BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2591032.2.1
(735 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW353450.1|CW353450 fsbb001f016d09f0 Sorghum methylation... 131 1e-028
gb|AW565318.1|AW565318 LG1_342_A06.g1_A002 Light Grown 1 (L... 121 1e-025
gb|BE597334.1|BE597334 PI1_72_B09.g1_A002 Pathogen induced ... 121 1e-025
gb|BF705043.1|BF705043 RHIZ2_1_F10.g1_A003 Rhizome2 (RHIZ2)... 109 4e-022
gb|BE594970.1|BE594970 PI1_48_B08.g1_A002 Pathogen induced ... 107 1e-021
gb|BF480784.1|BF480784 FM1_14_H09.g1_A003 Floral-Induced Me... 107 1e-021
gb|BG053517.1|BG053517 RHIZ2_10_B08.g1_A003 Rhizome2 (RHIZ2... 107 1e-021
gb|CF074385.1|CF074385 FE1_24_H07.b1_A002 Iron-deficient se... 107 1e-021
gb|CW223651.1|CW223651 104_659_11203029_148_37186_085 Sorgh... 103 2e-020
gb|CW280288.1|CW280288 104_755_11407540_148_35446_008 Sorgh... 101 9e-020
gb|CW363768.1|CW363768 fsbb001f035i09k0 Sorghum methylation... 101 9e-020
gb|BG465823.1|BG465823 RHIZ2_45_A06.g1_A003 Rhizome2 (RHIZ2... 101 9e-020
gb|CX606300.1|CX606300 ANR1_2_F08.b1_A002 Anaerobic roots S... 98 1e-018
gb|CW183962.1|CW183962 104_600_11164896_148_36687_096 Sorgh... 94 2e-017
gb|AW679681.1|AW679681 WS1_30_E12.g1_A002 Water-stressed 1 ... 94 2e-017
gb|AW923900.1|AW923900 WS1_30_E12.b1_A002 Water-stressed 1 ... 94 2e-017
gb|BG357481.1|BG357481 OV2_30_D12.g1_A002 Ovary 2 (OV2) Sor... 94 2e-017
gb|CD423436.1|CD423436 SA1_23_C04.b1_A002 Salicylic acid-tr... 94 2e-017
gb|CF485574.1|CF485574 POL1_32_G12.b1_A002 Pollen Sorghum b... 94 2e-017
gb|CN126293.1|CN126293 RHOH1_16_G04.b1_A002 Acid- and alkal... 94 2e-017
gb|CN126382.1|CN126382 RHOH1_16_G04.g1_A002 Acid- and alkal... 94 2e-017
gb|CN134750.1|CN134750 OX1_28_E12.b1_A002 Oxidatively-stres... 94 2e-017
gb|CW365890.1|CW365890 fsbb001f038k04f0 Sorghum methylation... 92 9e-017
gb|CW365891.1|CW365891 fsbb001f038k04k0 Sorghum methylation... 92 9e-017
gb|CF489387.1|CF489387 POL1_57_F11.b1_A002 Pollen Sorghum b... 92 9e-017
gb|CW111205.1|CW111205 104_484_11104174_148_34528_089 Sorgh... 86 5e-015
gb|CW310536.1|CW310536 104_799_11469765_116_37434_083 Sorgh... 86 5e-015
gb|CW430454.1|CW430454 fsbb001f144c20f0 Sorghum methylation... 84 2e-014
gb|CD209113.1|CD209113 HS1_46_A12.b1_A012 Heat-shocked seed... 84 2e-014
gb|CD427064.1|CD427064 SA1_17_G05.b1_A002 Salicylic acid-tr... 84 2e-014
gb|CW034726.1|CW034726 104_265_10502729_114_30378 Sorghum m... 80 3e-013
gb|CW311717.1|CW311717 104_801_11470377_116_36277_041 Sorgh... 80 3e-013
gb|CW311718.1|CW311718 104_801_11470377_148_36278_041 Sorgh... 80 3e-013
gb|BG052508.1|BG052508 RHIZ2_26_A04.g1_A003 Rhizome2 (RHIZ2... 76 5e-012
gb|BG103243.1|BG103243 RHIZ2_19_H12.g1_A003 Rhizome2 (RHIZ2... 76 5e-012
gb|CW308233.1|CW308233 104_796_11468560_116_35731_054 Sorgh... 66 5e-009
gb|CW308234.1|CW308234 104_796_11468560_148_35739_054 Sorgh... 66 5e-009
gb|CW073807.1|CW073807 104_340_10781623_116_31470_103 Sorgh... 64 2e-008
gb|CF489555.1|CF489555 POL1_58_F10.b1_A002 Pollen Sorghum b... 64 2e-008
gb|CW023418.1|CW023418 104_163_10432439_1_30001 Sorghum met... 60 3e-007
gb|CW368244.1|CW368244 fsbb001f042b22k0 Sorghum methylation... 60 3e-007
gb|CW492772.1|CW492772 fsbb001f283d16k0 Sorghum methylation... 60 3e-007
gb|CN132772.1|CN132772 OX1_8_D03.b1_A002 Oxidatively-stress... 60 3e-007
gb|CW492771.1|CW492771 fsbb001f283d16f0 Sorghum methylation... 52 7e-005
gb|CW105163.1|CW105163 104_474_11012772_116_34453_042 Sorgh... 50 3e-004
gb|CW403691.1|CW403691 fsbb001f095i13k0 Sorghum methylation... 50 3e-004
gb|BF422042.1|BF422042 FM1_12_C02.g1_A003 Floral-Induced Me... 50 3e-004
gb|CN147606.1|CN147606 WOUND1_50_F12.g1_A002 Wounded leaves... 50 3e-004
gb|CN149831.1|CN149831 WOUND1_65_D05.b1_A002 Wounded leaves... 50 3e-004
gb|CW403690.1|CW403690 fsbb001f095i13f0 Sorghum methylation... 46 0.005
gb|BZ349593.1|BZ349593 hr42g02.g1 WGS-SbicolorF (JM107 adap... 44 0.018
gb|CW026293.1|CW026293 104_252_10497863_116_30520 Sorghum m... 44 0.018
gb|CW194353.1|CW194353 104_617_11180051_148_36791_040 Sorgh... 44 0.018
gb|CW223650.1|CW223650 104_659_11203029_116_37185_085 Sorgh... 44 0.018
gb|CW318102.1|CW318102 104_810_11473771_116_35873_078 Sorgh... 44 0.018
gb|CW423106.1|CW423106 fsbb001f132m06f0 Sorghum methylation... 44 0.018
gb|AZ922789.1|AZ922789 SLCot4E02 Sorghum bicolor SLCot Sorg... 42 0.071
gb|CW023183.1|CW023183 104_162_10432303_1_30008 Sorghum met... 42 0.071
gb|CW038426.1|CW038426 104_270_10504920_115_30386 Sorghum m... 42 0.071
gb|CW088288.1|CW088288 104_433_10948097_114_32572_075 Sorgh... 42 0.071
gb|CW088290.1|CW088290 104_433_10948097_250_32620_075 Sorgh... 42 0.071
gb|CW310537.1|CW310537 104_799_11469765_148_37433_083 Sorgh... 42 0.071
gb|CW378681.1|CW378681 fsbb001f057i24f0 Sorghum methylation... 42 0.071
gb|CF486256.1|CF486256 POL1_36_E02.g1_A002 Pollen Sorghum b... 42 0.071
gb|CN147521.1|CN147521 WOUND1_50_F12.b1_A002 Wounded leaves... 42 0.071
gb|CW270918.1|CW270918 104_742_11402708_148_35335_066 Sorgh... 40 0.28
gb|BE362057.1|BE362057 DG1_84_G12.b1_A002 Dark Grown 1 (DG1... 40 0.28
>gb|CW353450.1|CW353450 fsbb001f016d09f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f016d09, DNA
sequence
Length = 730
Score = 131 bits (66), Expect = 1e-028
Identities = 300/378 (79%)
Strand = Plus / Minus
Query: 327 ctcgatctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaatt 386
||||| ||| ||||||||||||| || || |||||||||||||||||||| ||||| ||
Sbjct: 668 ctcgagctcaacaggctttggtatgtctggagggcttgcgcaccttatgagagcccagtt 609
Query: 387 cacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtaggccagccg 446
||| ||||||||||| ||||| ||||| ||||| || || ||||||||||| | || ||
Sbjct: 608 cacaccctcaaagaaaggatgttgctttatctcggtagcaccacgcttgtacccaagtcg 549
Query: 447 ttgctggggctccttcacaagcagacccctgatcagatccctcgccgagaagctgacggc 506
||||| || ||||| || |||| ||||| |||| |||||||| |||||||| ||
Sbjct: 548 gtgctgcgggtccttgactagcaatccccttatcatgtccctcgcagagaagctcacaat 489
Query: 507 cgggtactccgggaagcgcagctgctggccaatgacattgaacagcgtggcccggttgct 566
||| |||| ||||| | || ||||||| | || ||||| || || ||||||||||
Sbjct: 488 tggggactctgggaacctcaagggctggcccacaacgttgaagagtgtagcccggttgcc 429
Query: 567 ggatcccttgaaaggcgtcttcccgaacagcagctcgtacaagaataccccgaaggtcca 626
|| || ||||| || ||||| || |||| || |||||||||||||| || ||||||||
Sbjct: 428 tgaacctttgaacggggtcttgccaaacaacaactcgtacaagaatatgccaaaggtcca 369
Query: 627 ccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggccaggtactcgtg 686
||| || || || || ||||||||||| ||||| || || || ||||||| |||||| ||
Sbjct: 368 ccaatccacagcacttccatggccctccccttttattatttctggggccaagtactcatg 309
Query: 687 cgtcccaacgaacgacat 704
|| ||||| || |||||
Sbjct: 308 ggtgccaacaaaggacat 291
>gb|AW565318.1|AW565318 LG1_342_A06.g1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 698
Score = 121 bits (61), Expect = 1e-025
Identities = 265/333 (79%)
Strand = Plus / Minus
Query: 327 ctcgatctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaatt 386
||||| ||| ||||||||||||| || || |||||||||||||||||||| ||||| ||
Sbjct: 338 ctcgagctcaacaggctttggtatgtctggagggcttgcgcaccttatgagagcccagtt 279
Query: 387 cacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtaggccagccg 446
||| ||||||||||| ||||| ||||| ||||| || || ||||||||||| | || ||
Sbjct: 278 cacaccctcaaagaaaggatgttgctttatctcggtagcaccacgcttgtacccaagtcg 219
Query: 447 ttgctggggctccttcacaagcagacccctgatcagatccctcgccgagaagctgacggc 506
||||| || ||||| || |||| ||||| |||| |||||||| |||||||| ||
Sbjct: 218 gtgctgcgggtccttgactagcaatccccttatcatgtccctcgcagagaagctcacaat 159
Query: 507 cgggtactccgggaagcgcagctgctggccaatgacattgaacagcgtggcccggttgct 566
||| |||| ||||| | || ||||||| | || ||||| || || ||||||||||
Sbjct: 158 tggggactctgggaacctcaagggctggcccacaacgttgaagagtgtagcccggttgcc 99
Query: 567 ggatcccttgaaaggcgtcttcccgaacagcagctcgtacaagaataccccgaaggtcca 626
|| || ||||| || ||||| || |||| || |||||||||||||| || ||||||||
Sbjct: 98 tgaacctttgaacggggtcttgccaaacaacaactcgtacaagaatatgccaaaggtcca 39
Query: 627 ccagtcgacggcgctgccatggccctcgccttt 659
||| || || || || ||||||||||| |||||
Sbjct: 38 ccaatccacagcacttccatggccctccccttt 6
>gb|BE597334.1|BE597334 PI1_72_B09.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 614
Score = 121 bits (61), Expect = 1e-025
Identities = 265/333 (79%)
Strand = Plus / Minus
Query: 327 ctcgatctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaatt 386
||||| ||| ||||||||||||| || || |||||||||||||||||||| ||||| ||
Sbjct: 339 ctcgagctcaacaggctttggtatgtctggagggcttgcgcaccttatgagagcccagtt 280
Query: 387 cacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtaggccagccg 446
||| ||||||||||| ||||| ||||| ||||| || || ||||||||||| | || ||
Sbjct: 279 cacaccctcaaagaaaggatgttgctttatctcggtagcaccacgcttgtacccaagtcg 220
Query: 447 ttgctggggctccttcacaagcagacccctgatcagatccctcgccgagaagctgacggc 506
||||| || ||||| || |||| ||||| |||| |||||||| |||||||| ||
Sbjct: 219 gtgctgcgggtccttgactagcaatccccttatcatgtccctcgcagagaagctcacaat 160
Query: 507 cgggtactccgggaagcgcagctgctggccaatgacattgaacagcgtggcccggttgct 566
||| |||| ||||| | || ||||||| | || ||||| || || ||||||||||
Sbjct: 159 tggggactctgggaacctcaagggctggcccacaacgttgaagagtgtagcccggttgcc 100
Query: 567 ggatcccttgaaaggcgtcttcccgaacagcagctcgtacaagaataccccgaaggtcca 626
|| || ||||| || ||||| || |||| || |||||||||||||| || ||||||||
Sbjct: 99 tgaacctttgaacggggtcttgccaaacaacaactcgtacaagaatatgccaaaggtcca 40
Query: 627 ccagtcgacggcgctgccatggccctcgccttt 659
||| || || || || ||||||||||| |||||
Sbjct: 39 ccaatccacagcacttccatggccctccccttt 7
>gb|BF705043.1|BF705043 RHIZ2_1_F10.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 639
Score = 109 bits (55), Expect = 4e-022
Identities = 241/303 (79%)
Strand = Plus / Minus
Query: 327 ctcgatctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaatt 386
||||| ||| ||||||||||||| || || |||||||||||||||||||| ||||| ||
Sbjct: 312 ctcgagctcaacaggctttggtatgtctggagggcttgcgcaccttatgagagcccagtt 253
Query: 387 cacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtaggccagccg 446
||| ||||||||||| ||||| ||||| ||||| || || ||||||||||| | || ||
Sbjct: 252 cacaccctcaaagaaaggatgttgctttatctcggtagcaccacgcttgtacccaagtcg 193
Query: 447 ttgctggggctccttcacaagcagacccctgatcagatccctcgccgagaagctgacggc 506
||||| || ||||| || |||| ||||| |||| |||||||| |||||||| ||
Sbjct: 192 gtgctgcgggtccttgactagcaatccccttatcatgtccctcgcagagaagctcacaat 133
Query: 507 cgggtactccgggaagcgcagctgctggccaatgacattgaacagcgtggcccggttgct 566
||| |||| ||||| | || ||||||| | || ||||| || || ||||||||||
Sbjct: 132 tggggactctgggaacctcaagggctggcccacaacgttgaagagtgtagcccggttgcc 73
Query: 567 ggatcccttgaaaggcgtcttcccgaacagcagctcgtacaagaataccccgaaggtcca 626
|| || ||||| || ||||| || |||| || |||||||||||||| || ||||||||
Sbjct: 72 tgaacctttgaacggggtcttgccaaacaacaactcgtacaagaatatgccaaaggtcca 13
Query: 627 cca 629
|||
Sbjct: 12 cca 10
>gb|BE594970.1|BE594970 PI1_48_B08.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 645
Score = 107 bits (54), Expect = 1e-021
Identities = 144/174 (82%)
Strand = Plus / Minus
Query: 327 ctcgatctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaatt 386
||||| ||| ||||||||||||| || || |||||||||||||||||||| ||||| ||
Sbjct: 287 ctcgagctcaacaggctttggtatgtctggagggcttgcgcaccttatgagagcccagtt 228
Query: 387 cacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtaggccagccg 446
||| ||||||||||| ||||| ||||| ||||| || || ||||||||||| | || ||
Sbjct: 227 cacaccctcaaagaaaggatgttgctttatctcggtagcaccacgcttgtacccaagtcg 168
Query: 447 ttgctggggctccttcacaagcagacccctgatcagatccctcgccgagaagct 500
||||| || ||||| || |||| ||||| |||| |||||||| ||||||||
Sbjct: 167 gtgctgcgggtccttgactagcaatccccttatcatgtccctcgcagagaagct 114
>gb|BF480784.1|BF480784 FM1_14_H09.g1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 569
Score = 107 bits (54), Expect = 1e-021
Identities = 144/174 (82%)
Strand = Plus / Minus
Query: 327 ctcgatctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaatt 386
||||| ||| ||||||||||||| || || |||||||||||||||||||| ||||| ||
Sbjct: 254 ctcgagctcaacaggctttggtatgtctggagggcttgcgcaccttatgagagcccagtt 195
Query: 387 cacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtaggccagccg 446
||| ||||||||||| ||||| ||||| ||||| || || ||||||||||| | || ||
Sbjct: 194 cacaccctcaaagaaaggatgttgctttatctcggtagcaccacgcttgtacccaagtcg 135
Query: 447 ttgctggggctccttcacaagcagacccctgatcagatccctcgccgagaagct 500
||||| || ||||| || |||| ||||| |||| |||||||| ||||||||
Sbjct: 134 gtgctgcgggtccttgactagcaatccccttatcatgtccctcgcagagaagct 81
>gb|BG053517.1|BG053517 RHIZ2_10_B08.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 515
Score = 107 bits (54), Expect = 1e-021
Identities = 144/174 (82%)
Strand = Plus / Minus
Query: 327 ctcgatctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaatt 386
||||| ||| ||||||||||||| || || |||||||||||||||||||| ||||| ||
Sbjct: 226 ctcgagctcaacaggctttggtatgtctggagggcttgcgcaccttatgagagcccagtt 167
Query: 387 cacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtaggccagccg 446
||| ||||||||||| ||||| ||||| ||||| || || ||||||||||| | || ||
Sbjct: 166 cacaccctcaaagaaaggatgttgctttatctcggtagcaccacgcttgtacccaagtcg 107
Query: 447 ttgctggggctccttcacaagcagacccctgatcagatccctcgccgagaagct 500
||||| || ||||| || |||| ||||| |||| |||||||| ||||||||
Sbjct: 106 gtgctgcgggtccttgactagcaatccccttatcatgtccctcgcagagaagct 53
>gb|CF074385.1|CF074385 FE1_24_H07.b1_A002 Iron-deficient seedlings Sorghum bicolor cDNA
clone FE1_24_H07_A002 3', mRNA sequence
Length = 635
Score = 107 bits (54), Expect = 1e-021
Identities = 144/174 (82%)
Strand = Plus / Minus
Query: 327 ctcgatctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaatt 386
||||| ||| ||||||||||||| || || |||||||||||||||||||| ||||| ||
Sbjct: 278 ctcgagctcaacaggctttggtatgtctggagggcttgcgcaccttatgagagcccagtt 219
Query: 387 cacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgtaggccagccg 446
||| ||||||||||| ||||| ||||| ||||| || || ||||||||||| | || ||
Sbjct: 218 cacaccctcaaagaaaggatgttgctttatctcggtagcaccacgcttgtacccaagtcg 159
Query: 447 ttgctggggctccttcacaagcagacccctgatcagatccctcgccgagaagct 500
||||| || ||||| || |||| ||||| |||| |||||||| ||||||||
Sbjct: 158 gtgctgcgggtccttgactagcaatccccttatcatgtccctcgcagagaagct 105
>gb|CW223651.1|CW223651 104_659_11203029_148_37186_085 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11203029, DNA
sequence
Length = 726
Score = 103 bits (52), Expect = 2e-020
Identities = 154/188 (81%)
Strand = Plus / Minus
Query: 517 gggaagcgcagctgctggccaatgacattgaacagcgtggcccggttgctggatcccttg 576
|||||||||||| |||| | ||||| ||| |||||||||| ||||||| || ||||||
Sbjct: 191 gggaagcgcagcggctgctcgatgacgttgcacagcgtggcgcggttgccggcgcccttg 132
Query: 577 aaaggcgtcttcccgaacagcagctcgtacaagaataccccgaaggtccaccagtcgacg 636
|| ||||| ||| |||||||||||| | ||| | |||| ||||||||||| ||
Sbjct: 131 aagggcgtggagccgtgcagcagctcgtagaggaagatgccgagcgtccaccagtccacc 72
Query: 637 gcgctgccatggccctcgcctttgatgatctcgggggccaggtactcgtgcgtcccaacg 696
|||||||| ||||||||||| ||||||||| || ||||||||||||||||| || |||
Sbjct: 71 gcgctgccgtggccctcgccgcggatgatctccggcgccaggtactcgtgcgtgccgacg 12
Query: 697 aacgacat 704
||||||||
Sbjct: 11 aacgacat 4
Score = 44.1 bits (22), Expect = 0.018
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 376 agcgcccaattcacgccctcaaagaagggatgctgcttgatctccgtggc 425
|||||||| || || || || ||||| || ||||||||||||||||||||
Sbjct: 347 agcgcccagttgacaccttcgaagaacgggtgctgcttgatctccgtggc 298
>gb|CW280288.1|CW280288 104_755_11407540_148_35446_008 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11407540, DNA
sequence
Length = 652
Score = 101 bits (51), Expect = 9e-020
Identities = 84/95 (88%)
Strand = Plus / Minus
Query: 616 ccgaaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggcc 675
||||||||||||||||||||||||||||| ||||| ||||| ||||||||| || |||
Sbjct: 547 ccgaaggtccaccagtcgacggcgctgccgtggccgtcgccgcggatgatctccggcgcc 488
Query: 676 aggtactcgtgcgtcccaacgaacgacatcgaccg 710
||||||||||| || || ||||||||||| |||||
Sbjct: 487 aggtactcgtgggtgcccacgaacgacatggaccg 453
>gb|CW363768.1|CW363768 fsbb001f035i09k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f035i09, DNA
sequence
Length = 716
Score = 101 bits (51), Expect = 9e-020
Identities = 84/95 (88%)
Strand = Plus / Minus
Query: 616 ccgaaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggcc 675
||||||||||||||||||||||||||||| ||||| ||||| ||||||||| || |||
Sbjct: 171 ccgaaggtccaccagtcgacggcgctgccgtggccgtcgccgcggatgatctccggcgcc 112
Query: 676 aggtactcgtgcgtcccaacgaacgacatcgaccg 710
||||||||||| || || ||||||||||| |||||
Sbjct: 111 aggtactcgtgggtgcccacgaacgacatggaccg 77
>gb|BG465823.1|BG465823 RHIZ2_45_A06.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 522
Score = 101 bits (51), Expect = 9e-020
Identities = 96/111 (86%)
Strand = Plus / Minus
Query: 327 ctcgatctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaatt 386
||||| ||| ||||||||||||| || || |||||||||||||||||||| ||||| ||
Sbjct: 117 ctcgagctcaacaggctttggtatgtctggagggcttgcgcaccttatgagagcccagtt 58
Query: 387 cacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttgta 437
||| ||||||||||| ||||| ||||| ||||| || || |||||||||||
Sbjct: 57 cacaccctcaaagaaaggatgttgctttatctcggtagcaccacgcttgta 7
>gb|CX606300.1|CX606300 ANR1_2_F08.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_2_F08_A002 3', mRNA sequence
Length = 593
Score = 97.6 bits (49), Expect = 1e-018
Identities = 160/197 (81%)
Strand = Plus / Minus
Query: 535 ccaatgacattgaacagcgtggcccggttgctggatcccttgaaaggcgtcttcccgaac 594
||||||||||||||||| || |||||||| | | || ||||| || || ||||| |||
Sbjct: 204 ccaatgacattgaacagtgtcgcccggttccccgtgcctttgaatggggttttcccaaac 145
Query: 595 agcagctcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggccctcg 654
|| ||||| || | ||||| || |||||||||||||| || || || ||||| |||||
Sbjct: 144 aggagctcctataggaatataccaaaggtccaccagtcaacagcactaccatgaccctca 85
Query: 655 cctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacatcgaccgtgcg 714
|||||||| ||||||||||||| |||||| || || ||||| || |||||||| |||||
Sbjct: 84 cctttgataatctcgggggccaagtactcatgtgtaccaacaaatgacatcgatcgtgca 25
Query: 715 tcgctgggctctgctat 731
|| || || ||||||||
Sbjct: 24 tcactaggttctgctat 8
>gb|CW183962.1|CW183962 104_600_11164896_148_36687_096 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11164896, DNA
sequence
Length = 665
Score = 93.7 bits (47), Expect = 2e-017
Identities = 77/87 (88%)
Strand = Plus / Minus
Query: 333 ctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaattcacgcc 392
|||||||||||||||||| ||||| |||||||| |||| || | |||||||||||| ||
Sbjct: 150 ctcgacaggctttggtacatccggagggcttgcacaccgaatcaacgcccaattcacacc 91
Query: 393 ctcaaagaagggatgctgcttgatctc 419
||||||||| || ||||||||||||||
Sbjct: 90 ctcaaagaacgggtgctgcttgatctc 64
>gb|AW679681.1|AW679681 WS1_30_E12.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 637
Score = 93.7 bits (47), Expect = 2e-017
Identities = 77/87 (88%)
Strand = Plus / Minus
Query: 333 ctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaattcacgcc 392
|||||||||||||||||| ||||| |||||||| |||| || | |||||||||||| ||
Sbjct: 224 ctcgacaggctttggtacatccggagggcttgcacaccgaatcaacgcccaattcacacc 165
Query: 393 ctcaaagaagggatgctgcttgatctc 419
||||||||| || ||||||||||||||
Sbjct: 164 ctcaaagaacgggtgctgcttgatctc 138
>gb|AW923900.1|AW923900 WS1_30_E12.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 569
Score = 93.7 bits (47), Expect = 2e-017
Identities = 77/87 (88%)
Strand = Plus / Minus
Query: 333 ctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaattcacgcc 392
|||||||||||||||||| ||||| |||||||| |||| || | |||||||||||| ||
Sbjct: 292 ctcgacaggctttggtacatccggagggcttgcacaccgaatcaacgcccaattcacacc 233
Query: 393 ctcaaagaagggatgctgcttgatctc 419
||||||||| || ||||||||||||||
Sbjct: 232 ctcaaagaacgggtgctgcttgatctc 206
>gb|BG357481.1|BG357481 OV2_30_D12.g1_A002 Ovary 2 (OV2) Sorghum bicolor cDNA, mRNA
sequence
Length = 658
Score = 93.7 bits (47), Expect = 2e-017
Identities = 77/87 (88%)
Strand = Plus / Minus
Query: 333 ctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaattcacgcc 392
|||||||||||||||||| ||||| |||||||| |||| || | |||||||||||| ||
Sbjct: 280 ctcgacaggctttggtacatccggagggcttgcacaccgaatcaacgcccaattcacacc 221
Query: 393 ctcaaagaagggatgctgcttgatctc 419
||||||||| || ||||||||||||||
Sbjct: 220 ctcaaagaacgggtgctgcttgatctc 194
>gb|CD423436.1|CD423436 SA1_23_C04.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_23_C04_A002 3', mRNA sequence
Length = 643
Score = 93.7 bits (47), Expect = 2e-017
Identities = 77/87 (88%)
Strand = Plus / Minus
Query: 333 ctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaattcacgcc 392
|||||||||||||||||| ||||| |||||||| |||| || | |||||||||||| ||
Sbjct: 242 ctcgacaggctttggtacatccggagggcttgcacaccgaatcaacgcccaattcacacc 183
Query: 393 ctcaaagaagggatgctgcttgatctc 419
||||||||| || ||||||||||||||
Sbjct: 182 ctcaaagaacgggtgctgcttgatctc 156
>gb|CF485574.1|CF485574 POL1_32_G12.b1_A002 Pollen Sorghum bicolor cDNA clone
POL1_32_G12_A002 3', mRNA sequence
Length = 563
Score = 93.7 bits (47), Expect = 2e-017
Identities = 77/87 (88%)
Strand = Plus / Minus
Query: 333 ctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaattcacgcc 392
|||||||||||||||||| ||||| |||||||| |||| || | |||||||||||| ||
Sbjct: 250 ctcgacaggctttggtacatccggagggcttgcacaccgaatcaacgcccaattcacacc 191
Query: 393 ctcaaagaagggatgctgcttgatctc 419
||||||||| || ||||||||||||||
Sbjct: 190 ctcaaagaacgggtgctgcttgatctc 164
>gb|CN126293.1|CN126293 RHOH1_16_G04.b1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_16_G04_A002 3', mRNA sequence
Length = 820
Score = 93.7 bits (47), Expect = 2e-017
Identities = 77/87 (88%)
Strand = Plus / Minus
Query: 333 ctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaattcacgcc 392
|||||||||||||||||| ||||| |||||||| |||| || | |||||||||||| ||
Sbjct: 411 ctcgacaggctttggtacatccggagggcttgcacaccgaatcaacgcccaattcacacc 352
Query: 393 ctcaaagaagggatgctgcttgatctc 419
||||||||| || ||||||||||||||
Sbjct: 351 ctcaaagaacgggtgctgcttgatctc 325
>gb|CN126382.1|CN126382 RHOH1_16_G04.g1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_16_G04_A002 5', mRNA sequence
Length = 724
Score = 93.7 bits (47), Expect = 2e-017
Identities = 77/87 (88%)
Strand = Plus / Minus
Query: 333 ctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaattcacgcc 392
|||||||||||||||||| ||||| |||||||| |||| || | |||||||||||| ||
Sbjct: 721 ctcgacaggctttggtacatccggagggcttgcacaccgaatcaacgcccaattcacacc 662
Query: 393 ctcaaagaagggatgctgcttgatctc 419
||||||||| || ||||||||||||||
Sbjct: 661 ctcaaagaacgggtgctgcttgatctc 635
>gb|CN134750.1|CN134750 OX1_28_E12.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_28_E12_A002 3', mRNA sequence
Length = 842
Score = 93.7 bits (47), Expect = 2e-017
Identities = 77/87 (88%)
Strand = Plus / Minus
Query: 333 ctcgacaggctttggtacctccggtgggcttgcgcaccttatgagcgcccaattcacgcc 392
|||||||||||||||||| ||||| |||||||| |||| || | |||||||||||| ||
Sbjct: 612 ctcgacaggctttggtacatccggagggcttgcacaccgaatcaacgcccaattcacacc 553
Query: 393 ctcaaagaagggatgctgcttgatctc 419
||||||||| || ||||||||||||||
Sbjct: 552 ctcaaagaacgggtgctgcttgatctc 526
Score = 48.1 bits (24), Expect = 0.001
Identities = 129/164 (78%)
Strand = Plus / Minus
Query: 541 acattgaacagcgtggcccggttgctggatcccttgaaaggcgtcttcccgaacagcagc 600
|||||||| || || |||||||| | || ||||||||||| ||||| || || || |||
Sbjct: 404 acattgaagagtgtagcccggtttcctgaccccttgaaaggggtcttaccaaataggagc 345
Query: 601 tcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggccctcgcctttg 660
|| || | ||||| || ||||||||||| || || || ||||||||||| || || |||
Sbjct: 344 tcataaaggaatataccaaaggtccaccaatccacagcactgccatggccttctcccttg 285
Query: 661 atgatctcgggggccaggtactcgtgcgtcccaacgaacgacat 704
|| || || || |||| |||||| || || ||||| || |||||
Sbjct: 284 attatttctggcgccaagtactcatgggtgccaacaaatgacat 241
>gb|CW365890.1|CW365890 fsbb001f038k04f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f038k04, DNA
sequence
Length = 678
Score = 91.7 bits (46), Expect = 9e-017
Identities = 163/202 (80%)
Strand = Plus / Minus
Query: 530 gctggccaatgacattgaacagcgtggcccggttgctggatcccttgaaaggcgtcttcc 589
|||| ||||||||||||||||| || |||||||| | | || ||||| || || ||||
Sbjct: 347 gctgaccaatgacattgaacagtgtcgcccggttccccgtgcctttgaatggtgttttcc 288
Query: 590 cgaacagcagctcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggc 649
| ||||| ||||| || | ||||| || |||||||||||||| || || || ||||| |
Sbjct: 287 caaacaggagctcatataggaatataccaaaggtccaccagtcaacagcactaccatgac 228
Query: 650 cctcgcctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacatcgacc 709
|||| |||||||| |||||||| |||| |||||| || || ||||| || |||||||| |
Sbjct: 227 cctcacctttgataatctcgggtgccaagtactcatgtgtaccaacaaatgacatcgatc 168
Query: 710 gtgcgtcgctgggctctgctat 731
|||| || || || ||||||||
Sbjct: 167 gtgcatcactaggttctgctat 146
>gb|CW365891.1|CW365891 fsbb001f038k04k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f038k04, DNA
sequence
Length = 693
Score = 91.7 bits (46), Expect = 9e-017
Identities = 163/202 (80%)
Strand = Plus / Plus
Query: 530 gctggccaatgacattgaacagcgtggcccggttgctggatcccttgaaaggcgtcttcc 589
|||| ||||||||||||||||| || |||||||| | | || ||||| || || ||||
Sbjct: 344 gctgaccaatgacattgaacagtgtcgcccggttccccgtgcctttgaatggtgttttcc 403
Query: 590 cgaacagcagctcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggc 649
| ||||| ||||| || | ||||| || |||||||||||||| || || || ||||| |
Sbjct: 404 caaacaggagctcatataggaatataccaaaggtccaccagtcaacagcactaccatgac 463
Query: 650 cctcgcctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacatcgacc 709
|||| |||||||| |||||||| |||| |||||| || || ||||| || |||||||| |
Sbjct: 464 cctcacctttgataatctcgggtgccaagtactcatgtgtaccaacaaatgacatcgatc 523
Query: 710 gtgcgtcgctgggctctgctat 731
|||| || || || ||||||||
Sbjct: 524 gtgcatcactaggttctgctat 545
>gb|CF489387.1|CF489387 POL1_57_F11.b1_A002 Pollen Sorghum bicolor cDNA clone
POL1_57_F11_A002 3', mRNA sequence
Length = 712
Score = 91.7 bits (46), Expect = 9e-017
Identities = 163/202 (80%)
Strand = Plus / Minus
Query: 530 gctggccaatgacattgaacagcgtggcccggttgctggatcccttgaaaggcgtcttcc 589
|||| ||||||||||||||||| || |||||||| | | || ||||| || || ||||
Sbjct: 209 gctgaccaatgacattgaacagtgtcgcccggttccccgtgcctttgaatggtgttttcc 150
Query: 590 cgaacagcagctcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggc 649
| ||||| ||||| || | ||||| || |||||||||||||| || || || ||||| |
Sbjct: 149 caaacaggagctcatataggaatataccaaaggtccaccagtcaacagcactaccatgac 90
Query: 650 cctcgcctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacatcgacc 709
|||| |||||||| |||||||| |||| |||||| || || ||||| || |||||||| |
Sbjct: 89 cctcacctttgataatctcgggtgccaagtactcatgtgtaccaacaaatgacatcgatc 30
Query: 710 gtgcgtcgctgggctctgctat 731
|||| || || || ||||||||
Sbjct: 29 gtgcatcactaggttctgctat 8
>gb|CW111205.1|CW111205 104_484_11104174_148_34528_089 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11104174, DNA
sequence
Length = 516
Score = 85.7 bits (43), Expect = 5e-015
Identities = 94/111 (84%)
Strand = Plus / Plus
Query: 594 cagcagctcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggccctc 653
|||||||||||| | ||| | |||| ||||||||||| || |||||||| ||||||||
Sbjct: 37 cagcagctcgtagaggaagatgccgagcgtccaccagtccaccgcgctgccgtggccctc 96
Query: 654 gcctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacat 704
||| ||||||||| || ||||||||||||||||| || |||||||||||
Sbjct: 97 gccgcggatgatctccggcgccaggtactcgtgcgtgccgacgaacgacat 147
>gb|CW310536.1|CW310536 104_799_11469765_116_37434_083 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11469765, DNA
sequence
Length = 614
Score = 85.7 bits (43), Expect = 5e-015
Identities = 94/111 (84%)
Strand = Plus / Plus
Query: 594 cagcagctcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggccctc 653
|||||||||||| | ||| | |||| ||||||||||| || |||||||| ||||||||
Sbjct: 28 cagcagctcgtagaggaagatgccgagcgtccaccagtccaccgcgctgccgtggccctc 87
Query: 654 gcctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacat 704
||| ||||||||| || ||||||||||||||||| || |||||||||||
Sbjct: 88 gccgcggatgatctccggcgccaggtactcgtgcgtgccgacgaacgacat 138
>gb|CW430454.1|CW430454 fsbb001f144c20f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f144c20, DNA
sequence
Length = 611
Score = 83.8 bits (42), Expect = 2e-014
Identities = 57/62 (91%)
Strand = Plus / Minus
Query: 373 atgagcgcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgc 432
||||| ||||| |||||||||||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 182 atgagagcccagttcacgccctcaaagaaggggtgctgcttgatctccgtcgctccccgc 123
Query: 433 tt 434
||
Sbjct: 122 tt 121
>gb|CD209113.1|CD209113 HS1_46_A12.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_46_A12_A012 3', mRNA sequence
Length = 651
Score = 83.8 bits (42), Expect = 2e-014
Identities = 57/62 (91%)
Strand = Plus / Minus
Query: 373 atgagcgcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgc 432
||||| ||||| |||||||||||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 353 atgagagcccagttcacgccctcaaagaaggggtgctgcttgatctccgtcgctccccgc 294
Query: 433 tt 434
||
Sbjct: 293 tt 292
Score = 79.8 bits (40), Expect = 3e-013
Identities = 133/164 (81%)
Strand = Plus / Minus
Query: 544 ttgaacagcgtggcccggttgctggatcccttgaaaggcgtcttcccgaacagcagctcg 603
|||||||| ||||| ||||| | || |||||||| || || || ||| |||||||||||
Sbjct: 182 ttgaacagagtggcgcggttccctgaccccttgaatggggttttgccgtacagcagctcg 123
Query: 604 tacaagaataccccgaaggtccaccagtcgacggcgctgccatggccctcgcctttgatg 663
| | ||| | |||||||||||||||||||||||||| ||||| || || || ||||||
Sbjct: 122 tggaggaagatgccgaaggtccaccagtcgacggcgcttccatgcccttcacccttgatg 63
Query: 664 atctcgggggccaggtactcgtgcgtcccaacgaacgacatcga 707
|| || ||||| | ||| || || ||||| ||||| ||||||||
Sbjct: 62 atttcaggggctaagtattcatgagtcccgacgaatgacatcga 19
>gb|CD427064.1|CD427064 SA1_17_G05.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_17_G05_A002 3', mRNA sequence
Length = 652
Score = 83.8 bits (42), Expect = 2e-014
Identities = 57/62 (91%)
Strand = Plus / Minus
Query: 373 atgagcgcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgc 432
||||| ||||| |||||||||||||||||||| ||||||||||||||||| ||||| |||
Sbjct: 238 atgagagcccagttcacgccctcaaagaaggggtgctgcttgatctccgtcgctccccgc 179
Query: 433 tt 434
||
Sbjct: 178 tt 177
>gb|CW034726.1|CW034726 104_265_10502729_114_30378 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10502729, DNA
sequence
Length = 463
Score = 79.8 bits (40), Expect = 3e-013
Identities = 109/132 (82%)
Strand = Plus / Plus
Query: 571 cccttgaaaggcgtcttcccgaacagcagctcgtacaagaataccccgaaggtccaccag 630
|||||||| |||||| |||| ||| || |||||||| ||| ||||| | |||||||||
Sbjct: 186 cccttgaacggcgtccgcccgtacatcatctcgtacatgaacacccccagcgtccaccag 245
Query: 631 tcgacggcgctgccatggccctcgcctttgatgatctcgggggccaggtactcgtgcgtc 690
|||||||||||||| ||||||| || ||| | ||| || |||||||||||||||||
Sbjct: 246 tcgacggcgctgccgtggccctgcccggagatcacctccggcgccaggtactcgtgcgtg 305
Query: 691 ccaacgaacgac 702
|| |||||||||
Sbjct: 306 cccacgaacgac 317
>gb|CW311717.1|CW311717 104_801_11470377_116_36277_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11470377, DNA
sequence
Length = 698
Score = 79.8 bits (40), Expect = 3e-013
Identities = 109/132 (82%)
Strand = Plus / Plus
Query: 571 cccttgaaaggcgtcttcccgaacagcagctcgtacaagaataccccgaaggtccaccag 630
|||||||| |||||| |||| ||| || |||||||| ||| ||||| | |||||||||
Sbjct: 437 cccttgaacggcgtccgcccgtacatcatctcgtacatgaacacccccagcgtccaccag 496
Query: 631 tcgacggcgctgccatggccctcgcctttgatgatctcgggggccaggtactcgtgcgtc 690
|||||||||||||| ||||||| || ||| | ||| || |||||||||||||||||
Sbjct: 497 tcgacggcgctgccgtggccctgcccggagatcacctccggcgccaggtactcgtgcgtg 556
Query: 691 ccaacgaacgac 702
|| |||||||||
Sbjct: 557 cccacgaacgac 568
>gb|CW311718.1|CW311718 104_801_11470377_148_36278_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11470377, DNA
sequence
Length = 635
Score = 79.8 bits (40), Expect = 3e-013
Identities = 109/132 (82%)
Strand = Plus / Minus
Query: 571 cccttgaaaggcgtcttcccgaacagcagctcgtacaagaataccccgaaggtccaccag 630
|||||||| |||||| |||| ||| || |||||||| ||| ||||| | |||||||||
Sbjct: 611 cccttgaacggcgtccgcccgtacatcatctcgtacatgaacacccccagcgtccaccag 552
Query: 631 tcgacggcgctgccatggccctcgcctttgatgatctcgggggccaggtactcgtgcgtc 690
|||||||||||||| ||||||| || ||| | ||| || |||||||||||||||||
Sbjct: 551 tcgacggcgctgccgtggccctgcccggagatcacctccggcgccaggtactcgtgcgtg 492
Query: 691 ccaacgaacgac 702
|| |||||||||
Sbjct: 491 cccacgaacgac 480
>gb|BG052508.1|BG052508 RHIZ2_26_A04.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 520
Score = 75.8 bits (38), Expect = 5e-012
Identities = 56/62 (90%)
Strand = Plus / Minus
Query: 373 atgagcgcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgc 432
||||| ||||| ||||||||||| |||||||| ||||||||||||||||| ||||| |||
Sbjct: 228 atgagagcccagttcacgccctcgaagaaggggtgctgcttgatctccgtcgctccccgc 169
Query: 433 tt 434
||
Sbjct: 168 tt 167
>gb|BG103243.1|BG103243 RHIZ2_19_H12.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 691
Score = 75.8 bits (38), Expect = 5e-012
Identities = 56/62 (90%)
Strand = Plus / Minus
Query: 373 atgagcgcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgc 432
||||| ||||| ||||||||||| |||||||| ||||||||||||||||| ||||| |||
Sbjct: 404 atgagagcccagttcacgccctcgaagaaggggtgctgcttgatctccgtcgctccccgc 345
Query: 433 tt 434
||
Sbjct: 344 tt 343
Score = 71.9 bits (36), Expect = 8e-011
Identities = 132/164 (80%)
Strand = Plus / Minus
Query: 544 ttgaacagcgtggcccggttgctggatcccttgaaaggcgtcttcccgaacagcagctcg 603
|||||||| ||||| ||||| | || |||||||| || || || ||| |||||||||||
Sbjct: 233 ttgaacagagtggcgcggttccctgaccccttgaatggggttttgccgtacagcagctcg 174
Query: 604 tacaagaataccccgaaggtccaccagtcgacggcgctgccatggccctcgcctttgatg 663
| | ||| | |||||||||||||||||||||||||| ||||| || || || ||||||
Sbjct: 173 tggaggaagatgccgaaggtccaccagtcgacggcgcttccatgcccttcacccttgatg 114
Query: 664 atctcgggggccaggtactcgtgcgtcccaacgaacgacatcga 707
|| || ||||| | ||| || || ||||| || || ||||||||
Sbjct: 113 atttcaggggctaagtattcatgagtcccgacaaatgacatcga 70
>gb|CW308233.1|CW308233 104_796_11468560_116_35731_054 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11468560, DNA
sequence
Length = 613
Score = 65.9 bits (33), Expect = 5e-009
Identities = 45/49 (91%)
Strand = Plus / Plus
Query: 663 gatctcgggggccaggtactcgtgcgtcccaacgaacgacatcgaccgt 711
||||||||| ||||||||||||||||| || ||||||||||| ||||||
Sbjct: 495 gatctcgggcgccaggtactcgtgcgtgcccacgaacgacatggaccgt 543
>gb|CW308234.1|CW308234 104_796_11468560_148_35739_054 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11468560, DNA
sequence
Length = 605
Score = 65.9 bits (33), Expect = 5e-009
Identities = 45/49 (91%)
Strand = Plus / Minus
Query: 663 gatctcgggggccaggtactcgtgcgtcccaacgaacgacatcgaccgt 711
||||||||| ||||||||||||||||| || ||||||||||| ||||||
Sbjct: 464 gatctcgggcgccaggtactcgtgcgtgcccacgaacgacatggaccgt 416
>gb|CW073807.1|CW073807 104_340_10781623_116_31470_103 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10781623, DNA
sequence
Length = 596
Score = 63.9 bits (32), Expect = 2e-008
Identities = 56/64 (87%)
Strand = Plus / Plus
Query: 616 ccgaaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggcc 675
||||||||||||||||||||||| ||||| ||||| ||||| ||||||||| || |||
Sbjct: 533 ccgaaggtccaccagtcgacggctctgccgtggccgtcgccgcggatgatctccggcgcc 592
Query: 676 aggt 679
||||
Sbjct: 593 aggt 596
>gb|CF489555.1|CF489555 POL1_58_F10.b1_A002 Pollen Sorghum bicolor cDNA clone
POL1_58_F10_A002 3', mRNA sequence
Length = 692
Score = 63.9 bits (32), Expect = 2e-008
Identities = 146/184 (79%)
Strand = Plus / Minus
Query: 530 gctggccaatgacattgaacagcgtggcccggttgctggatcccttgaaaggcgtcttcc 589
|||| |||||||||||||||||||| |||||| | | | || ||||| || || ||||
Sbjct: 188 gctgaccaatgacattgaacagcgtcgcccgggtccccgtgcctttgaatggtgttttcc 129
Query: 590 cgaacagcagctcgtacaagaataccccgaaggtccaccagtcgacggcgctgccatggc 649
| ||||| ||||| || | ||||| || |||| |||||||| || | || ||||| |
Sbjct: 128 caaacaggagctcatataggaatataccaaaggggcaccagtcaacaacactaccatgac 69
Query: 650 cctcgcctttgatgatctcgggggccaggtactcgtgcgtcccaacgaacgacatcgacc 709
|||| |||||||| |||||||| |||| |||||| || || ||||| || |||||||| |
Sbjct: 68 cctcacctttgataatctcgggtgccaagtactcatgtgtaccaacaaatgacatcgatc 9
Query: 710 gtgc 713
||||
Sbjct: 8 gtgc 5
>gb|CW023418.1|CW023418 104_163_10432439_1_30001 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10432439, DNA
sequence
Length = 459
Score = 60.0 bits (30), Expect = 3e-007
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 376 agcgcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttg 435
|||||||| || |||||||| ||||||||||||||||| ||||||| || || ||||||
Sbjct: 367 agcgcccagttgacgccctcgaagaagggatgctgctttatctccgccgcgccgcgcttg 426
Query: 436 taggccagccgttgctggggctcctt 461
| ||||||| ||||||||||||
Sbjct: 427 acgcccagccggctctggggctcctt 452
>gb|CW368244.1|CW368244 fsbb001f042b22k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f042b22, DNA
sequence
Length = 403
Score = 60.0 bits (30), Expect = 3e-007
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 376 agcgcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttg 435
|||||||| || |||||||| ||||||||||||||||| ||||||| || || ||||||
Sbjct: 176 agcgcccagttgacgccctcgaagaagggatgctgctttatctccgccgcgccgcgcttg 235
Query: 436 taggccagccgttgctggggctcctt 461
| ||||||| ||||||||||||
Sbjct: 236 acgcccagccggctctggggctcctt 261
>gb|CW492772.1|CW492772 fsbb001f283d16k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f283d16, DNA
sequence
Length = 441
Score = 60.0 bits (30), Expect = 3e-007
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 376 agcgcccaattcacgccctcaaagaagggatgctgcttgatctccgtggctccacgcttg 435
|||||||| || |||||||| ||||||||||||||||| ||||||| || || ||||||
Sbjct: 271 agcgcccagttgacgccctcgaagaagggatgctgctttatctccgccgcgccgcgcttg 330
Query: 436 taggccagccgttgctggggctcctt 461
| ||||||| ||||||||||||
Sbjct: 331 acgcccagccggctctggggctcctt 356
>gb|CN132772.1|CN132772 OX1_8_D03.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_8_D03_A002 3', mRNA sequence
Length = 567
Score = 60.0 bits (30), Expect = 3e-007
Identities = 42/46 (91%)
Strand = Plus / Minus
Query: 376 agcgcccaattcacgccctcaaagaagggatgctgcttgatctccg 421
|||||||| || |||||||| ||||||||||||||||| |||||||
Sbjct: 81 agcgcccagttgacgccctcgaagaagggatgctgctttatctccg 36
>gb|CW492771.1|CW492771 fsbb001f283d16f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f283d16, DNA
sequence
Length = 352
Score = 52.0 bits (26), Expect = 7e-005
Identities = 38/42 (90%)
Strand = Plus / Minus
Query: 663 gatctcgggggccaggtactcgtgcgtcccaacgaacgacat 704
|||||| ||| |||||||||||||||| || |||||||||||
Sbjct: 352 gatctccgggcccaggtactcgtgcgtgcccacgaacgacat 311
>gb|CW105163.1|CW105163 104_474_11012772_116_34453_042 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11012772, DNA
sequence
Length = 714
Score = 50.1 bits (25), Expect = 3e-004
Identities = 55/65 (84%)
Strand = Plus / Minus
Query: 619 aaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggccagg 678
|||||||||||||| || || || |||||||| || ||||||||||| || || || |||
Sbjct: 227 aaggtccaccagtcaacagcacttccatggccatcccctttgatgatttctggtgcaagg 168
Query: 679 tactc 683
|||||
Sbjct: 167 tactc 163
>gb|CW403691.1|CW403691 fsbb001f095i13k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f095i13, DNA
sequence
Length = 681
Score = 50.1 bits (25), Expect = 3e-004
Identities = 55/65 (84%)
Strand = Plus / Minus
Query: 619 aaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggccagg 678
|||||||||||||| || || || |||||||| || ||||||||||| || || || |||
Sbjct: 373 aaggtccaccagtcaacagcacttccatggccatcccctttgatgatttctggtgcaagg 314
Query: 679 tactc 683
|||||
Sbjct: 313 tactc 309
>gb|BF422042.1|BF422042 FM1_12_C02.g1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 591
Score = 50.1 bits (25), Expect = 3e-004
Identities = 55/65 (84%)
Strand = Plus / Minus
Query: 619 aaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggccagg 678
|||||||||||||| || || || |||||||| || ||||||||||| || || || |||
Sbjct: 76 aaggtccaccagtcaacagcacttccatggccatcccctttgatgatttctggtgcaagg 17
Query: 679 tactc 683
|||||
Sbjct: 16 tactc 12
Score = 44.1 bits (22), Expect = 0.018
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 379 gcccaattcacgccctcaaagaagggatgctgcttgat 416
|||||||||| ||| |||||||| || |||||||||||
Sbjct: 316 gcccaattcaagccttcaaagaaagggtgctgcttgat 279
>gb|CN147606.1|CN147606 WOUND1_50_F12.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_50_F12_A002 5', mRNA sequence
Length = 818
Score = 50.1 bits (25), Expect = 3e-004
Identities = 55/65 (84%)
Strand = Plus / Minus
Query: 619 aaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggccagg 678
|||||||||||||| || || || |||||||| || ||||||||||| || || || |||
Sbjct: 653 aaggtccaccagtcaacagcacttccatggccatcccctttgatgatttctggtgcaagg 594
Query: 679 tactc 683
|||||
Sbjct: 593 tactc 589
>gb|CN149831.1|CN149831 WOUND1_65_D05.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_65_D05_A002 3', mRNA sequence
Length = 685
Score = 50.1 bits (25), Expect = 3e-004
Identities = 55/65 (84%)
Strand = Plus / Minus
Query: 619 aaggtccaccagtcgacggcgctgccatggccctcgcctttgatgatctcgggggccagg 678
|||||||||||||| || || || |||||||| || ||||||||||| || || || |||
Sbjct: 171 aaggtccaccagtcaacagcacttccatggccatcccctttgatgatttctggtgcaagg 112
Query: 679 tactc 683
|||||
Sbjct: 111 tactc 107
>gb|CW403690.1|CW403690 fsbb001f095i13f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f095i13, DNA
sequence
Length = 615
Score = 46.1 bits (23), Expect = 0.005
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 619 aaggtccaccagtcgacggcgctgccatggccctcgcctttgatgat 665
|||||||||||||| || || || |||||||| || |||||||||||
Sbjct: 564 aaggtccaccagtcaacagcacttccatggccatcccctttgatgat 610
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 186,679
Number of Sequences: 832831
Number of extensions: 186679
Number of successful extensions: 50967
Number of sequences better than 0.5: 67
Number of HSP's better than 0.5 without gapping: 67
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50839
Number of HSP's gapped (non-prelim): 120
length of query: 735
length of database: 491,359,669
effective HSP length: 20
effective length of query: 715
effective length of database: 474,703,049
effective search space: 339412680035
effective search space used: 339412680035
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)