BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3064721.2.1
(689 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF507175.1|BF507175 2604P-22 Pooled green leaf and root ... 133 2e-029
gb|BF507006.1|BF507006 15782P-16 Pooled green leaf and root... 117 1e-024
gb|CW354779.1|CW354779 fsbb001f019c05k0 Sorghum methylation... 78 1e-012
gb|CL193723.1|CL193723 104_417_10941134_116_32279_053 Sorgh... 52 7e-005
>gb|BF507175.1|BF507175 2604P-22 Pooled green leaf and root tissue Sorghum bicolor cDNA
clone 2604P-22, mRNA sequence
Length = 142
Score = 133 bits (67), Expect = 2e-029
Identities = 123/141 (87%), Gaps = 4/141 (2%)
Strand = Plus / Minus
Query: 497 ctttcctgatgtaaagatgccagcaggttggtggtagtattagatcatacaaacagttag 556
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||
Sbjct: 142 ctttcctgatgtaaaggtgccagcaggttggtggtaggcttagatcatacaaacagttag 83
Query: 557 gaaccaaggcatacttcannnnnnngtgcttataaatgctaatatggtagataatttttg 616
| ||||||| || |||| |||||||||||||||||||| ||||||||||||||
Sbjct: 82 tagccaaggcgtatttca---ttttgtgcttataaatgctaatatagtagataatttttg 26
Query: 617 actctaatgaattgaatgcta 637
||| | |||||| ||||||||
Sbjct: 25 actgt-atgaatcgaatgcta 6
>gb|BF507006.1|BF507006 15782P-16 Pooled green leaf and root tissue Sorghum bicolor cDNA
clone 15782P-16, mRNA sequence
Length = 138
Score = 117 bits (59), Expect = 1e-024
Identities = 74/79 (93%)
Strand = Plus / Minus
Query: 318 ggtcagcacacgtcaattacgaccaagtgtttctacaagagtgcaatataaacccgtgaa 377
|||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||
Sbjct: 138 ggtcagcatacgtcaattacgatcaagtgtttctacgggagtgcaatataaacccgtgaa 79
Query: 378 cagcaaatagtggtgtatg 396
|||||||||||||| ||||
Sbjct: 78 cagcaaatagtggtctatg 60
>gb|CW354779.1|CW354779 fsbb001f019c05k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f019c05, DNA
sequence
Length = 265
Score = 77.8 bits (39), Expect = 1e-012
Identities = 69/79 (87%)
Strand = Plus / Minus
Query: 4 tgcttgtggttgggcatatggcatgaacatgtttgatttgtctgggtggagaaagcaaaa 63
||||||||| ||||| ||||||||||||||||| |||||||||| |||||| ||||| ||
Sbjct: 176 tgcttgtggctgggcgtatggcatgaacatgttcgatttgtctgagtggaggaagcagaa 117
Query: 64 catcaccgaggtctaccat 82
|| || || |||||||||
Sbjct: 116 tattactgatgtctaccat 98
>gb|CL193723.1|CL193723 104_417_10941134_116_32279_053 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10941134, DNA
sequence
Length = 686
Score = 52.0 bits (26), Expect = 7e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgat 40
|||| ||||||||||| ||||| |||||||||||||||
Sbjct: 108 atgcatgtggttgggcttatggaatgaacatgtttgat 145
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 145,500
Number of Sequences: 832831
Number of extensions: 145500
Number of successful extensions: 38051
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38045
Number of HSP's gapped (non-prelim): 6
length of query: 689
length of database: 491,359,669
effective HSP length: 19
effective length of query: 670
effective length of database: 475,535,880
effective search space: 318609039600
effective search space used: 318609039600
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)