BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2542042.2.1
(691 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW165269.1|CW165269 104_573_11152417_116_36472_005 Sorgh... 256 2e-066
gb|CW020916.1|CW020916 104_109_10409239_116_30501 Sorghum m... 107 1e-021
gb|CW020915.1|CW020915 104_109_10409239_114_30493 Sorghum m... 100 3e-019
>gb|CW165269.1|CW165269 104_573_11152417_116_36472_005 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11152417, DNA
sequence
Length = 571
Score = 256 bits (129), Expect = 2e-066
Identities = 237/273 (86%), Gaps = 3/273 (1%)
Strand = Plus / Minus
Query: 39 cctgcgccacctccgagcaggcggcggccgacttcgctgcctcctcgctcggggtcaggg 98
|||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||| |
Sbjct: 481 cctgcgccacctccgagcaggcggcgaccgacttcgctgccgcctcgctgggggtcagtg 422
Query: 99 ccagcaagctggtcgcgctcgtcaccaccgtccatggggggaaggacgccactagatacg 158
||||| |||||||||| ||||||| |||||| ||| | |||||||| | || ||||
Sbjct: 421 ccagcgagctggtcgccgtcgtcacngtcgtccangggagctaggacgccgccaggtacg 362
Query: 159 tggtggcgcccaacggcatcacacgcatcggcaaggcggcaggggccgcggccgtagtgc 218
|||||||||| ||||| || | ||||||||||||||| || ||||| |||| ||||
Sbjct: 361 tggtggcgccagacggcgtcgcgcgcatcggcaaggcg---ggagccgccgccgcggtgc 305
Query: 219 cgtgccacccgatgtcgtacccgtacatggtccactactgccaccagccggcggacgtgg 278
|||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 304 cgtgccaccctatggcgtacccgtacatggtccactactgccaccggccggcggacgtgg 245
Query: 279 aggcgctccgtattgagctgaccgggctcggag 311
|||||||||| | |||||||| ||||||||||
Sbjct: 244 aggcgctccgcgtcgagctgacggggctcggag 212
Score = 155 bits (78), Expect = 6e-036
Identities = 120/134 (89%)
Strand = Plus / Minus
Query: 326 accgcgatcgccatgtgccacgccaacaccatgaactgggacgatcgctacttccaaatg 385
||||||||||||||||||||||||||||||| || |||||||| || |||||| | |||
Sbjct: 179 accgcgatcgccatgtgccacgccaacaccacgagctgggacgcccgatacttcgagatg 120
Query: 386 ctgaacgtgacgcgcggcgaggagatctgccacttcatgccgcgcaactatgtgctctgg 445
||||||| ||||||||| |||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 119 ctgaacgcgacgcgcggggaggagatctgccacttcatgccgcggaactacgtgctgtgg 60
Query: 446 ctaccagctgccga 459
|| || ||||||||
Sbjct: 59 ctgccggctgccga 46
>gb|CW020916.1|CW020916 104_109_10409239_116_30501 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10409239, DNA
sequence
Length = 634
Score = 107 bits (54), Expect = 1e-021
Identities = 69/74 (93%)
Strand = Plus / Plus
Query: 39 cctgcgccacctccgagcaggcggcggccgacttcgctgcctcctcgctcggggtcaggg 98
|||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||| |
Sbjct: 561 cctgcgccacctccgagcaggcggcgaccgacttcgctgccgcctcgctgggggtcagtg 620
Query: 99 ccagcaagctggtc 112
||||| ||||||||
Sbjct: 621 ccagcgagctggtc 634
>gb|CW020915.1|CW020915 104_109_10409239_114_30493 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10409239, DNA
sequence
Length = 717
Score = 99.6 bits (50), Expect = 3e-019
Identities = 77/86 (89%)
Strand = Plus / Minus
Query: 374 tacttccaaatgctgaacgtgacgcgcggcgaggagatctgccacttcatgccgcgcaac 433
|||||| | |||||||||| ||||||||| |||||||||||||||||||||||||| |||
Sbjct: 708 tacttcgagatgctgaacgcgacgcgcggggaggagatctgccacttcatgccgcggaac 649
Query: 434 tatgtgctctggctaccagctgccga 459
|| ||||| ||||| || ||||||||
Sbjct: 648 tacgtgctgtggctgccggctgccga 623
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 193,772
Number of Sequences: 832831
Number of extensions: 193772
Number of successful extensions: 53839
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53832
Number of HSP's gapped (non-prelim): 6
length of query: 691
length of database: 491,359,669
effective HSP length: 20
effective length of query: 671
effective length of database: 474,703,049
effective search space: 318525745879
effective search space used: 318525745879
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)