BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3071103.2.1
(570 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE597906.1|BE597906 PI1_66_H02.g1_A002 Pathogen induced ... 547 e-154
gb|BE598196.1|BE598196 PI1_66_H02.b1_A002 Pathogen induced ... 244 7e-063
gb|CW402098.1|CW402098 fsbb001f093d20k0 Sorghum methylation... 137 1e-030
gb|CW307372.1|CW307372 104_795_11468105_148_35736_073 Sorgh... 117 1e-024
gb|CW206617.1|CW206617 104_635_11187687_116_36961_058 Sorgh... 113 2e-023
gb|CW488277.1|CW488277 fsbb001f254j12f0 Sorghum methylation... 113 2e-023
gb|BE598085.1|BE598085 PI1_65_E11.b1_A002 Pathogen induced ... 113 2e-023
gb|BE597800.1|BE597800 PI1_65_E11.g1_A002 Pathogen induced ... 107 1e-021
gb|BZ338038.1|BZ338038 ia92e12.b1 WGS-SbicolorF (JM107 adap... 96 4e-018
gb|CW276618.1|CW276618 104_750_11405587_148_35398_074 Sorgh... 96 4e-018
gb|CW388024.1|CW388024 fsbb001f072j20f0 Sorghum methylation... 96 4e-018
gb|CW388025.1|CW388025 fsbb001f072j20k0 Sorghum methylation... 96 4e-018
gb|BE367523.1|BE367523 PI1_8_E06.g1_A002 Pathogen induced 1... 92 7e-017
gb|CW039394.1|CW039394 104_272_10505475_115_30390 Sorghum m... 72 6e-011
gb|CW110423.1|CW110423 104_483_11103696_148_34524_094 Sorgh... 72 6e-011
gb|CW204755.1|CW204755 104_632_11186715_116_37060_002 Sorgh... 72 6e-011
gb|BE362915.2|BE362915 DG1_90_E12.g1_A002 Dark Grown 1 (DG1... 72 6e-011
gb|CW265113.1|CW265113 104_734_11231683_116_35257_076 Sorgh... 64 1e-008
gb|CW265114.1|CW265114 104_734_11231683_148_35261_076 Sorgh... 64 1e-008
gb|CF760116.1|CF760116 DSAF1_55_F11.b1_A011 Drought-stresse... 64 1e-008
gb|CW266083.1|CW266083 104_735_11232237_148_35267_085 Sorgh... 62 6e-008
gb|CW454488.1|CW454488 fsbb001f198p08f0 Sorghum methylation... 62 6e-008
gb|BE358858.1|BE358858 DG1_32_F07.g1_A002 Dark Grown 1 (DG1... 62 6e-008
gb|CW117036.1|CW117036 104_493_11107443_148_34610_016 Sorgh... 60 2e-007
gb|CW275250.1|CW275250 104_748_11404861_148_35382_055 Sorgh... 60 2e-007
gb|CW448428.1|CW448428 fsbb001f182a11k0 Sorghum methylation... 60 2e-007
gb|CW470070.1|CW470070 fsbb001f223b16f0 Sorghum methylation... 60 2e-007
gb|CW489486.1|CW489486 fsbb001f274h04f0 Sorghum methylation... 60 2e-007
gb|CW493211.1|CW493211 fsbb001f283n22k0 Sorghum methylation... 60 2e-007
gb|BE357811.1|BE357811 DG1_22_D10.g1_A002 Dark Grown 1 (DG1... 60 2e-007
gb|BG049053.1|BG049053 OV1_22_F09.g1_A002 Ovary 1 (OV1) Sor... 60 2e-007
gb|BG049497.1|BG049497 OV1_20_G04.g1_A002 Ovary 1 (OV1) Sor... 60 2e-007
gb|BG102665.1|BG102665 RHIZ2_35_G08.g1_A003 Rhizome2 (RHIZ2... 60 2e-007
gb|CW159280.1|CW159280 104_565_11149276_148_36409_010 Sorgh... 58 9e-007
gb|AW746206.1|AW746206 WS1_40_B10.b1_A002 Water-stressed 1 ... 58 9e-007
gb|CW307371.1|CW307371 104_795_11468105_116_35728_073 Sorgh... 56 4e-006
gb|CW231901.1|CW231901 104_681_11211372_148_37350_042 Sorgh... 54 1e-005
gb|CW285685.1|CW285685 104_763_11410466_148_35506_013 Sorgh... 54 1e-005
gb|BE357733.1|BE357733 DG1_22_D10.b1_A002 Dark Grown 1 (DG1... 54 1e-005
gb|BG464063.1|BG464063 EM1_69_B11.b1_A002 Embryo 1 (EM1) So... 54 1e-005
gb|CW066077.1|CW066077 104_313_10523499_114_30148 Sorghum m... 52 6e-005
gb|CW069060.1|CW069060 104_318_10525580_1_30095 Sorghum met... 50 2e-004
gb|CD429983.1|CD429983 ETH1_16_A10.g1_A002 Ethylene-treated... 50 2e-004
gb|CW263590.1|CW263590 104_731_11230799_148_35217_082 Sorgh... 48 9e-004
gb|BE366378.1|BE366378 PI1_32_H10.g1_A002 Pathogen induced ... 48 9e-004
gb|CN129927.1|CN129927 RHOH1_38_F07.b1_A002 Acid- and alkal... 48 9e-004
gb|CN130014.1|CN130014 RHOH1_38_F07.g1_A002 Acid- and alkal... 48 9e-004
gb|BG464391.1|BG464391 EM1_69_B11.g1_A002 Embryo 1 (EM1) So... 44 0.014
gb|CW056944.1|CW056944 104_298_10517953_114_30151 Sorghum m... 42 0.055
gb|CW324492.1|CW324492 104_819_11477191_148_35910_030 Sorgh... 42 0.055
gb|CW363965.1|CW363965 fsbb001f035m22f0 Sorghum methylation... 42 0.055
gb|CW405242.1|CW405242 fsbb001f097l13f0 Sorghum methylation... 42 0.055
gb|CW430428.1|CW430428 fsbb001f144c05f0 Sorghum methylation... 42 0.055
gb|CW430429.1|CW430429 fsbb001f144c05k0 Sorghum methylation... 42 0.055
gb|CD227568.1|CD227568 CCC1_52_A02.b1_A007 Callus culture/c... 42 0.055
gb|CD227591.1|CD227591 CCC1_52_A02.g1_A007 Callus culture/c... 42 0.055
gb|CF486597.1|CF486597 POL1_38_D07.g1_A002 Pollen Sorghum b... 42 0.055
gb|CN125314.1|CN125314 RHOH1_10_G12.b1_A002 Acid- and alkal... 42 0.055
gb|CN130255.1|CN130255 RHOH1_40_F08.b1_A002 Acid- and alkal... 42 0.055
gb|CN130329.1|CN130329 RHOH1_40_F08.g1_A002 Acid- and alkal... 42 0.055
gb|CN137269.1|CN137269 OX1_56_F03.b1_A002 Oxidatively-stres... 42 0.055
gb|CN137353.1|CN137353 OX1_56_F03.g1_A002 Oxidatively-stres... 42 0.055
gb|CL161205.1|CL161205 104_352_10805558_114_31826_230 Sorgh... 40 0.22
gb|CL161206.1|CL161206 104_352_10805558_116_31827_230 Sorgh... 40 0.22
gb|CW150339.1|CW150339 104_549_11142974_116_36302_051 Sorgh... 40 0.22
gb|CW150340.1|CW150340 104_549_11142974_148_36301_051 Sorgh... 40 0.22
gb|CW204756.1|CW204756 104_632_11186715_148_36922_002 Sorgh... 40 0.22
gb|CW318996.1|CW318996 104_811_11474252_116_35881_074 Sorgh... 40 0.22
gb|CW357974.1|CW357974 fsbb001f024n22k0 Sorghum methylation... 40 0.22
gb|CW438619.1|CW438619 fsbb001f156f15f0 Sorghum methylation... 40 0.22
gb|AW922776.1|AW922776 DG1_46_C01.g1_A002 Dark Grown 1 (DG1... 40 0.22
gb|AW924229.1|AW924229 WS1_51_H04.b1_A002 Water-stressed 1 ... 40 0.22
gb|BE359997.1|BE359997 DG1_60_H07.g2_A002 Dark Grown 1 (DG1... 40 0.22
gb|CD423411.1|CD423411 SA1_23_C09.b1_A002 Salicylic acid-tr... 40 0.22
gb|CD423525.1|CD423525 SA1_23_C09.g1_A002 Salicylic acid-tr... 40 0.22
gb|CF486513.1|CF486513 POL1_38_D07.b1_A002 Pollen Sorghum b... 40 0.22
gb|CN134927.1|CN134927 OX1_29_A09.g1_A002 Oxidatively-stres... 40 0.22
gb|CN134928.1|CN134928 OX1_29_A10.g1_A002 Oxidatively-stres... 40 0.22
gb|CN151360.1|CN151360 WOUND1_75_B02.b1_A002 Wounded leaves... 40 0.22
gb|CN151443.1|CN151443 WOUND1_75_B02.g1_A002 Wounded leaves... 40 0.22
gb|CX610007.1|CX610007 ANR1_16_C10.b1_A002 Anaerobic roots ... 40 0.22
gb|CX610094.1|CX610094 ANR1_16_C10.g1_A002 Anaerobic roots ... 40 0.22
gb|CX613448.1|CX613448 GABR1_8_E12.b1_A002 GA- or brassinol... 40 0.22
gb|CX613534.1|CX613534 GABR1_8_E12.g1_A002 GA- or brassinol... 40 0.22
gb|CX616381.1|CX616381 GABR1_27_C09.g1_A002 GA- or brassino... 40 0.22
gb|AF402938.1|AF402938 Sorghum arundinaceum chitinase-B gen... 40 0.22
>gb|BE597906.1|BE597906 PI1_66_H02.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 708
Score = 547 bits (276), Expect = e-154
Identities = 377/410 (91%), Gaps = 3/410 (0%)
Strand = Plus / Minus
Query: 68 gttttcactgcgccgccacct---caaccgccagtccgctattgaagggcctctggccgt 124
|||||||||||||||||| || |||| |||| |||||||||| |||||||||||||
Sbjct: 509 gttttcactgcgccgccagctgctcaacggccaccgcgctattgaacggcctctggccgt 450
Query: 125 cgcaatcgagattgctcccgtagccgatgcggaagacatcgcagtagcgcttgtagaagc 184
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 449 cgcagtcgaggttgctcccgtagccgatgcggaagacatcgcagtagcgcttgtagaacc 390
Query: 185 caatccggtcggtgacccgggggtccgtcccgtgcccgcactcgatcccaccgttgatga 244
| |||||||| || ||||||||||| | ||||||||||||||||||||| ||||||||||
Sbjct: 389 cgatccggtccgtcacccgggggtcggccccgtgcccgcactcgatcccgccgttgatga 330
Query: 245 tgttggtgatcacgccgtaccctggcgcgccccggccggccgccctgtccgcagccgtgg 304
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
Sbjct: 329 tgttggtgatcacgccgtaccccggcgcgccccggccggccgccctgtccgccgccgtcg 270
Query: 305 gcgtccactgccccgtgatcacggcgtggcacgacggcttgttgtcccgcgcgttcatcc 364
|||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||
Sbjct: 269 gcgtccactgccccgtgatcaccgcgtggcacgacggcttgttgtccctcgccgtcatcc 210
Query: 365 agaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccgggttgt 424
||||||||||||| ||||||||||||| ||||||||| ||||| || |||||||||||||
Sbjct: 209 agaaccacagcgccgtcttgaaggataccacggggtcggtcgccaccaggtccgggttgt 150
Query: 425 tgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttg 474
| || ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 149 tcagcaggtccacgccgatggctctccccgccgggccgtagttgtagttg 100
>gb|BE598196.1|BE598196 PI1_66_H02.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 359
Score = 244 bits (123), Expect = 7e-063
Identities = 159/171 (92%)
Strand = Plus / Minus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttgttgtcccgcgcgttcatc 363
||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||
Sbjct: 358 ggcgtccactgccccgtgatcaccgcgtggcacgacggcttgttgtccctcgccgtcatc 299
Query: 364 cagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccgggttg 423
|||||||||||||| ||||||||||||| ||||||||| ||||| || ||||||||||||
Sbjct: 298 cagaaccacagcgccgtcttgaaggataccacggggtcggtcgccaccaggtccgggttg 239
Query: 424 ttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttg 474
|| || ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 238 ttcagcaggtccacgccgatggctctccccgccgggccgtagttgtagttg 188
Score = 127 bits (64), Expect = 1e-027
Identities = 76/80 (95%)
Strand = Plus / Minus
Query: 475 aaggagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactgc 534
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 89 aaggagatctggatggggccgcggccgaagtacttcttgccgggcgcgcagggccactcc 30
Query: 535 ggccgcggctcgcagtagtc 554
||||| |||| |||||||||
Sbjct: 29 ggccggggctggcagtagtc 10
>gb|CW402098.1|CW402098 fsbb001f093d20k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f093d20, DNA
sequence
Length = 275
Score = 137 bits (69), Expect = 1e-030
Identities = 84/89 (94%)
Strand = Plus / Plus
Query: 475 aaggagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactgc 534
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 66 aaggagatctggatggggccgcggccgaagtacttcttgccgggcgcgcagggccactcc 125
Query: 535 ggccgcggctcgcagtagtccgacggcgg 563
||||| |||| ||||||||| ||||||||
Sbjct: 126 ggccggggctggcagtagtcggacggcgg 154
>gb|CW307372.1|CW307372 104_795_11468105_148_35736_073 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11468105, DNA
sequence
Length = 603
Score = 117 bits (59), Expect = 1e-024
Identities = 128/151 (84%)
Strand = Plus / Minus
Query: 406 gcgacgaggtccgggttgttgaggaggtccacgccgatggctcgccccgccgggccgtag 465
||||| |||||||||||| ||||| | | |||||||||| | || || |||||||||
Sbjct: 311 gcgacaaggtccgggttggcgaggatgccggcgccgatggcctggccggcggggccgtag 252
Query: 466 ttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggcgcgcac 525
||||||||| |||||||||||||||| ||||||||| |||||||||| |||| ||||||
Sbjct: 251 ttgtagttgtaggagatctggatgggtccgcggccgtagtacttcttcccggcggcgcac 192
Query: 526 ggccactgcggccgcggctcgcagtagtccg 556
|||||||| | | ||||||||||||||||
Sbjct: 191 ggccactgtgtgctgggctcgcagtagtccg 161
Score = 60.0 bits (30), Expect = 2e-007
Identities = 39/42 (92%)
Strand = Plus / Minus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttg 345
||||||||||||||||| || ||| |||||||||||||||||
Sbjct: 413 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 372
Score = 56.0 bits (28), Expect = 4e-006
Identities = 85/104 (81%)
Strand = Plus / Minus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtcggtgacccgggggtccgtcccgtgcccg 222
|||||||||||||||||||| || |||| ||| | ||| |||| || | || || |||
Sbjct: 551 tcgcagtagcgcttgtagaacccgatcctgtccgcgacgcgggtatcggcgccatggccg 492
Query: 223 cactcgatcccaccgttgatgatgttggtgatcacgccgtaccc 266
||||||| || ||||||||||||||||||| ||||| |||||
Sbjct: 491 cactcgaggccgccgttgatgatgttggtgacgacgccataccc 448
>gb|CW206617.1|CW206617 104_635_11187687_116_36961_058 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11187687, DNA
sequence
Length = 639
Score = 113 bits (57), Expect = 2e-023
Identities = 204/253 (80%)
Strand = Plus / Plus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttgttgtcccgcgcgttcatc 363
||||||||||| || || || ||||||||||||||||||||| | ||| |||||
Sbjct: 251 ggcgtccactggccggtcatgacggcgtggcacgacggcttgggcgactgcggcgtcatc 310
Query: 364 cagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccgggttg 423
|||||||||| ||| |||| ||| || | ||||||| ||| || ||||||||||||
Sbjct: 311 cagaaccacaccgccgtctcgaacgacacggtcgggtccgacgccaccaggtccgggttg 370
Query: 424 ttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaaggagatc 483
||||| | | |||||||||| |||| || | |||||||||||||||| ||||||||
Sbjct: 371 gcgaggatgccggcgccgatggcctgcccggcggcgccgtagttgtagttgtaggagatc 430
Query: 484 tggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactgcggccgcggc 543
|||||||| || |||||| |||||||||| |||| |||||||||||||| | | |||
Sbjct: 431 tggatgggtccacggccgtagtacttcttcccggcggcgcacggccactgtgtgctgggc 490
Query: 544 tcgcagtagtccg 556
|||||||||||||
Sbjct: 491 tcgcagtagtccg 503
Score = 56.0 bits (28), Expect = 4e-006
Identities = 31/32 (96%)
Strand = Plus / Plus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtc 194
||||||||||||||||||||||| ||||||||
Sbjct: 113 tcgcagtagcgcttgtagaagccgatccggtc 144
>gb|CW488277.1|CW488277 fsbb001f254j12f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f254j12, DNA
sequence
Length = 507
Score = 113 bits (57), Expect = 2e-023
Identities = 204/253 (80%)
Strand = Plus / Plus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttgttgtcccgcgcgttcatc 363
||||||||||| || || || ||||||||||||||||||||| | ||| |||||
Sbjct: 69 ggcgtccactggccggtcatgacggcgtggcacgacggcttgggcgactgcggcgtcatc 128
Query: 364 cagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccgggttg 423
|||||||||| ||| |||| ||| || | ||||||| ||| || ||||||||||||
Sbjct: 129 cagaaccacaccgccgtctcgaacgacacggtcgggtccgacgccaccaggtccgggttg 188
Query: 424 ttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaaggagatc 483
||||| | | |||||||||| |||| || | |||||||||||||||| ||||||||
Sbjct: 189 gcgaggatgccggcgccgatggcctgcccggcggcgccgtagttgtagttgtaggagatc 248
Query: 484 tggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactgcggccgcggc 543
|||||||| || |||||| |||||||||| |||| |||||||||||||| | | |||
Sbjct: 249 tggatgggtccacggccgtagtacttcttcccggcggcgcacggccactgtgtgctgggc 308
Query: 544 tcgcagtagtccg 556
|||||||||||||
Sbjct: 309 tcgcagtagtccg 321
>gb|BE598085.1|BE598085 PI1_65_E11.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 632
Score = 113 bits (57), Expect = 2e-023
Identities = 204/253 (80%)
Strand = Plus / Minus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttgttgtcccgcgcgttcatc 363
||||||||||| || || || ||||||||||||||||||||| | ||| |||||
Sbjct: 375 ggcgtccactggccggtcatgacggcgtggcacgacggcttgggcgactgcggcgtcatc 316
Query: 364 cagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccgggttg 423
|||||||||| ||| |||| ||| || | ||||||| ||| || ||||||||||||
Sbjct: 315 cagaaccacaccgccgtctcgaacgacacggtcgggtccgacgccaccaggtccgggttg 256
Query: 424 ttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaaggagatc 483
||||| | | |||||||||| |||| || | |||||||||||||||| ||||||||
Sbjct: 255 gcgaggatgccggcgccgatggcctgcccggcggcgccgtagttgtagttgtaggagatc 196
Query: 484 tggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactgcggccgcggc 543
|||||||| || |||||| |||||||||| |||| |||||||||||||| | | |||
Sbjct: 195 tggatgggtccacggccgtagtacttcttcccggcggcgcacggccactgtgtgctgggc 136
Query: 544 tcgcagtagtccg 556
|||||||||||||
Sbjct: 135 tcgcagtagtccg 123
Score = 56.0 bits (28), Expect = 4e-006
Identities = 31/32 (96%)
Strand = Plus / Minus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtc 194
||||||||||||||||||||||| ||||||||
Sbjct: 513 tcgcagtagcgcttgtagaagccgatccggtc 482
>gb|BE597800.1|BE597800 PI1_65_E11.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 600
Score = 107 bits (54), Expect = 1e-021
Identities = 203/253 (80%)
Strand = Plus / Minus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttgttgtcccgcgcgttcatc 363
||||||||||| || || || ||||||||||||||||||||| | ||| |||||
Sbjct: 337 ggcgtccactggccggtcatgacggcgtggcacgacggcttgggcgactgcggcgtcatc 278
Query: 364 cagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccgggttg 423
|||||||||| ||| |||| ||| || | ||||||| ||| || ||||||||||||
Sbjct: 277 cagaaccacaccgccgtctcgaacgacacggtcgggtccgacgccaccaggtccgggttg 218
Query: 424 ttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaaggagatc 483
||||| | | |||||||||| |||| || | |||||||||||||||| ||||||||
Sbjct: 217 gcgaggatgccggcgccgatggcctgcccggcggcgccgtagttgtagttgtaggagatc 158
Query: 484 tggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactgcggccgcggc 543
|||||||| || |||||| |||||||||| |||| |||||||||||||| | | |||
Sbjct: 157 tggatgggtccacggccgtagtacttcttcccggcggcgcacggccactgtgtgctgggc 98
Query: 544 tcgcagtagtccg 556
|||||||| ||||
Sbjct: 97 tcgcagtantccg 85
Score = 56.0 bits (28), Expect = 4e-006
Identities = 31/32 (96%)
Strand = Plus / Minus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtc 194
||||||||||||||||||||||| ||||||||
Sbjct: 475 tcgcagtagcgcttgtagaagccgatccggtc 444
>gb|BZ338038.1|BZ338038 ia92e12.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone ia92e12 5', DNA sequence
Length = 608
Score = 95.6 bits (48), Expect = 4e-018
Identities = 66/72 (91%)
Strand = Plus / Plus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
||||||||||||||| |||||||||||||||| ||||||||| |||||||||| ||||
Sbjct: 394 ccgtagttgtagttgtaggagatctggatgggcccgcggccgtagtacttcttcccggcg 453
Query: 520 gcgcacggccac 531
||||||||||||
Sbjct: 454 gcgcacggccac 465
Score = 89.7 bits (45), Expect = 3e-016
Identities = 149/183 (81%), Gaps = 3/183 (1%)
Strand = Plus / Plus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtcggtgacccgggggtccgtcccgtgcccg 222
||||||||||||||||||||||| |||||||||| ||| ||| || | || || |||
Sbjct: 97 tcgcagtagcgcttgtagaagccgatccggtcggcgacgcggctatcggcgccatggccg 156
Query: 223 cactcgatcccaccgttgatgatgttggtgatcacgccgtaccctggcgcgccccggccg 282
||||||| || ||||||||||||||||||| ||||| ||||| ||| || ||||
Sbjct: 157 cactcgaggccgccgttgatgatgttggtgacgacgccataccccggcag---cctgccg 213
Query: 283 gccgccctgtccgcagccgtgggcgtccactgccccgtgatcacggcgtggcacgacggc 342
|| || |||| |||| || |||| |||||||||||||| ||||||||||||||||||
Sbjct: 214 gcggcggtgtcggcaggcgacggcgcccactgccccgtgacgacggcgtggcacgacggc 273
Query: 343 ttg 345
|||
Sbjct: 274 ttg 276
>gb|CW276618.1|CW276618 104_750_11405587_148_35398_074 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11405587, DNA
sequence
Length = 582
Score = 95.6 bits (48), Expect = 4e-018
Identities = 66/72 (91%)
Strand = Plus / Plus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
||||||||||||||| |||||||||||||||| ||||||||| |||||||||| ||||
Sbjct: 46 ccgtagttgtagttgtaggagatctggatgggcccgcggccgtagtacttcttcccggcg 105
Query: 520 gcgcacggccac 531
||||||||||||
Sbjct: 106 gcgcacggccac 117
>gb|CW388024.1|CW388024 fsbb001f072j20f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f072j20, DNA
sequence
Length = 694
Score = 95.6 bits (48), Expect = 4e-018
Identities = 66/72 (91%)
Strand = Plus / Minus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
||||||||||||||| |||||||||||||||| ||||||||| |||||||||| ||||
Sbjct: 590 ccgtagttgtagttgtaggagatctggatgggcccgcggccgtagtacttcttcccggcg 531
Query: 520 gcgcacggccac 531
||||||||||||
Sbjct: 530 gcgcacggccac 519
>gb|CW388025.1|CW388025 fsbb001f072j20k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f072j20, DNA
sequence
Length = 740
Score = 95.6 bits (48), Expect = 4e-018
Identities = 66/72 (91%)
Strand = Plus / Plus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
||||||||||||||| |||||||||||||||| ||||||||| |||||||||| ||||
Sbjct: 403 ccgtagttgtagttgtaggagatctggatgggcccgcggccgtagtacttcttcccggcg 462
Query: 520 gcgcacggccac 531
||||||||||||
Sbjct: 463 gcgcacggccac 474
Score = 89.7 bits (45), Expect = 3e-016
Identities = 149/183 (81%), Gaps = 3/183 (1%)
Strand = Plus / Plus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtcggtgacccgggggtccgtcccgtgcccg 222
||||||||||||||||||||||| |||||||||| ||| ||| || | || || |||
Sbjct: 106 tcgcagtagcgcttgtagaagccgatccggtcggcgacgcggctatcggcgccatggccg 165
Query: 223 cactcgatcccaccgttgatgatgttggtgatcacgccgtaccctggcgcgccccggccg 282
||||||| || ||||||||||||||||||| ||||| ||||| ||| || ||||
Sbjct: 166 cactcgaggccgccgttgatgatgttggtgacgacgccataccccggcag---cctgccg 222
Query: 283 gccgccctgtccgcagccgtgggcgtccactgccccgtgatcacggcgtggcacgacggc 342
|| || |||| |||| || |||| |||||||||||||| ||||||||||||||||||
Sbjct: 223 gcggcggtgtcggcaggcgacggcgcccactgccccgtgacgacggcgtggcacgacggc 282
Query: 343 ttg 345
|||
Sbjct: 283 ttg 285
>gb|BE367523.1|BE367523 PI1_8_E06.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 520
Score = 91.7 bits (46), Expect = 7e-017
Identities = 172/214 (80%)
Strand = Plus / Minus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttgttgtcccgcgcgttcatc 363
||||||||||| || || || ||||||||||||||||||||| | ||| |||||
Sbjct: 220 ggcgtccactggccggtcatgacggcgtggcacgacggcttgggcgactgcggcgtcatc 161
Query: 364 cagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccgggttg 423
|||||||||| ||| |||| ||| || | ||||||| ||| || ||||||||||||
Sbjct: 160 cagaaccacaccgccgtctcgaacgacacggtcgggtccgacgccaccaggtccgggttg 101
Query: 424 ttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaaggagatc 483
||||| | | |||||||||| |||| || | |||||||||||||||| ||||||||
Sbjct: 100 gcgaggatgccggcgccgatggcctgcccggcggcgccgtagttgtagttgtaggagatc 41
Query: 484 tggatggggccgcggccgaagtacttcttgccgg 517
|||||||| || |||||| |||||||||| ||||
Sbjct: 40 tggatgggtccacggccgtagtacttcttcccgg 7
Score = 56.0 bits (28), Expect = 4e-006
Identities = 31/32 (96%)
Strand = Plus / Minus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtc 194
||||||||||||||||||||||| ||||||||
Sbjct: 358 tcgcagtagcgcttgtagaagccgatccggtc 327
>gb|CW039394.1|CW039394 104_272_10505475_115_30390 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10505475, DNA
sequence
Length = 689
Score = 71.9 bits (36), Expect = 6e-011
Identities = 143/176 (81%), Gaps = 2/176 (1%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||| ||| ||||| |||||||| || | |||||||||| ||| || |||||
Sbjct: 351 tcatccagagccagagcgccgtcttgaatgaaaccacggggtcctgcgccaccttgtccg 410
Query: 419 ggttgttgaggaggtccacgccgatggctc-gccccgccgggccgtagttgtagttgaag 477
|||| | || ||||| ||||||||| ||| |||||||||| ||||||||| |||| |
Sbjct: 411 ggttctccagcaggtcgacgccgatg-ctctgccccgccggaccgtagttgaagttccac 469
Query: 478 gagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactg 533
|||||||| | |||||||| ||| |||||||||| || || || |||||||||||
Sbjct: 470 gagatctgcagcgggccgcgcccgtagtacttcttccccggggcacacggccactg 525
>gb|CW110423.1|CW110423 104_483_11103696_148_34524_094 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11103696, DNA
sequence
Length = 517
Score = 71.9 bits (36), Expect = 6e-011
Identities = 143/176 (81%), Gaps = 2/176 (1%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||| ||| ||||| |||||||| || | |||||||||| ||| || |||||
Sbjct: 132 tcatccagagccagagcgccgtcttgaatgaaaccacggggtcctgcgccaccttgtccg 191
Query: 419 ggttgttgaggaggtccacgccgatggctc-gccccgccgggccgtagttgtagttgaag 477
|||| | || ||||| ||||||||| ||| |||||||||| ||||||||| |||| |
Sbjct: 192 ggttctccagcaggtcgacgccgatg-ctctgccccgccggaccgtagttgaagttccac 250
Query: 478 gagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactg 533
|||||||| | |||||||| ||| |||||||||| || || || |||||||||||
Sbjct: 251 gagatctgcagcgggccgcgcccgtagtacttcttccccggggcacacggccactg 306
>gb|CW204755.1|CW204755 104_632_11186715_116_37060_002 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11186715, DNA
sequence
Length = 672
Score = 71.9 bits (36), Expect = 6e-011
Identities = 143/176 (81%), Gaps = 2/176 (1%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||| ||| ||||| |||||||| || | |||||||||| ||| || |||||
Sbjct: 50 tcatccagagccagagcgccgtcttgaatgaaaccacggggtcctgcgccaccttgtccg 109
Query: 419 ggttgttgaggaggtccacgccgatggctc-gccccgccgggccgtagttgtagttgaag 477
|||| | || ||||| ||||||||| ||| |||||||||| ||||||||| |||| |
Sbjct: 110 ggttctccagcaggtcgacgccgatg-ctctgccccgccggaccgtagttgaagttccac 168
Query: 478 gagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactg 533
|||||||| | |||||||| ||| |||||||||| || || || |||||||||||
Sbjct: 169 gagatctgcagcgggccgcgcccgtagtacttcttccccggggcacacggccactg 224
>gb|BE362915.2|BE362915 DG1_90_E12.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 528
Score = 71.9 bits (36), Expect = 6e-011
Identities = 143/176 (81%), Gaps = 2/176 (1%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||| ||| ||||| |||||||| || | |||||||||| ||| || |||||
Sbjct: 255 tcatccagagccagagcgccgtcttgaatgaaaccacggggtcctgcgccaccttgtccg 196
Query: 419 ggttgttgaggaggtccacgccgatggctc-gccccgccgggccgtagttgtagttgaag 477
|||| | || ||||| ||||||||| ||| |||||||||| ||||||||| |||| |
Sbjct: 195 ggttctccagcaggtcgacgccgatg-ctctgccccgccggaccgtagttgaagttccac 137
Query: 478 gagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactg 533
|||||||| | |||||||| ||| |||||||||| || || || |||||||||||
Sbjct: 136 gagatctgcagcgggccgcgcccgtagtacttcttccccggggcacacggccactg 81
>gb|CW265113.1|CW265113 104_734_11231683_116_35257_076 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11231683, DNA
sequence
Length = 664
Score = 63.9 bits (32), Expect = 1e-008
Identities = 143/176 (81%), Gaps = 3/176 (1%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||| ||| ||||| |||||||| || | |||||||||| ||| || |||||
Sbjct: 478 tcatccagagccagagcgccgtcttgaatgaaaccacggggtcctgcgccaccttgtccg 537
Query: 419 ggttgttgaggaggtccacgccgatggctc-gccccgccgggccgtagttgtagttgaag 477
|||| | || ||||| ||||||||| ||| |||||||||| ||||||||| |||| | |
Sbjct: 538 ggttctccagcaggtcgacgccgatg-ctctgccccgccggaccgtagttgaagttcacg 596
Query: 478 gagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactg 533
||||||| | |||||||| ||| |||||||||| || || || |||||||||||
Sbjct: 597 -agatctgcagcgggccgcgcccgtagtacttcttccccggggcacacggccactg 651
>gb|CW265114.1|CW265114 104_734_11231683_148_35261_076 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11231683, DNA
sequence
Length = 700
Score = 63.9 bits (32), Expect = 1e-008
Identities = 143/176 (81%), Gaps = 3/176 (1%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccg 418
||||||||| ||| ||||| |||||||| || | |||||||||| ||| || | ||||
Sbjct: 686 tcatccagagccagagcgccgtcttgaatgaaaccacggggtcctgcgccacctg-tccg 628
Query: 419 ggttgttgaggaggtccacgccgatggctc-gccccgccgggccgtagttgtagttgaag 477
|||| | || ||||| ||||||||| ||| |||||||||| ||||||||| |||| |
Sbjct: 627 ggttctccagcaggtcgacgccgatg-ctctgccccgccggaccgtagttgaagttccac 569
Query: 478 gagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggccactg 533
|||||||| | |||||||| ||| |||||||||| || || || |||||||||||
Sbjct: 568 gagatctgcagcgggccgcgcccgtagtacttcttccccggggcacacggccactg 513
>gb|CF760116.1|CF760116 DSAF1_55_F11.b1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_55_F11_A011 5', mRNA sequence
Length = 527
Score = 63.9 bits (32), Expect = 1e-008
Identities = 146/184 (79%)
Strand = Plus / Minus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttgttgtcccgcgcgttcatc 363
||||||||||| || || || ||||||||||||||||||||| | ||| |||||
Sbjct: 184 ggcgtccactggccggtcatgacggcgtggcacgacggcttgggcgactgcggcgtcatc 125
Query: 364 cagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtccgggttg 423
|||||||||| ||| |||| ||| || | ||||||| ||| || ||||||||||||
Sbjct: 124 cagaaccacaccgccgtctcgaacgacacggtcgggtccgacgccaccaggtccgggttg 65
Query: 424 ttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaaggagatc 483
||||| | | |||||||||| |||| || | |||||||||||||||| ||||||||
Sbjct: 64 gcgaggatgccggcgccgatggcctgcccggcggcgccgtagttgtagttgtaggagatc 5
Query: 484 tgga 487
||||
Sbjct: 4 tgga 1
Score = 56.0 bits (28), Expect = 4e-006
Identities = 31/32 (96%)
Strand = Plus / Minus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtc 194
||||||||||||||||||||||| ||||||||
Sbjct: 322 tcgcagtagcgcttgtagaagccgatccggtc 291
>gb|CW266083.1|CW266083 104_735_11232237_148_35267_085 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11232237, DNA
sequence
Length = 662
Score = 61.9 bits (31), Expect = 6e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 220 ccgcactcgatcccaccgttgatgatgttggtgatcacgccgtaccc 266
|||||||| ||||| |||||||||||||||||| ||||||| |||||
Sbjct: 486 ccgcactccatcccgccgttgatgatgttggtggtcacgccataccc 440
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 325 acggcgtggcacgacggctt 344
||||||||||||||||||||
Sbjct: 384 acggcgtggcacgacggctt 365
>gb|CW454488.1|CW454488 fsbb001f198p08f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f198p08, DNA
sequence
Length = 772
Score = 61.9 bits (31), Expect = 6e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 220 ccgcactcgatcccaccgttgatgatgttggtgatcacgccgtaccc 266
|||||||| ||||| |||||||||||||||||| ||||||| |||||
Sbjct: 67 ccgcactccatcccgccgttgatgatgttggtggtcacgccataccc 21
>gb|BE358858.1|BE358858 DG1_32_F07.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 655
Score = 61.9 bits (31), Expect = 6e-008
Identities = 43/47 (91%)
Strand = Plus / Minus
Query: 220 ccgcactcgatcccaccgttgatgatgttggtgatcacgccgtaccc 266
|||||||| ||||| |||||||||||||||||| ||||||| |||||
Sbjct: 322 ccgcactccatcccgccgttgatgatgttggtggtcacgccataccc 276
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 325 acggcgtggcacgacggctt 344
||||||||||||||||||||
Sbjct: 220 acggcgtggcacgacggctt 201
>gb|CW117036.1|CW117036 104_493_11107443_148_34610_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11107443, DNA
sequence
Length = 329
Score = 60.0 bits (30), Expect = 2e-007
Identities = 138/174 (79%)
Strand = Plus / Plus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtc 416
||||||||||||||| ||||| |||||||| | |||||||||||| ||| || | |||
Sbjct: 85 gttcatccagaaccagagcgccgtcttgaacgcgatcacggggtcctgcgccaccatgtc 144
Query: 417 cgggttgttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaa 476
|||||| ||| ||| | |||||| | | ||| || || |||||||||||||| |
Sbjct: 145 cgggttcccgagcccgtcgaagccgatctccctcccggcaggaccgtagttgtagttcca 204
Query: 477 ggagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggcca 530
|||||||| | |||||||| ||| |||||||||| || || |||||||||||
Sbjct: 205 cgagatctgcagcgggccgcgcccgtagtacttcttccccggggcgcacggcca 258
>gb|CW275250.1|CW275250 104_748_11404861_148_35382_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11404861, DNA
sequence
Length = 627
Score = 60.0 bits (30), Expect = 2e-007
Identities = 138/174 (79%)
Strand = Plus / Plus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtc 416
||||||||||||||| ||||| |||||||| | |||||||||||| ||| || | |||
Sbjct: 196 gttcatccagaaccagagcgccgtcttgaacgcgatcacggggtcctgcgccaccatgtc 255
Query: 417 cgggttgttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaa 476
|||||| ||| ||| | |||||| | | ||| || || |||||||||||||| |
Sbjct: 256 cgggttcccgagcccgtcgaagccgatctccctcccggcaggaccgtagttgtagttcca 315
Query: 477 ggagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggcca 530
|||||||| | |||||||| ||| |||||||||| || || |||||||||||
Sbjct: 316 cgagatctgcagcgggccgcgcccgtagtacttcttccccggggcgcacggcca 369
>gb|CW448428.1|CW448428 fsbb001f182a11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f182a11, DNA
sequence
Length = 633
Score = 60.0 bits (30), Expect = 2e-007
Identities = 138/174 (79%)
Strand = Plus / Plus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtc 416
||||||||||||||| ||||| |||||||| | |||||||||||| ||| || | |||
Sbjct: 407 gttcatccagaaccagagcgccgtcttgaacgcgatcacggggtcctgcgccaccatgtc 466
Query: 417 cgggttgttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaa 476
|||||| ||| ||| | |||||| | | ||| || || |||||||||||||| |
Sbjct: 467 cgggttcccgagcccgtcgaagccgatctccctcccggcaggaccgtagttgtagttcca 526
Query: 477 ggagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggcca 530
|||||||| | |||||||| ||| |||||||||| || || |||||||||||
Sbjct: 527 cgagatctgcagcgggccgcgcccgtagtacttcttccccggggcgcacggcca 580
>gb|CW470070.1|CW470070 fsbb001f223b16f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f223b16, DNA
sequence
Length = 452
Score = 60.0 bits (30), Expect = 2e-007
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttg 345
||||||||||||||||| || ||| |||||||||||||||||
Sbjct: 298 ggcgtccactgccccgtcatgacgtcgtggcacgacggcttg 339
Score = 56.0 bits (28), Expect = 4e-006
Identities = 85/104 (81%)
Strand = Plus / Plus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtcggtgacccgggggtccgtcccgtgcccg 222
|||||||||||||||||||| || |||| ||| | ||| |||| || | || || |||
Sbjct: 160 tcgcagtagcgcttgtagaacccgatcctgtccgcgacgcgggtatcggcgccatggccg 219
Query: 223 cactcgatcccaccgttgatgatgttggtgatcacgccgtaccc 266
||||||| || ||||||||||||||||||| ||||| |||||
Sbjct: 220 cactcgaggccgccgttgatgatgttggtgacgacgccataccc 263
>gb|CW489486.1|CW489486 fsbb001f274h04f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f274h04, DNA
sequence
Length = 597
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtcc 402
||||||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 240 gttcatccagaaccagagcgccgtcttgaatgaaatcacggggtcc 195
Score = 54.0 bits (27), Expect = 1e-005
Identities = 63/75 (84%)
Strand = Plus / Minus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
|||||||||||||| | |||||||| | |||||||| ||| |||||||||| || ||
Sbjct: 137 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttcttccccggg 78
Query: 520 gcgcacggccactgc 534
||||| |||||||||
Sbjct: 77 gcgcatggccactgc 63
>gb|CW493211.1|CW493211 fsbb001f283n22k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f283n22, DNA
sequence
Length = 617
Score = 60.0 bits (30), Expect = 2e-007
Identities = 138/174 (79%)
Strand = Plus / Plus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtccgtcgcgacgaggtc 416
||||||||||||||| ||||| |||||||| | |||||||||||| ||| || | |||
Sbjct: 6 gttcatccagaaccagagcgccgtcttgaacgcgatcacggggtcctgcgccaccatgtc 65
Query: 417 cgggttgttgaggaggtccacgccgatggctcgccccgccgggccgtagttgtagttgaa 476
|||||| ||| ||| | |||||| | | ||| || || |||||||||||||| |
Sbjct: 66 cgggttcccgagcccgtcgaagccgatctccctcccggcaggaccgtagttgtagttcca 125
Query: 477 ggagatctggatggggccgcggccgaagtacttcttgccgggcgcgcacggcca 530
|||||||| | |||||||| ||| |||||||||| || || |||||||||||
Sbjct: 126 cgagatctgcagcgggccgcgcccgtagtacttcttccccggggcgcacggcca 179
>gb|BE357811.1|BE357811 DG1_22_D10.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 624
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtcc 402
||||||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 220 gttcatccagaaccagagcgccgtcttgaatgaaatcacggggtcc 175
Score = 54.0 bits (27), Expect = 1e-005
Identities = 63/75 (84%)
Strand = Plus / Minus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
|||||||||||||| | |||||||| | |||||||| ||| |||||||||| || ||
Sbjct: 117 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttcttccccggg 58
Query: 520 gcgcacggccactgc 534
||||| |||||||||
Sbjct: 57 gcgcatggccactgc 43
>gb|BG049053.1|BG049053 OV1_22_F09.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 528
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtcc 402
||||||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 175 gttcatccagaaccagagcgccgtcttgaatgaaatcacggggtcc 130
Score = 48.1 bits (24), Expect = 9e-004
Identities = 60/72 (83%)
Strand = Plus / Minus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
|||||||||||||| | |||||||| | |||||||| ||| |||||||||| || ||
Sbjct: 72 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttcttccccggg 13
Query: 520 gcgcacggccac 531
||||| ||||||
Sbjct: 12 gcgcatggccac 1
>gb|BG049497.1|BG049497 OV1_20_G04.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 561
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtcc 402
||||||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 237 gttcatccagaaccagagcgccgtcttgaatgaaatcacggggtcc 192
Score = 54.0 bits (27), Expect = 1e-005
Identities = 63/75 (84%)
Strand = Plus / Minus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
|||||||||||||| | |||||||| | |||||||| ||| |||||||||| || ||
Sbjct: 134 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttcttccccggg 75
Query: 520 gcgcacggccactgc 534
||||| |||||||||
Sbjct: 74 gcgcatggccactgc 60
>gb|BG102665.1|BG102665 RHIZ2_35_G08.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 382
Score = 60.0 bits (30), Expect = 2e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtcc 402
||||||||||||||| ||||| |||||||| || ||||||||||||
Sbjct: 273 gttcatccagaaccagagcgccgtcttgaatgaaatcacggggtcc 228
Score = 54.0 bits (27), Expect = 1e-005
Identities = 63/75 (84%)
Strand = Plus / Minus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
|||||||||||||| | |||||||| | |||||||| ||| |||||||||| || ||
Sbjct: 170 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttcttccccggg 111
Query: 520 gcgcacggccactgc 534
||||| |||||||||
Sbjct: 110 gcgcatggccactgc 96
>gb|CW159280.1|CW159280 104_565_11149276_148_36409_010 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11149276, DNA
sequence
Length = 673
Score = 58.0 bits (29), Expect = 9e-007
Identities = 71/85 (83%)
Strand = Plus / Minus
Query: 449 gccccgccgggccgtagttgtagttgaaggagatctggatggggccgcggccgaagtact 508
|||||||||| ||||||||| |||| | |||||||| | |||||||| ||| ||||||
Sbjct: 628 gccccgccggaccgtagttgaagttccacgagatctgcagcgggccgcgcccgtagtact 569
Query: 509 tcttgccgggcgcgcacggccactg 533
|||| || || || |||||||||||
Sbjct: 568 tcttccccggggcacacggccactg 544
>gb|AW746206.1|AW746206 WS1_40_B10.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 541
Score = 58.0 bits (29), Expect = 9e-007
Identities = 71/85 (83%)
Strand = Plus / Minus
Query: 449 gccccgccgggccgtagttgtagttgaaggagatctggatggggccgcggccgaagtact 508
|||||||||| ||||||||| |||| | |||||||| | |||||||| ||| ||||||
Sbjct: 509 gccccgccggaccgtagttgaagttccacgagatctgcagcgggccgcgcccgtagtact 450
Query: 509 tcttgccgggcgcgcacggccactg 533
|||| || || || |||||||||||
Sbjct: 449 tcttccccggggcacacggccactg 425
>gb|CW307371.1|CW307371 104_795_11468105_116_35728_073 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11468105, DNA
sequence
Length = 642
Score = 56.0 bits (28), Expect = 4e-006
Identities = 85/104 (81%)
Strand = Plus / Plus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtcggtgacccgggggtccgtcccgtgcccg 222
|||||||||||||||||||| || |||| ||| | ||| |||| || | || || |||
Sbjct: 466 tcgcagtagcgcttgtagaacccgatcctgtccgcgacgcgggtatcggcgccatggccg 525
Query: 223 cactcgatcccaccgttgatgatgttggtgatcacgccgtaccc 266
||||||| || ||||||||||||||||||| ||||| |||||
Sbjct: 526 cactcgaggccgccgttgatgatgttggtgacgacgccataccc 569
Score = 54.0 bits (27), Expect = 1e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggc 342
||||||||||||||||| || ||| ||||||||||||||
Sbjct: 604 ggcgtccactgccccgtcatgacgtcgtggcacgacggc 642
>gb|CW231901.1|CW231901 104_681_11211372_148_37350_042 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11211372, DNA
sequence
Length = 510
Score = 54.0 bits (27), Expect = 1e-005
Identities = 63/75 (84%)
Strand = Plus / Plus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
|||||||||||||| | |||||||| | |||||||| ||| |||||||||| || ||
Sbjct: 73 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttcttccccggg 132
Query: 520 gcgcacggccactgc 534
||||| |||||||||
Sbjct: 133 gcgcatggccactgc 147
>gb|CW285685.1|CW285685 104_763_11410466_148_35506_013 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11410466, DNA
sequence
Length = 285
Score = 54.0 bits (27), Expect = 1e-005
Identities = 63/75 (84%)
Strand = Plus / Plus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
|||||||||||||| | |||||||| | |||||||| ||| |||||||||| || ||
Sbjct: 74 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttcttccccggg 133
Query: 520 gcgcacggccactgc 534
||||| |||||||||
Sbjct: 134 gcgcatggccactgc 148
>gb|BE357733.1|BE357733 DG1_22_D10.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 593
Score = 54.0 bits (27), Expect = 1e-005
Identities = 63/75 (84%)
Strand = Plus / Minus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
|||||||||||||| | |||||||| | |||||||| ||| |||||||||| || ||
Sbjct: 589 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttcttccccggg 530
Query: 520 gcgcacggccactgc 534
||||| |||||||||
Sbjct: 529 gcgcatggccactgc 515
>gb|BG464063.1|BG464063 EM1_69_B11.b1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 586
Score = 54.0 bits (27), Expect = 1e-005
Identities = 60/71 (84%)
Strand = Plus / Minus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttcttgccgggc 519
|||||||||||||| | |||||||| | |||||||| ||| |||||||||| || ||
Sbjct: 580 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttcttccccggg 521
Query: 520 gcgcacggcca 530
|||||||||||
Sbjct: 520 gcgcacggcca 510
>gb|CW066077.1|CW066077 104_313_10523499_114_30148 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10523499, DNA
sequence
Length = 537
Score = 52.0 bits (26), Expect = 6e-005
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtcc 402
||||||||||||||| ||||| |||||||| | ||||||||||||
Sbjct: 343 gttcatccagaaccagagcgccgtcttgaacgcgatcacggggtcc 388
>gb|CW069060.1|CW069060 104_318_10525580_1_30095 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10525580, DNA
sequence
Length = 429
Score = 50.1 bits (25), Expect = 2e-004
Identities = 70/85 (82%)
Strand = Plus / Minus
Query: 449 gccccgccgggccgtagttgtagttgaaggagatctggatggggccgcggccgaagtact 508
|||||||||| ||||||||| |||| | |||||||| | |||||||| ||| ||||||
Sbjct: 398 gccccgccggaccgtagttgaagttccacgagatctgcagcgggccgcgcccgtagtact 339
Query: 509 tcttgccgggcgcgcacggccactg 533
| || || || || |||||||||||
Sbjct: 338 ttttccccggggcacacggccactg 314
>gb|CD429983.1|CD429983 ETH1_16_A10.g1_A002 Ethylene-treated seedlings Sorghum bicolor cDNA
clone ETH1_16_A10_A002 5', mRNA sequence
Length = 693
Score = 50.1 bits (25), Expect = 2e-004
Identities = 34/37 (91%)
Strand = Plus / Minus
Query: 230 tcccaccgttgatgatgttggtgatcacgccgtaccc 266
|||| |||||||||||||||||| ||||||| |||||
Sbjct: 693 tcccgccgttgatgatgttggtggtcacgccataccc 657
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 325 acggcgtggcacgacggctt 344
||||||||||||||||||||
Sbjct: 601 acggcgtggcacgacggctt 582
>gb|CW263590.1|CW263590 104_731_11230799_148_35217_082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11230799, DNA
sequence
Length = 583
Score = 48.1 bits (24), Expect = 9e-004
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 359 tcatccagaaccacagcgctgtcttgaa 386
||||||||||||||||||| ||||||||
Sbjct: 348 tcatccagaaccacagcgccgtcttgaa 375
>gb|BE366378.1|BE366378 PI1_32_H10.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 454
Score = 48.1 bits (24), Expect = 9e-004
Identities = 84/104 (80%)
Strand = Plus / Minus
Query: 397 gggtccgtcgcgacgaggtccgggttgttgaggaggtccacgccgatggctcgccccgcc 456
||||||| ||| || |||||||||||| ||||| | | |||| ||||| |||| ||
Sbjct: 104 gggtccgacgccaccaggtccgggttggcgaggatgccggcgcctatggcctgcccggcg 45
Query: 457 gggccgtagttgtagttgaaggagatctggatggggccgcggcc 500
| |||||| ||||||||| | |||||||||||||| || |||||
Sbjct: 44 gcgccgtatttgtagttgtaagagatctggatgggtccacggcc 1
Score = 44.1 bits (22), Expect = 0.014
Identities = 37/42 (88%)
Strand = Plus / Minus
Query: 304 ggcgtccactgccccgtgatcacggcgtggcacgacggcttg 345
||||| ||||| || || || |||||||||||||||||||||
Sbjct: 197 ggcgtacactggccggtcatgacggcgtggcacgacggcttg 156
Score = 40.1 bits (20), Expect = 0.22
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 163 tcgcagtagcgcttgtagaagccaatccggtc 194
||||||||||||||||| || || ||||||||
Sbjct: 335 tcgcagtagcgcttgtaaaacccgatccggtc 304
>gb|CN129927.1|CN129927 RHOH1_38_F07.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_38_F07_A002 3', mRNA sequence
Length = 809
Score = 48.1 bits (24), Expect = 9e-004
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaa 386
||||||||||||||||||| ||||||||
Sbjct: 454 tcatccagaaccacagcgccgtcttgaa 427
>gb|CN130014.1|CN130014 RHOH1_38_F07.g1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_38_F07_A002 5', mRNA sequence
Length = 723
Score = 48.1 bits (24), Expect = 9e-004
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 359 tcatccagaaccacagcgctgtcttgaa 386
||||||||||||||||||| ||||||||
Sbjct: 645 tcatccagaaccacagcgccgtcttgaa 618
>gb|BG464391.1|BG464391 EM1_69_B11.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 308
Score = 44.1 bits (22), Expect = 0.014
Identities = 40/46 (86%)
Strand = Plus / Minus
Query: 357 gttcatccagaaccacagcgctgtcttgaaggatatcacggggtcc 402
||||||||| ||||| ||||| |||||||| | ||||||||||||
Sbjct: 168 gttcatccacaaccagagcgccgtcttgaacgcgatcacggggtcc 123
Score = 42.1 bits (21), Expect = 0.055
Identities = 45/53 (84%)
Strand = Plus / Minus
Query: 460 ccgtagttgtagttgaaggagatctggatggggccgcggccgaagtacttctt 512
|||||||||||||| | |||||||| | |||||||| ||| ||||||||||
Sbjct: 65 ccgtagttgtagttccacgagatctgcagcgggccgcgcccgtagtacttctt 13
>gb|CW056944.1|CW056944 104_298_10517953_114_30151 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10517953, DNA
sequence
Length = 652
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 449 gccccgccgggccgtagttgtagtt 473
|||||||||| ||||||||||||||
Sbjct: 331 gccccgccggcccgtagttgtagtt 355
>gb|CW324492.1|CW324492 104_819_11477191_148_35910_030 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11477191, DNA
sequence
Length = 720
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 449 gccccgccgggccgtagttgtagtt 473
|||||||||| ||||||||||||||
Sbjct: 207 gccccgccggcccgtagttgtagtt 183
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 145,282
Number of Sequences: 832831
Number of extensions: 145282
Number of successful extensions: 37761
Number of sequences better than 0.5: 86
Number of HSP's better than 0.5 without gapping: 67
Number of HSP's successfully gapped in prelim test: 19
Number of HSP's that attempted gapping in prelim test: 37532
Number of HSP's gapped (non-prelim): 235
length of query: 570
length of database: 491,359,669
effective HSP length: 19
effective length of query: 551
effective length of database: 475,535,880
effective search space: 262020269880
effective search space used: 262020269880
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)