 6e-007
gb|CW478891.1|CW478891 fsbb001f237a04k0 Sorghum methylation... 60 6e-007
gb|BG102714.1|BG102714 RHIZ2_36_D11.g1_A003 Rhizome2 (RHIZ2... 60 6e-007
gb|CF429902.1|CF429902 PH1_25_D10.b1_A002 Phosphorous-defic... 60 6e-007
gb|CN124537.1|CN124537 RHOH1_5_A06.g1_A002 Acid- and alkali... 60 6e-007
gb|CW152281.1|CW152281 104_553_11144405_148_36327_023 Sorgh... 58 2e-006
gb|CF479957.1|CF479957 POL1_62_H01.g1_A002 Pollen Sorghum b... 58 2e-006
gb|CW155257.1|CW155257 104_557_11146040_116_36358_020 Sorgh... 56 9e-006
gb|AI723825.1|AI723825 RHIZ1_12_H04.y1_A001 Rhizome1 (RHIZ1... 56 9e-006
gb|CF427655.1|CF427655 PH1_10_F04.b1_A002 Phosphorous-defic... 56 9e-006
gb|CF432253.1|CF432253 NIT1_15_E06.b1_A002 Nitrogen-deficie... 56 9e-006
gb|CN128566.1|CN128566 RHOH1_30_G06.b1_A002 Acid- and alkal... 56 9e-006
gb|CN141999.1|CN141999 WOUND1_3_E12.b1_A002 Wounded leaves ... 56 9e-006
gb|CN150772.1|CN150772 WOUND1_71_H03.b1_A002 Wounded leaves... 56 9e-006
gb|CL152121.1|CL152121 104_335_10779735_114_31363_135 Sorgh... 54 4e-005
gb|CL152964.1|CL152964 104_337_10780377_114_31367_009 Sorgh... 54 4e-005
gb|CW124855.1|CW124855 104_504_11112012_148_34702_034 Sorgh... 54 4e-005
gb|CW255680.1|CW255680 104_720_11226371_116_35402_042 Sorgh... 54 4e-005
gb|CW343244.1|CW343244 104_845_11487314_116_36184_007 Sorgh... 54 4e-005
gb|AW923012.1|AW923012 DG1_48_G01.b1_A002 Dark Grown 1 (DG1... 54 4e-005
gb|CD231893.1|CD231893 SS1_30_E08.g1_A012 Salt-stressed see... 54 4e-005
gb|CD232077.1|CD232077 SS1_38_E04.b1_A012 Salt-stressed see... 54 4e-005
gb|CD234308.1|CD234308 SS1_26_B02.g1_A012 Salt-stressed see... 54 4e-005
gb|CD236240.1|CD236240 SS1_32_H03.g1_A012 Salt-stressed see... 54 4e-005
gb|CF771144.1|CF771144 DSBF1_14_E10.g1_A010 Drought-stresse... 54 4e-005
gb|CN123882.1|CN123882 RHOH1_1_G06.b1_A002 Acid- and alkali... 54 4e-005
gb|CN124765.1|CN124765 RHOH1_6_F06.g1_A002 Acid- and alkali... 54 4e-005
gb|CN141757.1|CN141757 WOUND1_1_E01.g1_A002 Wounded leaves ... 54 4e-005
gb|CN141909.1|CN141909 WOUND1_2_D08.g1_A002 Wounded leaves ... 54 4e-005
gb|CN142079.1|CN142079 WOUND1_3_E12.g1_A002 Wounded leaves ... 54 4e-005
gb|CN143379.1|CN143379 WOUND1_15_H07.g1_A002 Wounded leaves... 54 4e-005
gb|CN143714.1|CN143714 WOUND1_17_H12.g1_A002 Wounded leaves... 54 4e-005
gb|CN144196.1|CN144196 WOUND1_20_F05.g1_A002 Wounded leaves... 54 4e-005
gb|CN144667.1|CN144667 WOUND1_23_F05.g1_A002 Wounded leaves... 54 4e-005
gb|CN145362.1|CN145362 WOUND1_28_A10.g1_A002 Wounded leaves... 54 4e-005
gb|CN145372.1|CN145372 WOUND1_28_B08.g1_A002 Wounded leaves... 54 4e-005
gb|CN146609.1|CN146609 WOUND1_42_A04.g1_A002 Wounded leaves... 54 4e-005
gb|CN146754.1|CN146754 WOUND1_43_B07.g1_A002 Wounded leaves... 54 4e-005
gb|CN147854.1|CN147854 WOUND1_52_E02.g1_A002 Wounded leaves... 54 4e-005
gb|CN148348.1|CN148348 WOUND1_55_G02.g1_A002 Wounded leaves... 54 4e-005
gb|CN149132.1|CN149132 WOUND1_60_H10.g1_A002 Wounded leaves... 54 4e-005
gb|CN150048.1|CN150048 WOUND1_66_C07.g1_A002 Wounded leaves... 54 4e-005
gb|CN150084.1|CN150084 WOUND1_66_G08.g1_A002 Wounded leaves... 54 4e-005
gb|CN150092.1|CN150092 WOUND1_66_H05.g1_A002 Wounded leaves... 54 4e-005
gb|CN150096.1|CN150096 WOUND1_66_H09.g1_A002 Wounded leaves... 54 4e-005
gb|CX622200.1|CX622200 GABR1_62_C09.g2_A002 GA- or brassino... 54 4e-005
gb|CL186438.1|CL186438 104_401_10900205_116_32412_027 Sorgh... 50 6e-004
gb|CW097150.1|CW097150 104_463_11002295_148_34356_094 Sorgh... 50 6e-004
gb|CW125846.1|CW125846 104_506_11112559_148_34726_028 Sorgh... 50 6e-004
gb|CW364959.1|CW364959 fsbb001f037d22k0 Sorghum methylation... 50 6e-004
gb|BG560632.1|BG560632 RHIZ2_59_G10.b1_A003 Rhizome2 (RHIZ2... 50 6e-004
gb|CD235468.1|CD235468 SS1_29_H10.g1_A012 Salt-stressed see... 50 6e-004
gb|CF433215.1|CF433215 NIT1_25_E08.g1_A002 Nitrogen-deficie... 50 6e-004
gb|CN145101.1|CN145101 WOUND1_26_F11.g1_A002 Wounded leaves... 50 6e-004
gb|BZ338207.1|BZ338207 ia93g08.b1 WGS-SbicolorF (JM107 adap... 48 0.002
gb|BZ338208.1|BZ338208 ia93g08.g1 WGS-SbicolorF (JM107 adap... 48 0.002
gb|CW092078.1|CW092078 104_454_10998930_116_33041_073 Sorgh... 48 0.002
gb|CW132607.1|CW132607 104_516_11116302_116_34807_031 Sorgh... 48 0.002
gb|CW132608.1|CW132608 104_516_11116302_148_34803_031 Sorgh... 48 0.002
gb|CW473754.1|CW473754 fsbb001f229e09k0 Sorghum methylation... 48 0.002
gb|BE596984.1|BE596984 PI1_60_A01.b1_A002 Pathogen induced ... 48 0.002
gb|BE600587.1|BE600587 PI1_89_A01.b1_A002 Pathogen induced ... 48 0.002
gb|CF430045.1|CF430045 PH1_25_D10.g1_A002 Phosphorous-defic... 48 0.002
gb|CF431998.1|CF431998 NIT1_16_E10.b1_A002 Nitrogen-deficie... 48 0.002
gb|CN129633.1|CN129633 RHOH1_36_B08.g1_A002 Acid- and alkal... 48 0.002
gb|CN144107.1|CN144107 WOUND1_20_E12.b1_A002 Wounded leaves... 48 0.002
gb|CN148282.1|CN148282 WOUND1_55_G06.b1_A002 Wounded leaves... 48 0.002
gb|CN150569.1|CN150569 WOUND1_70_C05.b1_A002 Wounded leaves... 48 0.002
gb|CN150866.1|CN150866 WOUND1_72_A06.b1_A002 Wounded leaves... 48 0.002
gb|CN151544.1|CN151544 WOUND1_76_C11.b1_A002 Wounded leaves... 48 0.002
gb|CX607134.1|CX607134 ANR1_6_H06.g1_A002 Anaerobic roots S... 48 0.002
gb|CX608131.1|CX608131 ANR1_32_G10.g1_A002 Anaerobic roots ... 48 0.002
gb|CX621075.1|CX621075 GABR1_55_G09.g1_A002 GA- or brassino... 48 0.002
gb|CL154390.1|CL154390 104_339_10781376_116_31372_240 Sorgh... 46 0.009
gb|CW125845.1|CW125845 104_506_11112559_116_34722_028 Sorgh... 46 0.009
gb|CW197913.1|CW197913 104_622_11181934_148_36831_089 Sorgh... 46 0.009
gb|CW419129.1|CW419129 fsbb001f123n18k0 Sorghum methylation... 46 0.009
gb|CW478518.1|CW478518 fsbb001f236h04f0 Sorghum methylation... 46 0.009
gb|CN146181.1|CN146181 WOUND1_38_A06.g1_A002 Wounded leaves... 46 0.009
gb|CN150856.1|CN150856 WOUND1_71_H03.g1_A002 Wounded leaves... 46 0.009
gb|CN151846.1|CN151846 WOUND1_78_C02.b1_A002 Wounded leaves... 46 0.009
gb|CX618812.1|CX618812 GABR1_41_G07.g1_A002 GA- or brassino... 46 0.009
gb|BZ332623.1|BZ332623 hx29d12.g1 WGS-SbicolorF (JM107 adap... 44 0.035
gb|BZ350831.1|BZ350831 ht61c09.g1 WGS-SbicolorF (JM107 adap... 44 0.035
gb|CW048139.1|CW048139 104_286_10513155_115_30215 Sorghum m... 44 0.035
gb|CW097149.1|CW097149 104_463_11002295_116_34344_094 Sorgh... 44 0.035
gb|CW108984.1|CW108984 104_480_11097815_116_34493_082 Sorgh... 44 0.035
gb|CW108985.1|CW108985 104_480_11097815_148_34497_082 Sorgh... 44 0.035
gb|CW151120.1|CW151120 104_551_11143770_116_36314_067 Sorgh... 44 0.035
gb|CW241790.1|CW241790 104_701_11218968_148_37553_094 Sorgh... 44 0.035
gb|CW252038.1|CW252038 104_714_11224272_116_35069_082 Sorgh... 44 0.035
gb|CW332999.1|CW332999 104_830_11481709_116_36036_049 Sorgh... 44 0.035
gb|CW353558.1|CW353558 fsbb001f016f20f0 Sorghum methylation... 44 0.035
gb|CW353590.1|CW353590 fsbb001f016g12f0 Sorghum methylation... 44 0.035
gb|CW353591.1|CW353591 fsbb001f016g12k0 Sorghum methylation... 44 0.035
gb|CW376953.1|CW376953 fsbb001f055b05k0 Sorghum methylation... 44 0.035
gb|BM328717.1|BM328717 PIC1_25_G03.g1_A002 Pathogen-infecte... 44 0.035
gb|CB925832.1|CB925832 ABA1_23_E12.g1_A012 Abscisic acid-tr... 44 0.035
gb|CD232097.1|CD232097 SS1_38_E03.b1_A012 Salt-stressed see... 44 0.035
gb|CD431034.1|CD431034 ETH1_6_B12.g1_A002 Ethylene-treated ... 44 0.035
gb|CF755720.1|CF755720 DSAF1_1_B02.b1_A011 Drought-stressed... 44 0.035
gb|CN135387.1|CN135387 OX1_32_B07.g1_A002 Oxidatively-stres... 44 0.035
gb|CN147618.1|CN147618 WOUND1_50_G12.g1_A002 Wounded leaves... 44 0.035
gb|CN151289.1|CN151289 WOUND1_74_C10.g1_A002 Wounded leaves... 44 0.035
gb|CW045870.1|CW045870 104_282_10509825_115_30223 Sorghum m... 42 0.14
gb|CW128190.1|CW128190 104_509_11113871_148_34750_086 Sorgh... 42 0.14
gb|CW221584.1|CW221584 104_656_11197987_148_37167_068 Sorgh... 42 0.14
gb|CW241789.1|CW241789 104_701_11218968_116_37554_094 Sorgh... 42 0.14
gb|CW447720.1|CW447720 fsbb001f180p16f0 Sorghum methylation... 42 0.14
gb|CW790988.1|CW790988 SP__Ba0075D13.r SP__Ba Sorghum propi... 42 0.14
gb|BE360969.1|BE360969 DG1_68_C08.g1_A002 Dark Grown 1 (DG1... 42 0.14
gb|BI643752.1|BI643752 IP1_56_F03.b1_A002 Immature pannicle... 42 0.14
gb|CD207627.1|CD207627 HS1_33_D06.g1_A012 Heat-shocked seed... 42 0.14
gb|CD431979.1|CD431979 ETH1_12_G10.b1_A002 Ethylene-treated... 42 0.14
gb|CF431223.1|CF431223 NIT1_6_C08.g1_A002 Nitrogen-deficien... 42 0.14
gb|CN124135.1|CN124135 RHOH1_2_G12.g1_A002 Acid- and alkali... 42 0.14
gb|CN129642.1|CN129642 RHOH1_36_C05.g1_A002 Acid- and alkal... 42 0.14
gb|CN145016.1|CN145016 WOUND1_26_F11.b2_A002 Wounded leaves... 42 0.14
>gb|CW792366.1|CW792366 SP__Ba0092A24.f SP__Ba Sorghum propinquum genomic clone
SP__Ba0092A24 5', DNA sequence
Length = 880
Score = 458 bits (231), Expect = e-127
Identities = 338/373 (90%), Gaps = 3/373 (0%)
Strand = Plus / Minus
Query: 515 cttgaggaaaacagcggttgcaggtggaatactctcaaacatattgcctgcgacgaactg 574
|||||| ||||||||||| ||||||||||||||||||||||| || ||||||||||||||
Sbjct: 600 cttgagaaaaacagcggtcgcaggtggaatactctcaaacatgtttcctgcgacgaactg 541
Query: 575 cacgttgccatcagacggagcaccggcgacaacgtgcgggaggtcaagcacgctgcactt 634
||||||| |||| || ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 540 cacgttgacatcggatggagcaccggcgacaacgtgcgggaggtcaagcacgctgcattt 481
Query: 635 gaggtgggggaaggcggcggcgatggtggcggcggcgccaccatggccaccaccgacgtc 694
|| ||| |||||||| |||||||||||||||| |||||||||||| ||||| |||||||
Sbjct: 480 gatgtgcgggaaggcagcggcgatggtggcggtggcgccaccatgcccaccggcgacgtc 421
Query: 695 aaccaacgagtcgatcccacgaaacgtctcgccgcactccctcagcacaattggcatgag 754
|||||||||||||||||||||||| ||||||||||||||| |||| |||||||| ||
Sbjct: 420 gaccaacgagtcgatcccacgaaacacctcgccgcactccctgagcatgattggcatcag 361
Query: 755 gaagcggctgtccgcggccatgcctttgttcagcaaggcgtttacgtcgtcagcatgttc 814
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||
Sbjct: 360 gaagcggctgtccgcgaccatgcctttgttcagcaaggcgtttacgtcgtcagcgtgctc 301
Query: 815 ccagatcgttggggt---ctggcggaacgccaggccatacggggacggctcgtgctgctc 871
||||||||| ||||| || || |||||||||| |||| | ||||||||||| ||||||
Sbjct: 300 ccagatcgtcggggttggctagcagaacgccagggcataagcggacggctcgttctgctc 241
Query: 872 ctgccggaaccac 884
|||||||||||||
Sbjct: 240 ctgccggaaccac 228
Score = 121 bits (61), Expect = 2e-025
Identities = 91/101 (90%)
Strand = Plus / Minus
Query: 913 cagcgataggctggagcgccagactcacaaagggagccaaggtcgccgtgctcacgtcgt 972
|||||||||| ||||||||||| ||| | ||||| ||||| |||| || |||||| ||||
Sbjct: 199 cagcgatagggtggagcgccaggctcgcgaagggcgccaacgtcgacgagctcacctcgt 140
Query: 973 cgctgacgaggaagcgggaggctgccgtcaacctgtagacg 1013
|||||||||||||||||||||||||||||| ||||||||||
Sbjct: 139 cgctgacgaggaagcgggaggctgccgtcagcctgtagacg 99
Score = 65.9 bits (33), Expect = 1e-008
Identities = 51/57 (89%)
Strand = Plus / Minus
Query: 1082 gacgctgaagatgcccgtgacggtgagcacgcgcatgaggcggcgaagggcgcgaag 1138
|||||||||| ||||| |||||||||| |||||||||||| ||| |||||||||||
Sbjct: 57 gacgctgaaggtgcccaagacggtgagcgcgcgcatgaggctgcgtagggcgcgaag 1
Score = 48.1 bits (24), Expect = 0.002
Identities = 78/92 (84%), Gaps = 3/92 (3%)
Strand = Plus / Minus
Query: 422 taccttcccacctgcatcccgtggagatatggcttgcttgcaattcttc-aatatcttga 480
||||||||| |||||| || ||||||| || |||||| |||| |||||| ||||||||||
Sbjct: 860 taccttccctcctgcaacc-gtggagaaatcgcttgcctgca-ttcttccaatatcttga 803
Query: 481 cacactcatcgtcaccccagtcatgtagagtt 512
| || | ||||||| ||||||||||| ||||
Sbjct: 802 cgcagttgtcgtcactccagtcatgtaaagtt 771
>gb|CW294913.1|CW294913 104_776_11460652_148_35615_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11460652, DNA
sequence
Length = 547
Score = 349 bits (176), Expect = 4e-094
Identities = 404/479 (84%), Gaps = 12/479 (2%)
Strand = Plus / Plus
Query: 546 ctctcaaacatattgcctgcgacgaactgcacgttgccatcagacggagcaccggcgaca 605
|||| |||||| || ||||||| ||||||||||||| |||| || |||||||||||||||
Sbjct: 1 ctctgaaacatgtttcctgcgatgaactgcacgttgacatcggatggagcaccggcgaca 60
Query: 606 acgtgcgggaggtcaagcacgctgcacttgaggtgggggaaggcggcggcgatggtggcg 665
||||| | ||||||||||||||||| |||| ||| |||||||| |||||||||||||||
Sbjct: 61 acgtgtgcaaggtcaagcacgctgcatttgatgtgcgggaaggcagcggcgatggtggcg 120
Query: 666 gcggcgccaccatggccaccaccgacgtcaaccaacgagtcgatcccacgaaacgtctcg 725
| |||||||||||| || || |||||||| |||| ||||||||||||||| ||| ||||
Sbjct: 121 gtggcgccaccatgcccgccgccgacgtcgaccagcgagtcgatcccacggaacacctcg 180
Query: 726 ccgcactccctcagcacaattggcatgaggaagcggctgtccgcggccatgcctttgttc 785
||||||||||| | ||| | ||||| |||||||||||||||||| ||||||||||||||
Sbjct: 181 ccgcactccctgatcacgaccggcatcaggaagcggctgtccgcgaccatgcctttgttc 240
Query: 786 agcaaggcgtttacgtcgtcagcatgttcccagatcgttggggt---ctggcggaacgcc 842
||||||||||||||||||||||| || ||||||||||| || || ||| |||||||||
Sbjct: 241 agcaaggcgtttacgtcgtcagcgtgctcccagatcgtcggcgttggctgccggaacgcc 300
Query: 843 aggccatacggggacggctcgtgctgctcctgccggaaccacgcggagatacccagggcg 902
|| |||| | || |||||||| ||||||||||||||||||| | | || ||| ||| |
Sbjct: 301 agcgcataggcggtcggctcgttctgctcctgccggaaccacttgcacatgccctgggtg 360
Query: 903 tgcggacaggcagcgataggctggagcgccagactcacaaagggagccaaggt------c 956
||||| | | ||||| || ||||||||||| ||||| ||||| |||||||| |
Sbjct: 361 tgcggggcgacggcgatcgggtggagcgccaggctcacgaagggcgccaaggtcgtcgac 420
Query: 957 gccgtgctcacgtcgt---cgctgacgaggaagcgggaggctgccgtcaacctgtagac 1012
| || |||||| |||| ||| |||||||||||||||||||||||||| |||||||||
Sbjct: 421 gacgagctcacctcgtcgtcgccgacgaggaagcgggaggctgccgtcagcctgtagac 479
>gb|BZ341570.1|BZ341570 ic46c10.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ic46c10 5', DNA sequence
Length = 621
Score = 281 bits (142), Expect = 9e-074
Identities = 211/234 (90%)
Strand = Plus / Plus
Query: 1082 gacgctgaagatgcccgtgacggtgagcacgcgcatgaggcggcgaagggcgcgaagctt 1141
|||||||||| ||||| |||||||||| |||||||||||| ||| ||||||||||||||
Sbjct: 185 gacgctgaaggtgcccaagacggtgagcgcgcgcatgaggctgcgtagggcgcgaagctt 244
Query: 1142 gcttgggtggagcgcagtctcggcgaggatctggagaagggtggcgccgccggcgccgtg 1201
| ||||||||||| ||||||||||||||||||| ||||||||||| ||| |||||||
Sbjct: 245 gtttgggtggagcttagtctcggcgaggatctgggtgagggtggcgccaccgccgccgtg 304
Query: 1202 gtggtggatcgcgtcggggatgcggaggtccagcgccacggcgagcgcgagcgatttggc 1261
| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||
Sbjct: 305 gcggtggatcgcgtcggggatgcggaggtccagcgccacggcgagcgccattgatttggc 364
Query: 1262 gaagcacagggaatggtgcaagagctcgtcgtgagcttggagcaaatcctggct 1315
|||||||||||| |||||| |||||||| ||| |||||||||||| ||||||||
Sbjct: 365 gaagcacagggactggtgccagagctcgacgtaagcttggagcaagtcctggct 418
Score = 113 bits (57), Expect = 5e-023
Identities = 90/101 (89%)
Strand = Plus / Plus
Query: 913 cagcgataggctggagcgccagactcacaaagggagccaaggtcgccgtgctcacgtcgt 972
|||||||||| ||||||||||| ||| | ||||| ||||| |||| || |||||| ||||
Sbjct: 43 cagcgatagggtggagcgccaggctcgcgaagggcgccaacgtcgacgagctcacctcgt 102
Query: 973 cgctgacgaggaagcgggaggctgccgtcaacctgtagacg 1013
|||||||||||||||| ||||||||||||| ||||||||||
Sbjct: 103 cgctgacgaggaagcgtgaggctgccgtcagcctgtagacg 143
>gb|CD432576.1|CD432576 ETH1_30_F07.g1_A002 Ethylene-treated seedlings Sorghum bicolor cDNA
clone ETH1_30_F07_A002 5', mRNA sequence
Length = 642
Score = 281 bits (142), Expect = 9e-074
Identities = 211/234 (90%)
Strand = Plus / Minus
Query: 1082 gacgctgaagatgcccgtgacggtgagcacgcgcatgaggcggcgaagggcgcgaagctt 1141
|||||||||| ||||| |||||||||| |||||||||||| ||| ||||||||||||||
Sbjct: 321 gacgctgaaggtgcccaagacggtgagcgcgcgcatgaggctgcgtagggcgcgaagctt 262
Query: 1142 gcttgggtggagcgcagtctcggcgaggatctggagaagggtggcgccgccggcgccgtg 1201
| ||||||||||| ||||||||||||||||||| ||||||||||| ||| |||||||
Sbjct: 261 gtttgggtggagcttagtctcggcgaggatctgggtgagggtggcgccaccgccgccgtg 202
Query: 1202 gtggtggatcgcgtcggggatgcggaggtccagcgccacggcgagcgcgagcgatttggc 1261
| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||
Sbjct: 201 gcggtggatcgcgtcggggatgcggaggtccagcgccacggcgagcgccattgatttggc 142
Query: 1262 gaagcacagggaatggtgcaagagctcgtcgtgagcttggagcaaatcctggct 1315
|||||||||||| |||||| |||||||| ||| |||||||||||| ||||||||
Sbjct: 141 gaagcacagggactggtgccagagctcgacgtaagcttggagcaagtcctggct 88
Score = 172 bits (87), Expect = 6e-041
Identities = 130/144 (90%), Gaps = 3/144 (2%)
Strand = Plus / Minus
Query: 744 attggcatgaggaagcggctgtccgcggccatgcctttgttcagcaaggcgtttacgtcg 803
|||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||
Sbjct: 635 attggcatcaggaagcggctgtccgcgaccatgcctttgttcagcaaggcgtntacgtcg 576
Query: 804 tcagcatgttcccagatcgttggggt---ctggcggaacgccaggccatacggggacggc 860
||||| || ||||||||||| ||||| ||||| |||||||||| |||| | |||||||
Sbjct: 575 tcagcgtgctcccagatcgtcggggttggctggcagaacgccagggcataagcggacggc 516
Query: 861 tcgtgctgctcctgccggaaccac 884
|||| |||||||||||||||||||
Sbjct: 515 tcgttctgctcctgccggaaccac 492
Score = 113 bits (57), Expect = 5e-023
Identities = 90/101 (89%)
Strand = Plus / Minus
Query: 913 cagcgataggctggagcgccagactcacaaagggagccaaggtcgccgtgctcacgtcgt 972
|||||||||| ||||||||||| ||| | ||||| ||||| |||| || |||||| ||||
Sbjct: 463 cagcgatagggtggagcgccaggctcgcgaagggcgccaacgtcgacgagctcacctcgt 404
Query: 973 cgctgacgaggaagcgggaggctgccgtcaacctgtagacg 1013
|||||||||||||||| ||||||||||||| ||||||||||
Sbjct: 403 cgctgacgaggaagcgtgaggctgccgtcagcctgtagacg 363
>gb|CW063113.1|CW063113 104_308_10521721_1_30092 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone 10521721, DNA sequence
Length = 513
Score = 276 bits (139), Expect = 5e-072
Identities = 204/225 (90%), Gaps = 3/225 (1%)
Strand = Plus / Plus
Query: 1081 cgacgctgaagatgcccgtgacggtgagcacgcgcatgaggcggcgaagggcgcgaagct 1140
||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||
Sbjct: 270 cgacgctgaaggtgcccgagacggtgagcacgcgcatgaggcggcgtagggcgcgaagct 329
Query: 1141 tgcttgggtggagcgcagtctcggcgaggatctggagaagggtggcgccgccggcgccgt 1200
||| ||| ||||| || |||||||||||||||||| | ||||||||||||||| ||||
Sbjct: 330 tgcatggatggagggccgtctcggcgaggatctgggggagggtggcgccgccg---ccgt 386
Query: 1201 ggtggtggatcgcgtcggggatgcggaggtccagcgccacggcgagcgcgagcgatttgg 1260
|| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 387 ggcggtggatcgcgtcggggatgcggaggtccagggccacggcgagagcgagcgatttga 446
Query: 1261 cgaagcacagggaatggtgcaagagctcgtcgtgagcttggagca 1305
| ||| |||||| |||||| ||||||||||||||||||||||||
Sbjct: 447 ggtagctcagggactggtgccagagctcgtcgtgagcttggagca 491
Score = 137 bits (69), Expect = 3e-030
Identities = 187/225 (83%), Gaps = 6/225 (2%)
Strand = Plus / Plus
Query: 800 gtcgtcagcatgttcccagatcgttggggtctggcggaacgccaggccatacggggacgg 859
|||||||||||||||||||||| ||||| |||| ||||||||||||| ||| |||||
Sbjct: 1 gtcgtcagcatgttcccagatccttgggacttggctgaacgccaggccaaacgccgacgg 60
Query: 860 ctcgtgctgctcctgccggaaccacgcggagatacccagggcgtgcggacaggcagcgat 919
|||||| ||||||||||||||||||||| |||| |||| ||||||||| || | |||
Sbjct: 61 ctcgtggtgctcctgccggaaccacgcgcagatgcccatggcgtgcggggagacgctgat 120
Query: 920 aggctggagcgccagactcacaaagggagccaaggtcgccgtgctca---cgtcgtcgc- 975
|| |||||| ||| |||| ||| ||||||| || |||| ||||| |||||||||
Sbjct: 121 ggggtggagcaccacgctcataaacggagccagtgttgccgagctcacctcgtcgtcgcc 180
Query: 976 --tgacgaggaagcgggaggctgccgtcaacctgtagacgacgac 1018
||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 181 gacgacgaggaaccgggaggctgccgtcagcctgtagacgacgac 225
>gb|CW365557.1|CW365557 fsbb001f038c08k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f038c08, DNA
sequence
Length = 725
Score = 274 bits (138), Expect = 2e-071
Identities = 210/234 (89%)
Strand = Plus / Plus
Query: 1082 gacgctgaagatgcccgtgacggtgagcacgcgcatgaggcggcgaagggcgcgaagctt 1141
|||||||||| |||| |||||||||| |||||||||||| ||| ||||||||||||||
Sbjct: 288 gacgctgaaggtgccgaagacggtgagcgcgcgcatgaggctgcgtagggcgcgaagctt 347
Query: 1142 gcttgggtggagcgcagtctcggcgaggatctggagaagggtggcgccgccggcgccgtg 1201
| |||||||||||||||||||||||||||||||| |||||||||||| || |||||||
Sbjct: 348 gtttgggtggagcgcagtctcggcgaggatctgggcgagggtggcgccgtcgtcgccgtg 407
Query: 1202 gtggtggatcgcgtcggggatgcggaggtccagcgccacggcgagcgcgagcgatttggc 1261
| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||
Sbjct: 408 gcggtggatcgcgtcggggatgcggaggtccagcgccacggcgagcgccatggatttggc 467
Query: 1262 gaagcacagggaatggtgcaagagctcgtcgtgagcttggagcaaatcctggct 1315
|||||||||||| |||||| |||||||| ||| || |||||||| ||||||||
Sbjct: 468 gaagcacagggactggtgccagagctcgacgtaagactggagcaagtcctggct 521
Score = 105 bits (53), Expect = 1e-020
Identities = 191/236 (80%), Gaps = 12/236 (5%)
Strand = Plus / Plus
Query: 789 aaggcgtttacgtcgtcagcatgttcccagatcgttggggt---ctggcggaacgccagg 845
|||||||||||||||||||| || ||||||||||| || || ||| |||||||||||
Sbjct: 1 aaggcgtttacgtcgtcagcgtgctcccagatcgtcggcgttggctgccggaacgccagc 60
Query: 846 ccatacggggacggctcgtgctgctcctgccggaaccacgcggagatacccagggcgtgc 905
|||| | || |||||||| ||||||||||||||||||| | | || ||| ||| ||||
Sbjct: 61 gcataggcggtcggctcgttctgctcctgccggaaccacttgcacatgccctgggtgtgc 120
Query: 906 ggacaggcagcgataggctggagcgccagactcacaaagggagccaaggt------cgcc 959
|| | | ||||| || ||||||||||| ||||| ||||| |||||||| || |
Sbjct: 121 ggggcgacggcgatcgggtggagcgccaggctcacgaagggcgccaaggtcgtcgacgac 180
Query: 960 gtgctcacgtcgt---cgctgacgaggaagcgggaggctgccgtcaacctgtagac 1012
| |||||| |||| ||| |||||||||||||||||||||||||| |||||||||
Sbjct: 181 gagctcacctcgtcgtcgccgacgaggaagcgggaggctgccgtcagcctgtagac 236
>gb|CW412274.1|CW412274 fsbb001f107n06k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f107n06, DNA
sequence
Length = 599
Score = 274 bits (138), Expect = 2e-071
Identities = 210/234 (89%)
Strand = Plus / Plus
Query: 1082 gacgctgaagatgcccgtgacggtgagcacgcgcatgaggcggcgaagggcgcgaagctt 1141
|||||||||| |||| |||||||||| |||||||||||| ||| ||||||||||||||
Sbjct: 90 gacgctgaaggtgccgaagacggtgagcgcgcgcatgaggctgcgtagggcgcgaagctt 149
Query: 1142 gcttgggtggagcgcagtctcggcgaggatctggagaagggtggcgccgccggcgccgtg 1201
| |||||||||||||||||||||||||||||||| |||||||||||| || |||||||
Sbjct: 150 gtttgggtggagcgcagtctcggcgaggatctgggcgagggtggcgccgtcgtcgccgtg 209
Query: 1202 gtggtggatcgcgtcggggatgcggaggtccagcgccacggcgagcgcgagcgatttggc 1261
| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||
Sbjct: 210 gcggtggatcgcgtcggggatgcggaggtccagcgccacggcgagcgccatggatttggc 269
Query: 1262 gaagcacagggaatggtgcaagagctcgtcgtgagcttggagcaaatcctggct 1315
|||||||||||| |||||| |||||||| ||| || |||||||| ||||||||
Sbjct: 270 gaagcacagggactggtgccagagctcgacgtaagactggagcaagtcctggct 323
>gb|CD432476.1|CD432476 ETH1_30_F07.b1_A002 Ethylene-treated seedlings Sorghum bicolor cDNA
clone ETH1_30_F07_A002 3', mRNA sequence
Length = 535
Score = 180 bits (91), Expect = 2e-043
Identities = 159/181 (87%), Gaps = 3/181 (1%)
Strand = Plus / Minus
Query: 206 aagcattcaaggatagacctcgatgatgaccgatacgtcaccaatgacgggtagaatttt 265
||||||||| |||||||||||||||| |||||| | |||| |||||||| |||||
Sbjct: 189 aagcattcatggatagacctcgatga---ccgatagagcgccaagaacgggtaggatttt 133
Query: 266 gtagtctttgaatccagcttcagtgaagatcttcttccactcttgctcgtcacgctcaac 325
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||
Sbjct: 132 gtagtctttgaatccagcttcagtgaaaatcttcttccactcttgctcgtcgcgctcagg 73
Query: 326 tccgttaaccgccatcatatacaaatcaaacataacttgtgtctcttgatgctttatgtt 385
||| ||||||| ||| ||||||||||||||||| || ||||||||| |||||||| ||||
Sbjct: 72 tccattaaccgtcataatatacaaatcaaacatgacctgtgtctctagatgctttgtgtt 13
Query: 386 t 386
|
Sbjct: 12 t 12
>gb|BZ340811.1|BZ340811 ic41b10.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ic41b10 5', DNA sequence
Length = 400
Score = 165 bits (83), Expect = 1e-038
Identities = 249/303 (82%), Gaps = 6/303 (1%)
Strand = Plus / Plus
Query: 722 ctcgccgcactccctcagcacaattggcatgaggaagcggctgtccgcggccatgccttt 781
||||||||||||||| ||||| | |||||| ||||||||||| | || || | |||||
Sbjct: 30 ctcgccgcactccctgagcacgactggcatcaggaagcggctctgtgcagcgagcccttt 89
Query: 782 gttcagcaaggcgtttacgtcgtcagcatgttcccagatcgttggggtctggcggaacgc 841
|||||| | |||||| || |||||||||||||||||||| ||||| |||| ||||||
Sbjct: 90 gttcagtatggcgttggcgacgtcagcatgttcccagatccttgggacttggctgaacgc 149
Query: 842 caggccatacggggacggctcgtgctgctcctgccggaaccacgcggagatacccagggc 901
||||||| ||| ||||||||||| ||||||||||||||||||||| |||| |||| |||
Sbjct: 150 caggccaaacgccgacggctcgtggtgctcctgccggaaccacgcgcagatgcccatggc 209
Query: 902 gtgcggacaggcagcgataggctggagcgccagactcacaaagggagccaaggtcgccgt 961
|||||| || | ||| || |||||| ||| |||| ||| ||||||| || ||||
Sbjct: 210 gtgcggtgagacgctgatggggtggagcaccacgctcataaacggagccagtgttgccga 269
Query: 962 gctca---cgtcgtcgc---tgacgaggaagcgggaggctgccgtcaacctgtagacgac 1015
||||| ||||||||| ||||||||| |||||||||||||||| ||||||||||||
Sbjct: 270 gctcacctcgtcgtcgccgacgacgaggaaccgggaggctgccgtcagcctgtagacgac 329
Query: 1016 gac 1018
|||
Sbjct: 330 gac 332
>gb|CF431021.1|CF431021 NIT1_4_H02.b1_A002 Nitrogen-deficient seedlings Sorghum bicolor
cDNA clone NIT1_4_H02_A002 3', mRNA sequence
Length = 651
Score = 93.7 bits (47), Expect = 4e-017
Identities = 110/131 (83%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| |||||||| ||||||| ||| ||||| ||||| ||||||| ||||
Sbjct: 186 attattatcttccctcctgcatctcgtggaggtattgcttgtttgcagttcttcagtatc 127
Query: 477 ttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgca 536
|||||||||||||| || ||||||||| ||| | ||||||||| || ||| ||||
Sbjct: 126 ttgacacactcatcatcgtgccagtcatgcagaatccacttgaggaacactgcgtttgcc 67
Query: 537 ggtggaatact 547
|||||||||||
Sbjct: 66 ggtggaatact 56
>gb|CN135321.1|CN135321 OX1_32_B07.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_32_B07_A002 3', mRNA sequence
Length = 714
Score = 93.7 bits (47), Expect = 4e-017
Identities = 110/131 (83%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| |||||||| ||||||| ||| ||||| ||||| ||||||| ||||
Sbjct: 249 attattatcttccctcctgcatctcgtggaggtattgcttgtttgcagttcttcagtatc 190
Query: 477 ttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgca 536
|||||||||||||| || ||||||||| ||| | ||||||||| || ||| ||||
Sbjct: 189 ttgacacactcatcatcgtgccagtcatgcagaatccacttgaggaacactgcgtttgcc 130
Query: 537 ggtggaatact 547
|||||||||||
Sbjct: 129 ggtggaatact 119
>gb|CN151211.1|CN151211 WOUND1_74_C10.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_74_C10_A002 3', mRNA sequence
Length = 780
Score = 93.7 bits (47), Expect = 4e-017
Identities = 110/131 (83%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| |||||||| ||||||| ||| ||||| ||||| ||||||| ||||
Sbjct: 325 attattatcttccctcctgcatctcgtggaggtattgcttgtttgcagttcttcagtatc 266
Query: 477 ttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgca 536
|||||||||||||| || ||||||||| ||| | ||||||||| || ||| ||||
Sbjct: 265 ttgacacactcatcatcgtgccagtcatgcagaatccacttgaggaacactgcgtttgcc 206
Query: 537 ggtggaatact 547
|||||||||||
Sbjct: 205 ggtggaatact 195
>gb|BE596903.1|BE596903 PI1_60_A01.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 676
Score = 85.7 bits (43), Expect = 1e-014
Identities = 109/131 (83%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| || ||||| ||||||| ||| |||| ||||| ||||||||||||
Sbjct: 209 attattatcttccctcccgcatctcgtggaggtattgcttttttgcagttcttcaatatc 150
Query: 477 ttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgca 536
|||||||||||||| ||| |||||| || ||| | ||||||||| |||||| | ||
Sbjct: 149 ttgacacactcatcatcattccagtcgtgaagaatccacttgaggaacacagcgttcgcc 90
Query: 537 ggtggaatact 547
|||||||||||
Sbjct: 89 ggtggaatact 79
Score = 61.9 bits (31), Expect = 2e-007
Identities = 55/63 (87%)
Strand = Plus / Minus
Query: 260 aattttgtagtctttgaatccagcttcagtgaagatcttcttccactcttgctcgtcacg 319
|||||||||||| ||||||||||| || ||| |||||||||||||||||||| || ||
Sbjct: 366 aattttgtagtccttgaatccagcctcgaagaaaatcttcttccactcttgctcatctcg 307
Query: 320 ctc 322
|||
Sbjct: 306 ctc 304
>gb|CB925746.1|CB925746 ABA1_23_E12.b1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_23_E12_A012 3', mRNA sequence
Length = 534
Score = 83.8 bits (42), Expect = 4e-014
Identities = 66/74 (89%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| |||||||| ||||||| ||| ||||| ||||| ||||||| ||||
Sbjct: 77 attattatcttccctcctgcatctcgtggaggtattgcttgtttgcagttcttcagtatc 18
Query: 477 ttgacacactcatc 490
||||||||||||||
Sbjct: 17 ttgacacactcatc 4
>gb|CW063049.1|CW063049 104_308_10521687_1_30092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10521687, DNA
sequence
Length = 635
Score = 81.8 bits (41), Expect = 2e-013
Identities = 116/141 (82%)
Strand = Plus / Minus
Query: 416 gattattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatat 475
||||||||||||||| |||||| | ||||||| ||| || |||||||| ||||||| |||
Sbjct: 297 gattattaccttccctcctgcagctcgtggaggtatagcctgcttgcacttcttcagtat 238
Query: 476 cttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgc 535
||| |||||||| ||||| | |||||| || ||| | |||||| || |||||| ||
Sbjct: 237 cttcacacactcgtcgtcgctccagtcgtgcagaatccacttgagcaacacagcgtccgc 178
Query: 536 aggtggaatactctcaaacat 556
|| |||||||||||||||||
Sbjct: 177 cggaggaatactctcaaacat 157
Score = 56.0 bits (28), Expect = 9e-006
Identities = 61/72 (84%)
Strand = Plus / Minus
Query: 599 ggcgacaacgtgcgggaggtcaagcacgctgcacttgaggtgggggaaggcggcggcgat 658
|||||| || ||||||||||| ||||| |||||||||||| ||||| || || |||||
Sbjct: 108 ggcgacgacctgcgggaggtccagcaccgtgcacttgaggtccgggaacgctgccgcgat 49
Query: 659 ggtggcggcggc 670
| ||||||||||
Sbjct: 48 gttggcggcggc 37
Score = 42.1 bits (21), Expect = 0.14
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 290 gaagatcttcttccactcttgctcgtcacgctc 322
|||||||||||||||||| ||||||| |||||
Sbjct: 438 gaagatcttcttccactccagctcgtctcgctc 406
>gb|CW152280.1|CW152280 104_553_11144405_116_36323_023 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11144405, DNA
sequence
Length = 684
Score = 81.8 bits (41), Expect = 2e-013
Identities = 116/141 (82%)
Strand = Plus / Plus
Query: 416 gattattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatat 475
||||||||||||||| |||||| | ||||||| ||| || |||||||| ||||||| |||
Sbjct: 60 gattattaccttccctcctgcagctcgtggaggtatagcctgcttgcacttcttcagtat 119
Query: 476 cttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgc 535
||| |||||||| ||||| | |||||| || ||| | |||||| || |||||| ||
Sbjct: 120 cttcacacactcgtcgtcgctccagtcgtgcagaatccacttgagcaacacagcgtccgc 179
Query: 536 aggtggaatactctcaaacat 556
|| |||||||||||||||||
Sbjct: 180 cggaggaatactctcaaacat 200
Score = 56.0 bits (28), Expect = 9e-006
Identities = 61/72 (84%)
Strand = Plus / Plus
Query: 599 ggcgacaacgtgcgggaggtcaagcacgctgcacttgaggtgggggaaggcggcggcgat 658
|||||| || ||||||||||| ||||| |||||||||||| ||||| || || |||||
Sbjct: 249 ggcgacgacctgcgggaggtccagcaccgtgcacttgaggtccgggaacgctgccgcgat 308
Query: 659 ggtggcggcggc 670
| ||||||||||
Sbjct: 309 gttggcggcggc 320
>gb|BG558734.1|BG558734 RHIZ2_59_G10.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 532
Score = 81.8 bits (41), Expect = 2e-013
Identities = 107/129 (82%)
Strand = Plus / Minus
Query: 453 gcttgcttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatgtagagtt 512
|||||||| ||||||||||||||||||| ||||||||| || ||||||||||| | | |
Sbjct: 130 gcttgcttacaattcttcaatatcttgatacactcatcatcgccccagtcatgcaaaatc 71
Query: 513 ttcttgaggaaaacagcggttgcaggtggaatactctcaaacatattgcctgcgacgaac 572
||||||||| ||||| |||| |||||||| |||| |||||| | || || || |||
Sbjct: 70 cacttgaggaagacagcatttgccggtggaatgctctgaaacatgtcacccgcaacaaac 11
Query: 573 tgcacgttg 581
|||||||||
Sbjct: 10 tgcacgttg 2
>gb|CF490081.1|CF490081 POL1_62_H01.b1_A002 Pollen Sorghum bicolor cDNA clone
POL1_62_H01_A002 3', mRNA sequence
Length = 623
Score = 81.8 bits (41), Expect = 2e-013
Identities = 116/141 (82%)
Strand = Plus / Minus
Query: 416 gattattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatat 475
||||||||||||||| |||||| | ||||||| ||| || |||||||| ||||||| |||
Sbjct: 226 gattattaccttccctcctgcagctcgtggaggtatagcctgcttgcacttcttcagtat 167
Query: 476 cttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgc 535
||| |||||||| ||||| | |||||| || ||| | |||||| || |||||| ||
Sbjct: 166 cttcacacactcgtcgtcgctccagtcgtgcagaatccacttgagcaacacagcgtccgc 107
Query: 536 aggtggaatactctcaaacat 556
|| |||||||||||||||||
Sbjct: 106 cggaggaatactctcaaacat 86
Score = 42.1 bits (21), Expect = 0.14
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 290 gaagatcttcttccactcttgctcgtcacgctc 322
|||||||||||||||||| ||||||| |||||
Sbjct: 367 gaagatcttcttccactccagctcgtctcgctc 335
>gb|CF431162.1|CF431162 NIT1_6_C08.b1_A002 Nitrogen-deficient seedlings Sorghum bicolor
cDNA clone NIT1_6_C08_A002 3', mRNA sequence
Length = 487
Score = 79.8 bits (40), Expect = 6e-013
Identities = 91/108 (84%)
Strand = Plus / Minus
Query: 449 tatggcttgcttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatgtag 508
|||||||| |||||| |||||||||||||||||||| || | |||||||||||||| ||
Sbjct: 156 tatggctttcttgcagttcttcaatatcttgacacattcggcatcaccccagtcatgcag 97
Query: 509 agttttcttgaggaaaacagcggttgcaggtggaatactctcaaacat 556
| | |||||||||||| ||| |||| | ||||| |||||||||||
Sbjct: 96 aatccacttgaggaaaaccgcgtttgctgacggaatgctctcaaacat 49
>gb|CW353559.1|CW353559 fsbb001f016f20k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f016f20, DNA
sequence
Length = 740
Score = 75.8 bits (38), Expect = 1e-011
Identities = 65/74 (87%)
Strand = Plus / Plus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| || ||||| ||||||| ||| |||| ||||| ||||||||||||
Sbjct: 435 attattatcttccctcccgcatctcgtggaggtattgcttttttgcagttcttcaatatc 494
Query: 477 ttgacacactcatc 490
||||||||||||||
Sbjct: 495 ttgacacactcatc 508
Score = 61.9 bits (31), Expect = 2e-007
Identities = 55/63 (87%)
Strand = Plus / Plus
Query: 260 aattttgtagtctttgaatccagcttcagtgaagatcttcttccactcttgctcgtcacg 319
|||||||||||| ||||||||||| || ||| |||||||||||||||||||| || ||
Sbjct: 278 aattttgtagtccttgaatccagcctcgaagaaaatcttcttccactcttgctcatctcg 337
Query: 320 ctc 322
|||
Sbjct: 338 ctc 340
>gb|CW392630.1|CW392630 fsbb001f079f09f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f079f09, DNA
sequence
Length = 655
Score = 71.9 bits (36), Expect = 2e-010
Identities = 63/72 (87%)
Strand = Plus / Minus
Query: 416 gattattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatat 475
||||||||||||||| |||||| | ||||||| ||| || |||||||| ||||||| |||
Sbjct: 75 gattattaccttccctcctgcagctcgtggaggtatagcctgcttgcacttcttcagtat 16
Query: 476 cttgacacactc 487
||| ||||||||
Sbjct: 15 cttcacacactc 4
Score = 42.1 bits (21), Expect = 0.14
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 290 gaagatcttcttccactcttgctcgtcacgctc 322
|||||||||||||||||| ||||||| |||||
Sbjct: 216 gaagatcttcttccactccagctcgtctcgctc 184
>gb|CD235375.1|CD235375 SS1_29_H10.b1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_29_H10_A012 3', mRNA sequence
Length = 652
Score = 71.9 bits (36), Expect = 2e-010
Identities = 90/108 (83%)
Strand = Plus / Minus
Query: 449 tatggcttgcttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatgtag 508
|||||||| |||||| |||||||||||||||||||| || | |||||||||||||| ||
Sbjct: 313 tatggctttcttgcagttcttcaatatcttgacacattcggcatcaccccagtcatgcag 254
Query: 509 agttttcttgaggaaaacagcggttgcaggtggaatactctcaaacat 556
| | ||||||||| || ||| |||| | ||||| |||||||||||
Sbjct: 253 aatccacttgaggaagaccgcgtttgctgacggaatgctctcaaacat 206
Score = 46.1 bits (23), Expect = 0.009
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 599 ggcgacaacgtgcgggaggtcaagcacgctgcact 633
|||||||||||| ||||| || |||||||||||||
Sbjct: 163 ggcgacaacgtgtgggagatccagcacgctgcact 129
>gb|CF433158.1|CF433158 NIT1_25_E08.b1_A002 Nitrogen-deficient seedlings Sorghum bicolor
cDNA clone NIT1_25_E08_A002 3', mRNA sequence
Length = 626
Score = 71.9 bits (36), Expect = 2e-010
Identities = 90/108 (83%)
Strand = Plus / Minus
Query: 449 tatggcttgcttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatgtag 508
|||||||| |||||| |||||||||||||||||||| || | |||||||||||||| ||
Sbjct: 226 tatggctttcttgcagttcttcaatatcttgacacattcggcatcaccccagtcatgcag 167
Query: 509 agttttcttgaggaaaacagcggttgcaggtggaatactctcaaacat 556
| | ||||||||| || ||| |||| | ||||| |||||||||||
Sbjct: 166 aatccacttgaggaagaccgcgtttgctgacggaatgctctcaaacat 119
>gb|CN148575.1|CN148575 WOUND1_57_A09.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_57_A09_A002 5', mRNA sequence
Length = 863
Score = 71.9 bits (36), Expect = 2e-010
Identities = 90/108 (83%)
Strand = Plus / Minus
Query: 449 tatggcttgcttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatgtag 508
|||||||| |||||| |||||||||||||||||||| || | |||||||||||||| ||
Sbjct: 862 tatggctttcttgcagttcttcaatatcttgacacattcggcatcaccccagtcatgcag 803
Query: 509 agttttcttgaggaaaacagcggttgcaggtggaatactctcaaacat 556
| | ||||||||| || ||| |||| | ||||| |||||||||||
Sbjct: 802 aatccacttgaggaagaccgcgtttgctgacggaatgctctcaaacat 755
Score = 50.1 bits (25), Expect = 6e-004
Identities = 40/45 (88%)
Strand = Plus / Minus
Query: 1079 gacgacgctgaagatgcccgtgacggtgagcacgcgcatgaggcg 1123
|||||||||||||| ||| |||| |||||||| |||||||||||
Sbjct: 280 gacgacgctgaagacgccggtgagagtgagcacacgcatgaggcg 236
Score = 46.1 bits (23), Expect = 0.009
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 599 ggcgacaacgtgcgggaggtcaagcacgctgcact 633
|||||||||||| ||||| || |||||||||||||
Sbjct: 712 ggcgacaacgtgtgggagatccagcacgctgcact 678
Score = 42.1 bits (21), Expect = 0.14
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 1203 tggtggatcgcgtcggggatgcggaggtc 1231
||||||| ||||||||||||||||||||
Sbjct: 159 tggtggacggcgtcggggatgcggaggtc 131
>gb|BG463547.1|BG463547 EM1_49_H04.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 540
Score = 69.9 bits (35), Expect = 6e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 453 gcttgcttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatgta 507
|||||||||||||||||||||||||||| ||||||||| | | |||||||||||
Sbjct: 99 gcttgcttgcaattcttcaatatcttgatacactcatcattgctccagtcatgta 45
Score = 44.1 bits (22), Expect = 0.035
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 264 ttgtagtctttgaatccagcttcagtgaagatcttcttccactcttgctc 313
|||||||| || ||||||||||| ||| || |||||||||||||||||
Sbjct: 288 ttgtagtccttaaatccagcttcgaggaatattttcttccactcttgctc 239
>gb|CL179753.1|CL179753 104_389_10895528_148_31907_056 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10895528, DNA
sequence
Length = 693
Score = 67.9 bits (34), Expect = 2e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 453 gcttgcttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||||| ||||||||||||||||||| ||||||||| || | |||||||||
Sbjct: 627 gcttgcttacaattcttcaatatcttgatacactcatcatcgcnccagtcatg 575
>gb|CN129547.1|CN129547 RHOH1_36_B08.b3_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_36_B08_A002 3', mRNA sequence
Length = 793
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| ||| || |||||||| ||||||| ||| |||| ||||| ||||||| ||||
Sbjct: 434 attattatctttcctcctgcatctcgtggaggtattgcttttttgcagttcttcagtatc 375
Query: 477 ttgacacactcatc 490
||||||||||||||
Sbjct: 374 ttgacacactcatc 361
Score = 54.0 bits (27), Expect = 4e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 292 agatcttcttccactcttgctcgtcacgctc 322
||||||||||||||||||||||||| |||||
Sbjct: 568 agatcttcttccactcttgctcgtctcgctc 538
>gb|CX606124.1|CX606124 ANR1_1_F10.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_1_F10_A002 3', mRNA sequence
Length = 675
Score = 67.9 bits (34), Expect = 2e-009
Identities = 130/162 (80%)
Strand = Plus / Minus
Query: 397 atccaactaccacatccaagattattaccttcccacctgcatcccgtggagatatggctt 456
||||||| |||| ||| | |||||||||||| || ||| |||| ||||||| ||| ||||
Sbjct: 194 atccaaccaccatatctatgattattacctttcctcctacatctcgtggaggtatagctt 135
Query: 457 gcttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatgtagagttttct 516
| || || ||||| | |||||||||||| ||||| ||| |||||| || ||| | ||
Sbjct: 134 gtttacagttctttagtatcttgacacagtcatcatcattccagtcgtgcagaatccact 75
Query: 517 tgaggaaaacagcggttgcaggtggaatactctcaaacatat 558
||||||| |||||| || ||||||||||| | ||||||||
Sbjct: 74 tgaggaacacagcgtcggccggtggaatactttgaaacatat 33
Score = 48.1 bits (24), Expect = 0.002
Identities = 57/68 (83%)
Strand = Plus / Minus
Query: 255 ggtagaattttgtagtctttgaatccagcttcagtgaagatcttcttccactcttgctcg 314
|||| |||||| ||||||| |||||||| || ||| ||||||||||||||||||||
Sbjct: 336 ggtataattttatagtcttcaaatccagcctccaagaaaatcttcttccactcttgctca 277
Query: 315 tcacgctc 322
|| |||||
Sbjct: 276 tctcgctc 269
>gb|CX607042.1|CX607042 ANR1_6_H06.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_6_H06_A002 3', mRNA sequence
Length = 733
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| ||| || |||||||| ||||||| ||| |||| ||||| ||||||| ||||
Sbjct: 321 attattatctttcctcctgcatctcgtggaggtattgcttttttgcagttcttcagtatc 262
Query: 477 ttgacacactcatc 490
||||||||||||||
Sbjct: 261 ttgacacactcatc 248
Score = 54.0 bits (27), Expect = 4e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 292 agatcttcttccactcttgctcgtcacgctc 322
||||||||||||||||||||||||| |||||
Sbjct: 455 agatcttcttccactcttgctcgtctcgctc 425
>gb|CX608050.1|CX608050 ANR1_32_G10.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_32_G10_A002 3', mRNA sequence
Length = 617
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| ||| || |||||||| ||||||| ||| |||| ||||| ||||||| ||||
Sbjct: 184 attattatctttccccctgcatctcgtggaggtattgcttttttgcagttcttcagtatc 125
Query: 477 ttgacacactcatc 490
||||||||||||||
Sbjct: 124 ttgacacactcatc 111
Score = 54.0 bits (27), Expect = 4e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 292 agatcttcttccactcttgctcgtcacgctc 322
||||||||||||||||||||||||| |||||
Sbjct: 318 agatcttcttccactcttgctcgtctcgctc 288
>gb|CX620993.1|CX620993 GABR1_55_G09.b1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_55_G09_A002 3', mRNA sequence
Length = 667
Score = 67.9 bits (34), Expect = 2e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| ||| || |||||||| ||||||| ||| |||| ||||| ||||||| ||||
Sbjct: 233 attattatctttcctcctgcatctcgtggaggtattgcttttttgcagttcttcagtatc 174
Query: 477 ttgacacactcatc 490
||||||||||||||
Sbjct: 173 ttgacacactcatc 160
Score = 54.0 bits (27), Expect = 4e-005
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 292 agatcttcttccactcttgctcgtcacgctc 322
||||||||||||||||||||||||| |||||
Sbjct: 367 agatcttcttccactcttgctcgtctcgctc 337
>gb|CW364958.1|CW364958 fsbb001f037d22f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f037d22, DNA
sequence
Length = 730
Score = 65.9 bits (33), Expect = 1e-008
Identities = 51/57 (89%)
Strand = Plus / Plus
Query: 449 tatggcttgcttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||||| |||||| |||||||||||||||||||| || | ||||||||||||||
Sbjct: 586 tatggctttcttgcagttcttcaatatcttgacacattcggcatcaccccagtcatg 642
>gb|CL152122.1|CL152122 104_335_10779735_116_31364_135 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10779735, DNA
sequence
Length = 699
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 414 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 461
>gb|CL152965.1|CL152965 104_337_10780377_116_31368_009 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10780377, DNA
sequence
Length = 583
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 414 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 461
>gb|CW124854.1|CW124854 104_504_11112012_116_34706_034 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11112012, DNA
sequence
Length = 512
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 326 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 373
>gb|CW255681.1|CW255681 104_720_11226371_148_35403_042 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226371, DNA
sequence
Length = 706
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 299 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 346
>gb|AW923055.1|AW923055 DG1_48_G01.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 690
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Minus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 211 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 164
>gb|CD234204.1|CD234204 SS1_26_B02.b1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_26_B02_A012 3', mRNA sequence
Length = 618
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Minus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 157 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 110
>gb|CD236143.1|CD236143 SS1_32_H03.b1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_32_H03_A012 3', mRNA sequence
Length = 531
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Minus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 65 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 18
>gb|CF429614.1|CF429614 PH1_23_D07.b1_A002 Phosphorous-deficient seedlings Sorghum bicolor
cDNA clone PH1_23_D07_A002 3', mRNA sequence
Length = 632
Score = 63.9 bits (32), Expect = 4e-008
Identities = 113/140 (80%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| || ||||| |||| || ||| |||| || |||||||||| ||||
Sbjct: 301 attattatcttccctccggcatctcgtgaaggtattgcttttttacaattcttcagtatc 242
Query: 477 ttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgca 536
|||||||||||||| || |||||| || ||| | ||||||||| |||||| | ||
Sbjct: 241 ttgacacactcatcatcgttccagtcgtgcagaactaacttgaggaacacagcgttcgcc 182
Query: 537 ggtggaatactctcaaacat 556
||||||||||| | ||||||
Sbjct: 181 ggtggaatactttgaaacat 162
Score = 56.0 bits (28), Expect = 9e-006
Identities = 58/68 (85%)
Strand = Plus / Minus
Query: 261 attttgtagtctttgaatccagcttcagtgaagatcttcttccactcttgctcgtcacgc 320
||||||||||| |||||||| || || | |||||||||||||||||||||| || |||
Sbjct: 466 attttgtagtccttgaatcccgcctcgaaggagatcttcttccactcttgctcatctcgc 407
Query: 321 tcaactcc 328
|| |||||
Sbjct: 406 tcgactcc 399
>gb|CF432260.1|CF432260 NIT1_15_D05.b1_A002 Nitrogen-deficient seedlings Sorghum bicolor
cDNA clone NIT1_15_D05_A002 3', mRNA sequence
Length = 538
Score = 63.9 bits (32), Expect = 4e-008
Identities = 113/140 (80%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| || ||||| |||| || ||| |||| || |||||||||| ||||
Sbjct: 198 attattatcttccctccggcatctcgtgaaggtattgcttttttacaattcttcagtatc 139
Query: 477 ttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgca 536
|||||||||||||| || |||||| || ||| | ||||||||| |||||| | ||
Sbjct: 138 ttgacacactcatcatcgttccagtcgtgcagaactaacttgaggaacacagcgttcgcc 79
Query: 537 ggtggaatactctcaaacat 556
||||||||||| | ||||||
Sbjct: 78 ggtggaatactttgaaacat 59
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 261 attttgtagtctttgaatccagcttcagtgaagatcttcttccactcttgctcgtcacgc 320
||||||||||| |||||||| || || | |||||||||||||||||||||| || |||
Sbjct: 363 attttgtagtccttgaatcccgcctcgaaggagatcttcttccactcttgctcatctcgc 304
Query: 321 tcaactccgtt 331
|| ||||||||
Sbjct: 303 tcgactccgtt 293
>gb|CN124677.1|CN124677 RHOH1_6_F06.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_6_F06_A002 3', mRNA sequence
Length = 619
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Minus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 99 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 52
>gb|CN129718.1|CN129718 RHOH1_37_B03.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_37_B03_A002 3', mRNA sequence
Length = 774
Score = 63.9 bits (32), Expect = 4e-008
Identities = 113/140 (80%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| || ||||| |||| || ||| |||| || |||||||||| ||||
Sbjct: 310 attattatcttccctccggcatctcgtgaaggtattgcttttttacaattcttcagtatc 251
Query: 477 ttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgca 536
|||||||||||||| || |||||| || ||| | ||||||||| |||||| | ||
Sbjct: 250 ttgacacactcatcatcgttccagtcgtgcagaactaacttgaggaacacagcgttcgcc 191
Query: 537 ggtggaatactctcaaacat 556
||||||||||| | ||||||
Sbjct: 190 ggtggaatactttgaaacat 171
Score = 56.0 bits (28), Expect = 9e-006
Identities = 58/68 (85%)
Strand = Plus / Minus
Query: 261 attttgtagtctttgaatccagcttcagtgaagatcttcttccactcttgctcgtcacgc 320
||||||||||| |||||||| || || | |||||||||||||||||||||| || |||
Sbjct: 475 attttgtagtccttgaatcccgcctcgaaggagatcttcttccactcttgctcatctcgc 416
Query: 321 tcaactcc 328
|| |||||
Sbjct: 415 tcgactcc 408
>gb|CN130050.1|CN130050 RHOH1_39_A12.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_39_A12_A002 3', mRNA sequence
Length = 690
Score = 63.9 bits (32), Expect = 4e-008
Identities = 113/140 (80%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| || ||||| |||| || ||| |||| || |||||||||| ||||
Sbjct: 323 attattatcttccctccggcatctcgtgaaggtattgcttttttacaattcttcagtatc 264
Query: 477 ttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgca 536
|||||||||||||| || |||||| || ||| | ||||||||| |||||| | ||
Sbjct: 263 ttgacacactcatcatccttccagtcgtgcagaactaacttgaggaacacagcgttcgcc 204
Query: 537 ggtggaatactctcaaacat 556
||||||||||| | ||||||
Sbjct: 203 ggtggaatactttgaaacat 184
Score = 56.0 bits (28), Expect = 9e-006
Identities = 58/68 (85%)
Strand = Plus / Minus
Query: 261 attttgtagtctttgaatccagcttcagtgaagatcttcttccactcttgctcgtcacgc 320
||||||||||| |||||||| || || | |||||||||||||||||||||| || |||
Sbjct: 488 attttgtagtccttgaatcccgcctcgaaggagatcttcttccactcttgctcatctcgc 429
Query: 321 tcaactcc 328
|| |||||
Sbjct: 428 tcgactcc 421
>gb|CN135665.1|CN135665 OX1_38_F05.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_38_F05_A002 3', mRNA sequence
Length = 741
Score = 63.9 bits (32), Expect = 4e-008
Identities = 113/140 (80%)
Strand = Plus / Minus
Query: 417 attattaccttcccacctgcatcccgtggagatatggcttgcttgcaattcttcaatatc 476
||||||| |||||| || ||||| |||| || ||| |||| || |||||||||| ||||
Sbjct: 277 attattatcttccctccggcatctcgtgaaggtattgcttttttacaattcttcagtatc 218
Query: 477 ttgacacactcatcgtcaccccagtcatgtagagttttcttgaggaaaacagcggttgca 536
|||||||||||||| || |||||| || ||| | ||||||||| |||||| | ||
Sbjct: 217 ttgacacactcatcatcgttccagtcgtgcagaactaacttgaggaacacagcgttcgcc 158
Query: 537 ggtggaatactctcaaacat 556
||||||||||| | ||||||
Sbjct: 157 ggtggaatactttgaaacat 138
Score = 56.0 bits (28), Expect = 9e-006
Identities = 58/68 (85%)
Strand = Plus / Minus
Query: 261 attttgtagtctttgaatccagcttcagtgaagatcttcttccactcttgctcgtcacgc 320
||||||||||| |||||||| || || | |||||||||||||||||||||| || |||
Sbjct: 442 attttgtagtccttgaatcccgcctcgaaggagatcttcttccactcttgctcatctcgc 383
Query: 321 tcaactcc 328
|| |||||
Sbjct: 382 tcgactcc 375
>gb|CN141678.1|CN141678 WOUND1_1_E01.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_1_E01_A002 3', mRNA sequence
Length = 584
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Minus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 122 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 75
>gb|CN145288.1|CN145288 WOUND1_28_A10.b2_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_28_A10_A002 3', mRNA sequence
Length = 623
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Minus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 137 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 90
>gb|CN146677.1|CN146677 WOUND1_43_B07.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_43_B07_A002 3', mRNA sequence
Length = 754
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Minus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 304 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 257
>gb|CN149045.1|CN149045 WOUND1_60_H10.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_60_H10_A002 3', mRNA sequence
Length = 681
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Minus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 224 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 177
>gb|CN150014.1|CN150014 WOUND1_66_H05.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_66_H05_A002 3', mRNA sequence
Length = 627
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Minus
Query: 458 cttgcaattcttcaatatcttgacacactcatcgtcaccccagtcatg 505
|||||| |||||||||||||||||||| ||| |||||||||| |||||
Sbjct: 161 cttgcagttcttcaatatcttgacacattcagcgtcaccccaatcatg 114
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 495,877
Number of Sequences: 832831
Number of extensions: 495877
Number of successful extensions: 150662
Number of sequences better than 0.5: 183
Number of HSP's better than 0.5 without gapping: 181
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 150033
Number of HSP's gapped (non-prelim): 593
length of query: 1432
length of database: 491,359,669
effective HSP length: 20
effective length of query: 1412
effective length of database: 474,703,049
effective search space: 670280705188
effective search space used: 670280705188
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)