BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2440773.2.1
(1437 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW672118.1|AW672118 LG1_357_F09.b1_A002 Light Grown 1 (L... 706 0.0
gb|CN132016.1|CN132016 OX1_3_C11.g1_A002 Oxidatively-stress... 642 0.0
gb|BM322277.1|BM322277 PIC1_2_E03.b1_A002 Pathogen-infected... 426 e-117
gb|BG463420.1|BG463420 EM1_49_C05.b1_A002 Embryo 1 (EM1) So... 252 8e-065
gb|CL166462.1|CL166462 104_362_10809392_114_31798_224 Sorgh... 163 6e-038
gb|CL166463.1|CL166463 104_362_10809392_116_31799_224 Sorgh... 163 6e-038
gb|CW326410.1|CW326410 104_821_11478202_116_36065_035 Sorgh... 163 6e-038
gb|CW326411.1|CW326411 104_821_11478202_148_36064_035 Sorgh... 157 3e-036
gb|CW039193.1|CW039193 104_271_10505355_114_30387 Sorghum m... 141 2e-031
gb|BM326763.1|BM326763 PIC1_2_E03.g1_A002 Pathogen-infected... 125 1e-026
gb|BG463500.1|BG463500 EM1_49_C05.g1_A002 Embryo 1 (EM1) So... 121 2e-025
gb|CN131930.1|CN131930 OX1_3_C11.b1_A002 Oxidatively-stress... 121 2e-025
gb|CW176188.1|CW176188 104_589_11158356_116_36589_048 Sorgh... 117 3e-024
gb|BG411541.1|BG411541 EM1_57_E04.b1_A002 Embryo 1 (EM1) So... 113 5e-023
gb|CW235057.1|CW235057 104_690_11214777_116_37407_043 Sorgh... 64 4e-008
gb|CW235058.1|CW235058 104_690_11214777_148_37411_043 Sorgh... 64 4e-008
gb|CW259825.1|CW259825 104_726_11228639_148_35188_092 Sorgh... 64 4e-008
gb|CW295542.1|CW295542 104_776_11460984_148_35613_082 Sorgh... 64 4e-008
gb|CW465986.1|CW465986 fsbb001f217a05k0 Sorghum methylation... 64 4e-008
gb|CW495001.1|CW495001 fsbb001f286i24k0 Sorghum methylation... 64 4e-008
gb|CW070237.1|CW070237 104_321_10526627_1_30090 Sorghum met... 60 6e-007
gb|CW259824.1|CW259824 104_726_11228639_116_35192_092 Sorgh... 60 6e-007
gb|CW495000.1|CW495000 fsbb001f286i24f0 Sorghum methylation... 60 6e-007
gb|BE592920.1|BE592920 WS1_92_A12.b1_A002 Water-stressed 1 ... 56 9e-006
gb|BG933249.1|BG933249 WS1_92_A12.g1_A002 Water-stressed 1 ... 56 9e-006
gb|BZ335282.1|BZ335282 hx96f12.g1 WGS-SbicolorF (JM107 adap... 54 4e-005
gb|CW039194.1|CW039194 104_271_10505355_115_30388 Sorghum m... 54 4e-005
gb|CB928016.1|CB928016 ABA1_35_B03.g1_A012 Abscisic acid-tr... 50 6e-004
gb|CL153756.1|CL153756 104_338_10780938_116_31370_186 Sorgh... 48 0.002
gb|CL177249.1|CL177249 104_384_10893706_116_31916_154 Sorgh... 48 0.002
gb|CL177250.1|CL177250 104_384_10893706_148_31915_154 Sorgh... 48 0.002
gb|CL183871.1|CL183871 104_396_10898461_116_31924_301 Sorgh... 48 0.002
gb|CW021029.1|CW021029 104_109_10409304_116_30498 Sorghum m... 48 0.002
gb|CW061609.1|CW061609 104_305_10520491_114_30150 Sorghum m... 48 0.002
gb|CW066245.1|CW066245 104_313_10523584_115_30149 Sorghum m... 48 0.002
gb|CW103821.1|CW103821 104_472_11012095_116_34432_022 Sorgh... 48 0.002
gb|CW118872.1|CW118872 104_495_11108445_148_34700_087 Sorgh... 48 0.002
gb|CW176189.1|CW176189 104_589_11158356_148_36588_048 Sorgh... 48 0.002
gb|CW207098.1|CW207098 104_636_11187937_148_36967_013 Sorgh... 48 0.002
gb|CW220938.1|CW220938 104_655_11197629_148_37158_083 Sorgh... 48 0.002
gb|CW253236.1|CW253236 104_716_11224974_116_35105_019 Sorgh... 48 0.002
gb|CW275477.1|CW275477 104_748_11404985_148_35384_067 Sorgh... 48 0.002
gb|CW283411.1|CW283411 104_759_11409232_116_35478_050 Sorgh... 48 0.002
gb|CW283453.1|CW283453 104_759_11409255_148_35475_050 Sorgh... 48 0.002
gb|CW317443.1|CW317443 104_809_11473416_148_35864_092 Sorgh... 48 0.002
gb|CW333375.1|CW333375 104_831_11481907_148_36044_074 Sorgh... 48 0.002
gb|CW362112.1|CW362112 fsbb001f033a10f0 Sorghum methylation... 48 0.002
gb|CW406822.1|CW406822 fsbb001f100a12f0 Sorghum methylation... 48 0.002
gb|CW406823.1|CW406823 fsbb001f100a12k0 Sorghum methylation... 48 0.002
gb|CW410081.1|CW410081 fsbb001f104k19k0 Sorghum methylation... 48 0.002
gb|CW415696.1|CW415696 fsbb001f115o18f0 Sorghum methylation... 48 0.002
gb|CW432964.1|CW432964 fsbb001f147p15f0 Sorghum methylation... 48 0.002
gb|CW433153.1|CW433153 fsbb001f148d24k0 Sorghum methylation... 48 0.002
gb|CW436724.1|CW436724 fsbb001f153h16f0 Sorghum methylation... 48 0.002
gb|CW501082.1|CW501082 fsbb001f296l13k0 Sorghum methylation... 48 0.002
gb|AW678519.1|AW678519 WS1_16_A09.b1_A002 Water-stressed 1 ... 48 0.002
gb|BE358492.1|BE358492 DG1_30_E09.b1_A002 Dark Grown 1 (DG1... 48 0.002
gb|BE594074.1|BE594074 WS1_101_H05.b1_A002 Water-stressed 1... 48 0.002
gb|BF177265.1|BF177265 EM1_1_C01.b1_A002 Embryo 1 (EM1) Sor... 48 0.002
gb|BG462809.1|BG462809 EM1_45_H01.b1_A002 Embryo 1 (EM1) So... 48 0.002
gb|BG487477.1|BG487477 EM1_65_E06.b1_A002 Embryo 1 (EM1) So... 48 0.002
gb|BG556794.1|BG556794 EM1_38_F11.b1_A002 Embryo 1 (EM1) So... 48 0.002
gb|BM324999.1|BM324999 PIC1_38_E05.b1_A002 Pathogen-infecte... 48 0.002
gb|CD206399.1|CD206399 HS1_22_H09.g1_A012 Heat-shocked seed... 48 0.002
gb|CD211330.1|CD211330 HS1_59_D10.g1_A012 Heat-shocked seed... 48 0.002
gb|CD211692.1|CD211692 HS1_63_G09.g1_A012 Heat-shocked seed... 48 0.002
gb|CD213112.1|CD213112 HS1_28_C06.g1_A012 Heat-shocked seed... 48 0.002
gb|CD222882.1|CD222882 CCC1_24_G10.g1_A007 Callus culture/c... 48 0.002
gb|CD223169.1|CD223169 CCC1_26_H01.g1_A007 Callus culture/c... 48 0.002
gb|CD227619.1|CD227619 CCC1_52_F07.g1_A007 Callus culture/c... 48 0.002
gb|CF427156.1|CF427156 PH1_3_H11.g1_A002 Phosphorous-defici... 48 0.002
gb|CN124618.1|CN124618 RHOH1_5_H11.g1_A002 Acid- and alkali... 48 0.002
gb|CN134496.1|CN134496 OX1_26_E07.g1_A002 Oxidatively-stres... 48 0.002
gb|CN143484.1|CN143484 WOUND1_16_C05.g1_A002 Wounded leaves... 48 0.002
gb|CN148626.1|CN148626 WOUND1_57_F11.g1_A002 Wounded leaves... 48 0.002
gb|CL150683.1|CL150683 104_332_10778703_116_31358_255 Sorgh... 46 0.009
gb|CW301434.1|CW301434 104_785_11464199_116_36261_092 Sorgh... 46 0.009
gb|CW400098.1|CW400098 fsbb001f090e01f0 Sorghum methylation... 46 0.009
gb|BG649153.1|BG649153 EM1_56_H02.b1_A002 Embryo 1 (EM1) So... 46 0.009
gb|CD462731.1|CD462731 ETH1_39_H09.g1_A002 Ethylene-treated... 46 0.009
gb|CF431342.1|CF431342 NIT1_5_F07.g1_A002 Nitrogen-deficien... 46 0.009
gb|CN138774.1|CN138774 OX1_13_G09.g1_A002 Oxidatively-stres... 46 0.009
gb|BZ422441.1|BZ422441 id53g12.b1 WGS-SbicolorF (DH5a methy... 44 0.036
gb|CW048309.1|CW048309 104_286_10513285_115_30215 Sorghum m... 44 0.036
gb|CW063062.1|CW063062 104_308_10521693_5_30097 Sorghum met... 44 0.036
gb|CW088382.1|CW088382 104_433_10948137_116_32575_041 Sorgh... 44 0.036
gb|CW110217.1|CW110217 104_482_11103566_116_34510_049 Sorgh... 44 0.036
gb|CW155946.1|CW155946 104_558_11146412_116_36370_070 Sorgh... 44 0.036
gb|CW155947.1|CW155947 104_558_11146412_148_36369_070 Sorgh... 44 0.036
gb|CW175768.1|CW175768 104_588_11158125_148_36579_089 Sorgh... 44 0.036
gb|CW186524.1|CW186524 104_604_11166615_116_36709_056 Sorgh... 44 0.036
gb|CW405680.1|CW405680 fsbb001f098f15f0 Sorghum methylation... 44 0.036
gb|CW405681.1|CW405681 fsbb001f098f15k0 Sorghum methylation... 44 0.036
gb|CW405883.1|CW405883 fsbb001f098k04f0 Sorghum methylation... 44 0.036
gb|CW415904.1|CW415904 fsbb001f116d11f0 Sorghum methylation... 44 0.036
gb|AW744892.1|AW744892 LG1_384_H07.b1_A002 Light Grown 1 (L... 44 0.036
gb|AW744861.1|AW744861 LG1_384_H07.g1_A002 Light Grown 1 (L... 44 0.036
gb|CX614690.1|CX614690 GABR1_15_E05.g1_A002 GA- or brassino... 44 0.036
gb|BZ691344.1|BZ691344 SP__Ba0006M14.r SP__Ba Sorghum propi... 42 0.14
gb|BZ694046.1|BZ694046 SP__Ba0041P24.f SP__Ba Sorghum propi... 42 0.14
gb|CL194448.1|CL194448 104_418_10941642_116_32290_065 Sorgh... 42 0.14
gb|CW029995.1|CW029995 104_257_10499994_116_30402 Sorghum m... 42 0.14
gb|CW032823.1|CW032823 104_262_10501609_115_30362 Sorghum m... 42 0.14
gb|CW032909.1|CW032909 104_262_10501657_115_30362 Sorghum m... 42 0.14
gb|CW033358.1|CW033358 104_262_10501910_114_30361 Sorghum m... 42 0.14
gb|CW096630.1|CW096630 104_462_11002005_148_34352_089 Sorgh... 42 0.14
gb|CW098946.1|CW098946 104_465_11003283_116_34372_004 Sorgh... 42 0.14
gb|CW098947.1|CW098947 104_465_11003283_148_34368_004 Sorgh... 42 0.14
gb|CW105067.1|CW105067 104_474_11012732_148_34449_076 Sorgh... 42 0.14
gb|CW133556.1|CW133556 104_517_11116825_148_34814_009 Sorgh... 42 0.14
gb|CW148610.1|CW148610 104_547_11142045_116_35014_091 Sorgh... 42 0.14
gb|CW148611.1|CW148611 104_547_11142045_148_35010_091 Sorgh... 42 0.14
gb|CW153329.1|CW153329 104_555_11144989_116_36339_063 Sorgh... 42 0.14
gb|CW153510.1|CW153510 104_555_11145087_116_36339_060 Sorgh... 42 0.14
gb|CW168668.1|CW168668 104_578_11154268_116_36606_010 Sorgh... 42 0.14
gb|CW177808.1|CW177808 104_591_11159226_148_36613_075 Sorgh... 42 0.14
gb|CW182358.1|CW182358 104_597_11164029_116_36659_083 Sorgh... 42 0.14
gb|CW183357.1|CW183357 104_599_11164574_148_36673_059 Sorgh... 42 0.14
gb|CW213474.1|CW213474 104_645_11191570_116_37041_047 Sorgh... 42 0.14
gb|CW216854.1|CW216854 104_649_11195335_116_37461_018 Sorgh... 42 0.14
gb|CW218668.1|CW218668 104_652_11196312_116_37531_090 Sorgh... 42 0.14
gb|CW220763.1|CW220763 104_655_11197534_148_37454_087 Sorgh... 42 0.14
gb|CW229727.1|CW229727 104_671_11207464_148_37266_062 Sorgh... 42 0.14
gb|CW288892.1|CW288892 104_767_11412191_116_35543_088 Sorgh... 42 0.14
gb|CW288893.1|CW288893 104_767_11412191_148_35539_088 Sorgh... 42 0.14
gb|CW290058.1|CW290058 104_769_11412807_116_35555_062 Sorgh... 42 0.14
gb|CW301698.1|CW301698 104_785_11464337_148_36262_069 Sorgh... 42 0.14
gb|CW303633.1|CW303633 104_788_11465344_116_35692_060 Sorgh... 42 0.14
gb|CW318809.1|CW318809 104_811_11474150_148_35885_061 Sorgh... 42 0.14
gb|CW320049.1|CW320049 104_812_11474805_116_35886_081 Sorgh... 42 0.14
gb|CW320050.1|CW320050 104_812_11474805_148_35890_081 Sorgh... 42 0.14
gb|CW358362.1|CW358362 fsbb001f025h14f0 Sorghum methylation... 42 0.14
gb|CW358363.1|CW358363 fsbb001f025h14k0 Sorghum methylation... 42 0.14
gb|CW384934.1|CW384934 fsbb001f068d05f0 Sorghum methylation... 42 0.14
gb|CW394783.1|CW394783 fsbb001f082i17k0 Sorghum methylation... 42 0.14
gb|CW421710.1|CW421710 fsbb001f130k11f0 Sorghum methylation... 42 0.14
gb|CW427017.1|CW427017 fsbb001f138m10k0 Sorghum methylation... 42 0.14
gb|CW430849.1|CW430849 fsbb001f144m02k0 Sorghum methylation... 42 0.14
gb|CW431604.1|CW431604 fsbb001f145o06f0 Sorghum methylation... 42 0.14
gb|CW445809.1|CW445809 fsbb001f171c17k0 Sorghum methylation... 42 0.14
gb|CW450096.1|CW450096 fsbb001f188i23k0 Sorghum methylation... 42 0.14
gb|CW454791.1|CW454791 fsbb001f199g12k0 Sorghum methylation... 42 0.14
gb|CW459279.1|CW459279 fsbb001f205p01f0 Sorghum methylation... 42 0.14
gb|CW459280.1|CW459280 fsbb001f205p01k0 Sorghum methylation... 42 0.14
gb|CW465911.1|CW465911 fsbb001f216o04f0 Sorghum methylation... 42 0.14
gb|CW473765.1|CW473765 fsbb001f229e17f0 Sorghum methylation... 42 0.14
gb|CW477765.1|CW477765 fsbb001f235e06k0 Sorghum methylation... 42 0.14
gb|CW478664.1|CW478664 fsbb001f236k11k0 Sorghum methylation... 42 0.14
gb|CW480559.1|CW480559 fsbb001f239k24f0 Sorghum methylation... 42 0.14
gb|CW480560.1|CW480560 fsbb001f239k24k0 Sorghum methylation... 42 0.14
gb|CW483703.1|CW483703 fsbb001f245h12k0 Sorghum methylation... 42 0.14
gb|CW496487.1|CW496487 fsbb001f288m08k0 Sorghum methylation... 42 0.14
gb|CW785005.1|CW785005 SP__Ba0006M14.r SP__Ba Sorghum propi... 42 0.14
gb|CW788132.1|CW788132 SP__Ba0041P24.f SP__Ba Sorghum propi... 42 0.14
gb|CL699804.2|CL699804 SP__Ba0052L24.r SP__Ba Sorghum propi... 42 0.14
gb|BG051032.1|BG051032 FM1_55_D11.b1_A003 Floral-Induced Me... 42 0.14
gb|BG053681.1|BG053681 RHIZ2_8_D09.b1_A003 Rhizome2 (RHIZ2)... 42 0.14
gb|BG104122.1|BG104122 RHIZ2_40_G09.b1_A003 Rhizome2 (RHIZ2... 42 0.14
gb|BI139896.1|BI139896 IP1_47_B06.b1_A002 Immature pannicle... 42 0.14
gb|CB928724.1|CB928724 ABA1_17_G10.g1_A012 Abscisic acid-tr... 42 0.14
gb|CD209734.1|CD209734 HS1_54_F01.g1_A012 Heat-shocked seed... 42 0.14
gb|CD229885.1|CD229885 CCC1_20_D06.g1_A007 Callus culture/c... 42 0.14
gb|CD235314.1|CD235314 SS1_28_F11.g1_A012 Salt-stressed see... 42 0.14
gb|CD235351.1|CD235351 SS1_28_B01.g1_A012 Salt-stressed see... 42 0.14
gb|CD423165.1|CD423165 SA1_27_H10.g1_A002 Salicylic acid-tr... 42 0.14
gb|CD424148.1|CD424148 SA1_3_D09.g1_A002 Salicylic acid-tre... 42 0.14
gb|CD427446.1|CD427446 SA1_30_F09.g1_A002 Salicylic acid-tr... 42 0.14
gb|CD428598.1|CD428598 ETH1_27_B10.g1_A002 Ethylene-treated... 42 0.14
gb|CD432201.1|CD432201 ETH1_26_F01.g1_A002 Ethylene-treated... 42 0.14
gb|CF072604.1|CF072604 FE1_3_H10.g1_A002 Iron-deficient see... 42 0.14
gb|CF073873.1|CF073873 FE1_12_F10.g1_A002 Iron-deficient se... 42 0.14
gb|CF426925.1|CF426925 PH1_2_B05.g1_A002 Phosphorous-defici... 42 0.14
gb|CF428413.1|CF428413 PH1_14_F02.g1_A002 Phosphorous-defic... 42 0.14
gb|CF485887.1|CF485887 POL1_34_G06.b1_A002 Pollen Sorghum b... 42 0.14
gb|CF487913.1|CF487913 POL1_46_D12.g1_A002 Pollen Sorghum b... 42 0.14
gb|CN130206.1|CN130206 RHOH1_40_A08.b1_A002 Acid- and alkal... 42 0.14
gb|CN147693.1|CN147693 WOUND1_51_C01.g1_A002 Wounded leaves... 42 0.14
gb|CX610090.1|CX610090 ANR1_16_C06.g1_A002 Anaerobic roots ... 42 0.14
gb|AF010283.1| Sorghum bicolor ADP-glucose pyrophosphorylas... 42 0.14
>gb|AW672118.1|AW672118 LG1_357_F09.b1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 547
Score = 706 bits (356), Expect = 0.0
Identities = 431/456 (94%)
Strand = Plus / Plus
Query: 144 accgccgtgacgtgggcaagatgaagcacgggtgcgagcattaccggcggaggtgcaaga 203
||||||| ||||| ||||||||| ||||||||||||||||||||||||| ||||||||||
Sbjct: 92 accgccgcgacgtcggcaagatggagcacgggtgcgagcattaccggcgcaggtgcaaga 151
Query: 204 tcgtggcaccgtgctgcaaccaggtgttcccctgccgccactgccacaacgaggctacgg 263
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 152 tcgtggcgccgtgctgcaaccaggtgttcccctgccgccactgccacaacgaggctacgg 211
Query: 264 cttccggagataggcatacaatatgtcgtcaggatgttgaaaaagtagtttgcctactct 323
|||| |||||| ||||||||||| ||||||||||||| |||||||||||||||||||||
Sbjct: 212 cttctggagatcggcatacaatagttcgtcaggatgttaaaaaagtagtttgcctactct 271
Query: 324 gtgaaacaaaacagccggtgtcacaagtgtgcataagctgtggagtcaatatgggagagt 383
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 272 gtgaaacagaacagccggtgtcacaagtgtgcataagctgtggagtcaatatgggagagt 331
Query: 384 acttttgtgatatatgcaaattttatgatgatgatacagacaaagggcagtaccattgca 443
|||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||
Sbjct: 332 acttctgtgatatatgcaaattttatgatgatgatatagggaaagggcagtaccattgca 391
Query: 444 tcgattgtggcatatgcagggttggtggcaaggaaaacttcttccactgtgtgaagtgtg 503
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||
Sbjct: 392 atgattgtggcatatgcagggttggtggcaaggaaaaattcttccactgtgtaaagtgtg 451
Query: 504 ggtcctgctattctgttatactccgtgataaccatcagtgtgtggagaactcaatgaggc 563
|||| |||||||||||| ||| ||||||||||||| ||| |||||||||||||||||||
Sbjct: 452 ggtcttgctattctgttgaactgcgtgataaccatcggtgcgtggagaactcaatgaggc 511
Query: 564 agaattgcccaatctgttatgagtatctatttgact 599
||||||||||||||||||||||||||||||||||||
Sbjct: 512 agaattgcccaatctgttatgagtatctatttgact 547
Score = 89.7 bits (45), Expect = 7e-016
Identities = 51/53 (96%)
Strand = Plus / Plus
Query: 58 gccgccgccgccggggatggggggagcgcaattccccggcgacaacgacgtcg 110
|||||||||||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 9 gccgccgccgccggggatggggggagcgcagttcctcggcgacaacgacgtcg 61
>gb|CN132016.1|CN132016 OX1_3_C11.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_3_C11_A002 5', mRNA sequence
Length = 706
Score = 642 bits (324), Expect = 0.0
Identities = 384/404 (95%)
Strand = Plus / Plus
Query: 558 tgaggcagaattgcccaatctgttatgagtatctatttgactcattacaaggaacaagag 617
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 tgaggcagaattgcccaatctgttatgagtatctatttgactcattacaaggaacaagag 60
Query: 618 ttctgaactgtggacacacaatgcacttgacatgttttgaagaaatggtggcgcataaca 677
|||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||
Sbjct: 61 ttcttaactgtggacacacaatgcacttgacatgttttgaagagatggtggagcataaca 120
Query: 678 aatacacttgtccaatatgctctaaaacagctcttgatttgacacatcattgggaaatgt 737
|||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||||
Sbjct: 121 aatacacttgtccaatatgctctaaaacagctcttgatatgacacgtcattgggagatgt 180
Query: 738 tggatcaagagatcgaagccacgatcatgcctcttgtgtatcgctacaagatttgggtgc 797
|||||||||||||||||||||| |||||||||| ||| ||||| ||||||||||||||||
Sbjct: 181 tggatcaagagatcgaagccacaatcatgcctcctgtatatcggtacaagatttgggtgc 240
Query: 798 tttgcaacgattgcaacaaggtctcagaggtgaactttcacgtgattggccacaagtgca 857
|||||||||| |||||||||||||||||||||||||| || ||||| |||||||||||||
Sbjct: 241 tttgcaacgactgcaacaaggtctcagaggtgaacttccatgtgatcggccacaagtgca 300
Query: 858 gccactgcagatcgtacaacacccgaacaacatcgcgccctgcagatttatccggaagca 917
|||||||||| ||||||||||||||| ||||||||||||||||||||| ||| |||||||
Sbjct: 301 gccactgcagctcgtacaacacccgatcaacatcgcgccctgcagattcatcgggaagca 360
Query: 918 gctcaccttcaacagactcatccgacaacaacatatagagaaga 961
|||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 361 gctcaccttcgacagactcatccgacaacaacatgtagagaaga 404
Score = 111 bits (56), Expect = 2e-022
Identities = 124/146 (84%), Gaps = 3/146 (2%)
Strand = Plus / Plus
Query: 1017 ggcgtgcgtgcttgccaaacttgaagactcccagccgtttattggccctcatcttgtcta 1076
||||||||||| |||||||||||||||||||||||| |||||| |||||| | ||||| |
Sbjct: 466 ggcgtgcgtgcctgccaaacttgaagactcccagccatttatttgccctcgttttgtcaa 525
Query: 1077 gattcagttcattccatgagtctttgctgttgtggcaacttccagcttgcgcatcgctgg 1136
||||| ||| |||||||||||| ||||| |||| || ||||||||| |||| |||||
Sbjct: 526 gattcgactcaatccatgagtcttggctgtcgtgggaaattccagcttcggcattgctgg 585
Query: 1137 gtcaacaacccacatggccggcgtag 1162
|| ||||||||||||| ||||||
Sbjct: 586 gt---taacccacatggccagcgtag 608
>gb|BM322277.1|BM322277 PIC1_2_E03.b1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 535
Score = 426 bits (215), Expect = e-117
Identities = 266/283 (93%)
Strand = Plus / Plus
Query: 679 atacacttgtccaatatgctctaaaacagctcttgatttgacacatcattgggaaatgtt 738
||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||
Sbjct: 9 atacacttgtccaatatgctctaaaacagctcttgatatgacacgtcattgggagatgtt 68
Query: 739 ggatcaagagatcgaagccacgatcatgcctcttgtgtatcgctacaagatttgggtgct 798
||||||||||||||||||||| |||||||||| ||| ||||| |||||||||||||||||
Sbjct: 69 ggatcaagagatcgaagccacaatcatgcctcctgtatatcggtacaagatttgggtgct 128
Query: 799 ttgcaacgattgcaacaaggtctcagaggtgaactttcacgtgattggccacaagtgcag 858
||||||||| |||||||||||||||||||||||||| || ||||| ||||||||||||||
Sbjct: 129 ttgcaacgactgcaacaaggtctcagaggtgaacttccatgtgatcggccacaagtgcag 188
Query: 859 ccactgcagatcgtacaacacccgaacaacatcgcgccctgcagatttatccggaagcag 918
||||||||| ||||||||||||||| ||||||||||||||||||||| ||| ||||||||
Sbjct: 189 ccactgcagctcgtacaacacccgatcaacatcgcgccctgcagattcatcgggaagcag 248
Query: 919 ctcaccttcaacagactcatccgacaacaacatatagagaaga 961
||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 249 ctcaccttcgacagactcatccgacaacaacatgtagagaaga 291
Score = 121 bits (61), Expect = 2e-025
Identities = 135/159 (84%), Gaps = 3/159 (1%)
Strand = Plus / Plus
Query: 1004 aacattgtttcggggcgtgcgtgcttgccaaacttgaagactcccagccgtttattggcc 1063
|||||||||| | ||||||||||| |||||||||||||||||||||||| |||||| |||
Sbjct: 339 aacattgttttgcggcgtgcgtgcctgccaaacttgaagactcccagccatttatttgcc 398
Query: 1064 ctcatcttgtctagattcagttcattccatgagtctttgctgttgtggcaacttccagct 1123
||| | ||||| |||||| ||| |||||||||||| ||||| |||| || ||||||||
Sbjct: 399 ctcgttttgtcaagattcgactcaatccatgagtcttggctgtcgtgggaaattccagct 458
Query: 1124 tgcgcatcgctgggtcaacaacccacatggccggcgtag 1162
| |||| ||||||| ||||||||||||| ||||||
Sbjct: 459 tcggcattgctgggt---taacccacatggccagcgtag 494
>gb|BG463420.1|BG463420 EM1_49_C05.b1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 493
Score = 252 bits (127), Expect = 8e-065
Identities = 157/167 (94%)
Strand = Plus / Plus
Query: 144 accgccgtgacgtgggcaagatgaagcacgggtgcgagcattaccggcggaggtgcaaga 203
||||||| ||||| ||||||||| ||||||||||||||||||||||||| ||||||||||
Sbjct: 174 accgccgcgacgtcggcaagatggagcacgggtgcgagcattaccggcgcaggtgcaaga 233
Query: 204 tcgtggcaccgtgctgcaaccaggtgttcccctgccgccactgccacaacgaggctacgg 263
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 234 tcgtggcgccgtgctgcaaccaggtgttcccctgccgccactgccacaacgaggctacgg 293
Query: 264 cttccggagataggcatacaatatgtcgtcaggatgttgaaaaagta 310
|||| |||||| ||||||||||| ||||||||||||| ||||||||
Sbjct: 294 cttctggagatcggcatacaatagttcgtcaggatgttaaaaaagta 340
Score = 141 bits (71), Expect = 2e-031
Identities = 103/113 (91%), Gaps = 3/113 (2%)
Strand = Plus / Plus
Query: 1 tggacgccccttatcgccctcgttatttacatctctgccaccctcctctccgccg---tc 57
|||| |||||| | |||||||| |||||||||| ||||||||||||||||||||| ||
Sbjct: 31 tggaggcccctgaccgccctcgctatttacatccctgccaccctcctctccgccgccgtc 90
Query: 58 gccgccgccgccggggatggggggagcgcaattccccggcgacaacgacgtcg 110
|||||||||||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 91 gccgccgccgccggggatggggggagcgcagttcctcggcgacaacgacgtcg 143
Score = 61.9 bits (31), Expect = 2e-007
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 308 gtagtttgcctactctgtgaaacaaaacagccggt 342
|||||||||||||||||||||||| ||||||||||
Sbjct: 432 gtagtttgcctactctgtgaaacagaacagccggt 466
>gb|CL166462.1|CL166462 104_362_10809392_114_31798_224 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10809392, DNA
sequence
Length = 734
Score = 163 bits (82), Expect = 6e-038
Identities = 88/90 (97%)
Strand = Plus / Plus
Query: 174 ggtgcgagcattaccggcggaggtgcaagatcgtggcaccgtgctgcaaccaggtgttcc 233
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||
Sbjct: 474 ggtgcgagcattaccggcgcaggtgcaagatcgtggcgccgtgctgcaaccaggtgttcc 533
Query: 234 cctgccgccactgccacaacgaggctacgg 263
||||||||||||||||||||||||||||||
Sbjct: 534 cctgccgccactgccacaacgaggctacgg 563
Score = 141 bits (71), Expect = 2e-031
Identities = 103/113 (91%), Gaps = 3/113 (2%)
Strand = Plus / Plus
Query: 1 tggacgccccttatcgccctcgttatttacatctctgccaccctcctctccgc---cgtc 57
|||| |||||| | |||||||| |||||||||| ||||||||||||||||||| ||||
Sbjct: 45 tggaggcccctgaccgccctcgctatttacatccctgccaccctcctctccgccgccgtc 104
Query: 58 gccgccgccgccggggatggggggagcgcaattccccggcgacaacgacgtcg 110
|||||||||||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 105 gccgccgccgccggggatggggggagcgcagttcctcggcgacaacgacgtcg 157
>gb|CL166463.1|CL166463 104_362_10809392_116_31799_224 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10809392, DNA
sequence
Length = 701
Score = 163 bits (82), Expect = 6e-038
Identities = 88/90 (97%)
Strand = Plus / Minus
Query: 174 ggtgcgagcattaccggcggaggtgcaagatcgtggcaccgtgctgcaaccaggtgttcc 233
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||
Sbjct: 668 ggtgcgagcattaccggcgcaggtgcaagatcgtggcgccgtgctgcaaccaggtgttcc 609
Query: 234 cctgccgccactgccacaacgaggctacgg 263
||||||||||||||||||||||||||||||
Sbjct: 608 cctgccgccactgccacaacgaggctacgg 579
>gb|CW326410.1|CW326410 104_821_11478202_116_36065_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11478202, DNA
sequence
Length = 642
Score = 163 bits (82), Expect = 6e-038
Identities = 88/90 (97%)
Strand = Plus / Minus
Query: 174 ggtgcgagcattaccggcggaggtgcaagatcgtggcaccgtgctgcaaccaggtgttcc 233
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||
Sbjct: 373 ggtgcgagcattaccggcgcaggtgcaagatcgtggcgccgtgctgcaaccaggtgttcc 314
Query: 234 cctgccgccactgccacaacgaggctacgg 263
||||||||||||||||||||||||||||||
Sbjct: 313 cctgccgccactgccacaacgaggctacgg 284
>gb|CW326411.1|CW326411 104_821_11478202_148_36064_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11478202, DNA
sequence
Length = 615
Score = 157 bits (79), Expect = 3e-036
Identities = 87/90 (96%)
Strand = Plus / Plus
Query: 174 ggtgcgagcattaccggcggaggtgcaagatcgtggcaccgtgctgcaaccaggtgttcc 233
||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||
Sbjct: 489 ggtgcgagcattaccggcgcangtgcaagatcgtggcgccgtgctgcaaccaggtgttcc 548
Query: 234 cctgccgccactgccacaacgaggctacgg 263
||||||||||||||||||||||||||||||
Sbjct: 549 cctgccgccactgccacaacgaggctacgg 578
Score = 141 bits (71), Expect = 2e-031
Identities = 103/113 (91%), Gaps = 3/113 (2%)
Strand = Plus / Plus
Query: 1 tggacgccccttatcgccctcgttatttacatctctgccaccctcctctccgcc---gtc 57
|||| |||||| | |||||||| |||||||||| |||||||||||||||||||| |||
Sbjct: 60 tggaggcccctgaccgccctcgctatttacatccctgccaccctcctctccgccgccgtc 119
Query: 58 gccgccgccgccggggatggggggagcgcaattccccggcgacaacgacgtcg 110
|||||||||||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 120 gccgccgccgccggggatggggggagcgcagttcctcggcgacaacgacgtcg 172
>gb|CW039193.1|CW039193 104_271_10505355_114_30387 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10505355, DNA
sequence
Length = 566
Score = 141 bits (71), Expect = 2e-031
Identities = 103/113 (91%), Gaps = 3/113 (2%)
Strand = Plus / Plus
Query: 1 tggacgccccttatcgccctcgttatttacatctctgccaccctcctctccgccg---tc 57
|||| |||||| | |||||||| |||||||||| ||||||||||||||||||||| ||
Sbjct: 123 tggaggcccctgaccgccctcgctatttacatccctgccaccctcctctccgccgccgtc 182
Query: 58 gccgccgccgccggggatggggggagcgcaattccccggcgacaacgacgtcg 110
|||||||||||||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 183 gccgccgccgccggggatggggggagcgcagttcctcggcgacaacgacgtcg 235
>gb|BM326763.1|BM326763 PIC1_2_E03.g1_A002 Pathogen-infected compatible 1 (PIC1) Sorghum
bicolor cDNA, mRNA sequence
Length = 586
Score = 125 bits (63), Expect = 1e-026
Identities = 78/83 (93%)
Strand = Plus / Plus
Query: 879 cccgaacaacatcgcgccctgcagatttatccggaagcagctcaccttcaacagactcat 938
||||| ||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||
Sbjct: 1 cccgatcaacatcgcgccctgcagattcatcgggaagcagctcaccttcgacagactcat 60
Query: 939 ccgacaacaacatatagagaaga 961
||||||||||||| |||||||||
Sbjct: 61 ccgacaacaacatgtagagaaga 83
Score = 121 bits (61), Expect = 2e-025
Identities = 135/159 (84%), Gaps = 3/159 (1%)
Strand = Plus / Plus
Query: 1004 aacattgtttcggggcgtgcgtgcttgccaaacttgaagactcccagccgtttattggcc 1063
|||||||||| | ||||||||||| |||||||||||||||||||||||| |||||| |||
Sbjct: 131 aacattgttttgcggcgtgcgtgcctgccaaacttgaagactcccagccatttatttgcc 190
Query: 1064 ctcatcttgtctagattcagttcattccatgagtctttgctgttgtggcaacttccagct 1123
||| | ||||| |||||| ||| |||||||||||| ||||| |||| || ||||||||
Sbjct: 191 ctcgttttgtcaagattcgactcaatccatgagtcttggctgtcgtgggaaattccagct 250
Query: 1124 tgcgcatcgctgggtcaacaacccacatggccggcgtag 1162
| |||| ||||||| ||||||||||||| ||||||
Sbjct: 251 tcggcattgctgggt---taacccacatggccagcgtag 286
>gb|BG463500.1|BG463500 EM1_49_C05.g1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA sequence
Length = 394
Score = 121 bits (61), Expect = 2e-025
Identities = 135/159 (84%), Gaps = 3/159 (1%)
Strand = Plus / Plus
Query: 1004 aacattgtttcggggcgtgcgtgcttgccaaacttgaagactcccagccgtttattggcc 1063
|||||||||| | ||||||||||| |||||||||||||||||||||||| |||||| |||
Sbjct: 23 aacattgttttgcggcgtgcgtgcgtgccaaacttgaagactcccagccatttatttgcc 82
Query: 1064 ctcatcttgtctagattcagttcattccatgagtctttgctgttgtggcaacttccagct 1123
||| | ||||| |||||| ||| |||||||||||| ||||| |||| || ||||||||
Sbjct: 83 ctcgttttgtcaagattcgactcaatccatgagtcttggctgtcgtgggaaattccagct 142
Query: 1124 tgcgcatcgctgggtcaacaacccacatggccggcgtag 1162
|| |||| | ||||| ||||||||||||| ||||||
Sbjct: 143 tgggcattgatgggt---taacccacatggccagcgtag 178
>gb|CN131930.1|CN131930 OX1_3_C11.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_3_C11_A002 3', mRNA sequence
Length = 526
Score = 121 bits (61), Expect = 2e-025
Identities = 135/159 (84%), Gaps = 3/159 (1%)
Strand = Plus / Plus
Query: 1004 aacattgtttcggggcgtgcgtgcttgccaaacttgaagactcccagccgtttattggcc 1063
|||||||||| | ||||||||||| |||||||||||||||||||||||| |||||| |||
Sbjct: 71 aacattgttttgcggcgtgcgtgcctgccaaacttgaagactcccagccatttatttgcc 130
Query: 1064 ctcatcttgtctagattcagttcattccatgagtctttgctgttgtggcaacttccagct 1123
||| | ||||| |||||| ||| |||||||||||| ||||| |||| || ||||||||
Sbjct: 131 ctcgttttgtcaagattcgactcaatccatgagtcttggctgtcgtgggaaattccagct 190
Query: 1124 tgcgcatcgctgggtcaacaacccacatggccggcgtag 1162
| |||| ||||||| ||||||||||||| ||||||
Sbjct: 191 tcggcattgctgggt---taacccacatggccagcgtag 226
>gb|CW176188.1|CW176188 104_589_11158356_116_36589_048 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11158356, DNA
sequence
Length = 710
Score = 117 bits (59), Expect = 3e-024
Identities = 74/79 (93%)
Strand = Plus / Minus
Query: 340 ggtgtcacaagtgtgcataagctgtggagtcaatatgggagagtacttttgtgatatatg 399
||||||| ||||||||||| |||||||||||||||||||||||||||| ||||||| |||
Sbjct: 474 ggtgtcataagtgtgcataggctgtggagtcaatatgggagagtacttctgtgatacatg 415
Query: 400 caaattttatgatgatgat 418
||||||||||| |||||||
Sbjct: 414 caaattttatggtgatgat 396
Score = 61.9 bits (31), Expect = 2e-007
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 425 aaagggcagtaccattgcatcgattgtggcatatgcagg 463
|||||| ||||||||||||||||||||| ||||||||||
Sbjct: 304 aaagggtagtaccattgcatcgattgtgccatatgcagg 266
Score = 60.0 bits (30), Expect = 6e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 460 cagggttggtggcaaggaaaacttcttccactgt 493
||||||||||||||||||||| ||||||||||||
Sbjct: 194 cagggttggtggcaaggaaaatttcttccactgt 161
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 308 gtagtttgcctactctgtgaaacaaaacagcc 339
||||||||||||||||||||| || |||||||
Sbjct: 596 gtagtttgcctactctgtgaatcagaacagcc 565
>gb|BG411541.1|BG411541 EM1_57_E04.b1_A002 Embryo 1 (EM1) Sorghum bicolor cDNA, mRNA
sequence
Length = 126
Score = 113 bits (57), Expect = 5e-023
Identities = 86/95 (90%), Gaps = 3/95 (3%)
Strand = Plus / Plus
Query: 1 tggacgccccttatcgccctcgttatttacatctctgccaccctcctct---ccgccgtc 57
|||| |||||| | |||||||| |||||||||| ||||||||||||||| ||||||||
Sbjct: 31 tggaggcccctgaccgccctcgctatttacatccctgccaccctcctctccgccgccgtc 90
Query: 58 gccgccgccgccggggatggggggagcgcaattcc 92
|||||||||||||||||||||||||||||| ||||
Sbjct: 91 gccgccgccgccggggatggggggagcgcagttcc 125
>gb|CW235057.1|CW235057 104_690_11214777_116_37407_043 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214777, DNA
sequence
Length = 695
Score = 63.9 bits (32), Expect = 4e-008
Identities = 60/69 (86%), Gaps = 4/69 (5%)
Strand = Plus / Plus
Query: 174 ggtgcgagcattaccggcggaggt----gcaagatcgtggcaccgtgctgcaaccaggtg 229
||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||
Sbjct: 485 ggtgcgagcattaccggcggaggcctgcgcaagatcgtggtgccgtgctgcaacctggtg 544
Query: 230 ttcccctgc 238
||||||||
Sbjct: 545 ctcccctgc 553
Score = 60.0 bits (30), Expect = 6e-007
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 121 cgcggcccgcgacggagaggtggaccgccgtgacgtgggcaa 162
||||||||||||||| ||||| |||||||| |||||||||||
Sbjct: 137 cgcggcccgcgacggggaggtcgaccgccgcgacgtgggcaa 178
>gb|CW235058.1|CW235058 104_690_11214777_148_37411_043 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11214777, DNA
sequence
Length = 673
Score = 63.9 bits (32), Expect = 4e-008
Identities = 60/69 (86%), Gaps = 4/69 (5%)
Strand = Plus / Minus
Query: 174 ggtgcgagcattaccggcggaggt----gcaagatcgtggcaccgtgctgcaaccaggtg 229
||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||
Sbjct: 267 ggtgcgagcattaccggcggaggcctgcgcaagatcgtggtgccgtgctgcaacctggtg 208
Query: 230 ttcccctgc 238
||||||||
Sbjct: 207 ctcccctgc 199
Score = 60.0 bits (30), Expect = 6e-007
Identities = 39/42 (92%)
Strand = Plus / Minus
Query: 121 cgcggcccgcgacggagaggtggaccgccgtgacgtgggcaa 162
||||||||||||||| ||||| |||||||| |||||||||||
Sbjct: 615 cgcggcccgcgacggggaggtcgaccgccgcgacgtgggcaa 574
>gb|CW259825.1|CW259825 104_726_11228639_148_35188_092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11228639, DNA
sequence
Length = 550
Score = 63.9 bits (32), Expect = 4e-008
Identities = 60/69 (86%), Gaps = 4/69 (5%)
Strand = Plus / Minus
Query: 174 ggtgcgagcattaccggcggaggt----gcaagatcgtggcaccgtgctgcaaccaggtg 229
||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||
Sbjct: 271 ggtgcgagcattaccggcggaggcctgcgcaagatcgtggtgccgtgctgcaacctggtg 212
Query: 230 ttcccctgc 238
||||||||
Sbjct: 211 ctcccctgc 203
>gb|CW295542.1|CW295542 104_776_11460984_148_35613_082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11460984, DNA
sequence
Length = 610
Score = 63.9 bits (32), Expect = 4e-008
Identities = 60/69 (86%), Gaps = 4/69 (5%)
Strand = Plus / Minus
Query: 174 ggtgcgagcattaccggcggaggt----gcaagatcgtggcaccgtgctgcaaccaggtg 229
||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||
Sbjct: 204 ggtgcgagcattaccggcggaggcctgcgcaagatcgtggtgccgtgctgcaacctggtg 145
Query: 230 ttcccctgc 238
||||||||
Sbjct: 144 ctcccctgc 136
Score = 60.0 bits (30), Expect = 6e-007
Identities = 39/42 (92%)
Strand = Plus / Minus
Query: 121 cgcggcccgcgacggagaggtggaccgccgtgacgtgggcaa 162
||||||||||||||| ||||| |||||||| |||||||||||
Sbjct: 552 cgcggcccgcgacggggaggtcgaccgccgcgacgtgggcaa 511
>gb|CW465986.1|CW465986 fsbb001f217a05k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f217a05, DNA
sequence
Length = 203
Score = 63.9 bits (32), Expect = 4e-008
Identities = 60/69 (86%), Gaps = 4/69 (5%)
Strand = Plus / Minus
Query: 174 ggtgcgagcattaccggcggaggt----gcaagatcgtggcaccgtgctgcaaccaggtg 229
||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||
Sbjct: 165 ggtgcgagcattaccggcggaggcctgcgcaagatcgtggtgccgtgctgcaacctggtg 106
Query: 230 ttcccctgc 238
||||||||
Sbjct: 105 ctcccctgc 97
>gb|CW495001.1|CW495001 fsbb001f286i24k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f286i24, DNA
sequence
Length = 673
Score = 63.9 bits (32), Expect = 4e-008
Identities = 60/69 (86%), Gaps = 4/69 (5%)
Strand = Plus / Minus
Query: 174 ggtgcgagcattaccggcggaggt----gcaagatcgtggcaccgtgctgcaaccaggtg 229
||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||
Sbjct: 129 ggtgcgagcattaccggcggaggcctgcgcaagatcgtggtgccgtgctgcaacctggtg 70
Query: 230 ttcccctgc 238
||||||||
Sbjct: 69 ctcccctgc 61
Score = 60.0 bits (30), Expect = 6e-007
Identities = 39/42 (92%)
Strand = Plus / Minus
Query: 121 cgcggcccgcgacggagaggtggaccgccgtgacgtgggcaa 162
||||||||||||||| ||||| |||||||| |||||||||||
Sbjct: 477 cgcggcccgcgacggggaggtcgaccgccgcgacgtgggcaa 436
>gb|CW070237.1|CW070237 104_321_10526627_1_30090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10526627, DNA
sequence
Length = 630
Score = 60.0 bits (30), Expect = 6e-007
Identities = 39/42 (92%)
Strand = Plus / Minus
Query: 121 cgcggcccgcgacggagaggtggaccgccgtgacgtgggcaa 162
||||||||||||||| ||||| |||||||| |||||||||||
Sbjct: 273 cgcggcccgcgacggggaggtcgaccgccgcgacgtgggcaa 232
>gb|CW259824.1|CW259824 104_726_11228639_116_35192_092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11228639, DNA
sequence
Length = 560
Score = 60.0 bits (30), Expect = 6e-007
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 121 cgcggcccgcgacggagaggtggaccgccgtgacgtgggcaa 162
||||||||||||||| ||||| |||||||| |||||||||||
Sbjct: 279 cgcggcccgcgacggggaggtcgaccgccgcgacgtgggcaa 320
>gb|CW495000.1|CW495000 fsbb001f286i24f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f286i24, DNA
sequence
Length = 693
Score = 60.0 bits (30), Expect = 6e-007
Identities = 39/42 (92%)
Strand = Plus / Plus
Query: 121 cgcggcccgcgacggagaggtggaccgccgtgacgtgggcaa 162
||||||||||||||| ||||| |||||||| |||||||||||
Sbjct: 430 cgcggcccgcgacggggaggtcgaccgccgcgacgtgggcaa 471
>gb|BE592920.1|BE592920 WS1_92_A12.b1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 533
Score = 56.0 bits (28), Expect = 9e-006
Identities = 70/84 (83%)
Strand = Plus / Plus
Query: 430 gcagtaccattgcatcgattgtggcatatgcagggttggtggcaaggaaaacttcttcca 489
||||| ||||||| |||||| ||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 158 gcagttccattgcgacgattgcggcatctgcagagtcggtggaaaggacaacttcttcca 217
Query: 490 ctgtgtgaagtgtgggtcctgcta 513
||| |||||||| ||||||||
Sbjct: 218 ctgccaaaagtgtggatcctgcta 241
>gb|BG933249.1|BG933249 WS1_92_A12.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 740
Score = 56.0 bits (28), Expect = 9e-006
Identities = 70/84 (83%)
Strand = Plus / Plus
Query: 430 gcagtaccattgcatcgattgtggcatatgcagggttggtggcaaggaaaacttcttcca 489
||||| ||||||| |||||| ||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 46 gcagttccattgcgacgattgcggcatctgcagagtcggtggaaaggacaacttcttcca 105
Query: 490 ctgtgtgaagtgtgggtcctgcta 513
||| |||||||| ||||||||
Sbjct: 106 ctgccaaaagtgtggatcctgcta 129
>gb|BZ335282.1|BZ335282 hx96f12.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone hx96f12 5', DNA sequence
Length = 628
Score = 54.0 bits (27), Expect = 4e-005
Identities = 27/27 (100%)
Strand = Plus / Plus
Query: 1406 tcttatatctatacctaataataaaga 1432
|||||||||||||||||||||||||||
Sbjct: 457 tcttatatctatacctaataataaaga 483
>gb|CW039194.1|CW039194 104_271_10505355_115_30388 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10505355, DNA
sequence
Length = 652
Score = 54.0 bits (27), Expect = 4e-005
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 237 gccgccactgccacaacgaggctacgg 263
|||||||||||||||||||||||||||
Sbjct: 652 gccgccactgccacaacgaggctacgg 626
>gb|CB928016.1|CB928016 ABA1_35_B03.g1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_35_B03_A012 5', mRNA sequence
Length = 427
Score = 50.1 bits (25), Expect = 6e-004
Identities = 72/88 (81%)
Strand = Plus / Plus
Query: 168 agcacgggtgcgagcattaccggcggaggtgcaagatcgtggcaccgtgctgcaaccagg 227
||||||| |||| ||||||| | || |||||| ||||||| || |||||| |||||
Sbjct: 216 agcacggntgcgcgcattacagccgtgggtgcatcgtcgtggcgccctgctgcggccagg 275
Query: 228 tgttcccctgccgccactgccacaacga 255
| ||| |||||||||| |||||||||||
Sbjct: 276 tcttcgcctgccgccattgccacaacga 303
>gb|CL153756.1|CL153756 104_338_10780938_116_31370_186 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10780938, DNA
sequence
Length = 727
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 416 tatatctatacctaataataaaga 439
>gb|CL177249.1|CL177249 104_384_10893706_116_31916_154 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10893706, DNA
sequence
Length = 700
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 233 tatatctatacctaataataaaga 256
>gb|CL177250.1|CL177250 104_384_10893706_148_31915_154 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10893706, DNA
sequence
Length = 784
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 646 tatatctatacctaataataaaga 623
>gb|CL183871.1|CL183871 104_396_10898461_116_31924_301 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10898461, DNA
sequence
Length = 664
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 164 tatatctatacctaataataaaga 141
>gb|CW021029.1|CW021029 104_109_10409304_116_30498 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10409304, DNA
sequence
Length = 620
Score = 48.1 bits (24), Expect = 0.002
Identities = 45/52 (86%)
Strand = Plus / Plus
Query: 204 tcgtggcaccgtgctgcaaccaggtgttcccctgccgccactgccacaacga 255
||||||| || |||||| |||||| ||| |||||||||| |||||||||||
Sbjct: 414 tcgtggcgccctgctgcggccaggtcttcgcctgccgccattgccacaacga 465
>gb|CW061609.1|CW061609 104_305_10520491_114_30150 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10520491, DNA
sequence
Length = 355
Score = 48.1 bits (24), Expect = 0.002
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 43 ctcctctccgccgtcgccgccgccgccg 70
||||||||||||| ||||||||||||||
Sbjct: 218 ctcctctccgccgccgccgccgccgccg 245
>gb|CW066245.1|CW066245 104_313_10523584_115_30149 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10523584, DNA
sequence
Length = 288
Score = 48.1 bits (24), Expect = 0.002
Identities = 45/52 (86%)
Strand = Plus / Minus
Query: 204 tcgtggcaccgtgctgcaaccaggtgttcccctgccgccactgccacaacga 255
||||||| || |||||| |||||| ||| |||||||||| |||||||||||
Sbjct: 279 tcgtggcgccctgctgcggccaggtcttcgcctgccgccattgccacaacga 228
>gb|CW103821.1|CW103821 104_472_11012095_116_34432_022 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11012095, DNA
sequence
Length = 726
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 203 tatatctatacctaataataaaga 226
>gb|CW118872.1|CW118872 104_495_11108445_148_34700_087 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11108445, DNA
sequence
Length = 645
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 511 tatatctatacctaataataaaga 488
>gb|CW176189.1|CW176189 104_589_11158356_148_36588_048 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11158356, DNA
sequence
Length = 663
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 308 gtagtttgcctactctgtgaaacaaaacagcc 339
||||||||||||||||||||| || |||||||
Sbjct: 619 gtagtttgcctactctgtgaatcagaacagcc 650
>gb|CW207098.1|CW207098 104_636_11187937_148_36967_013 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11187937, DNA
sequence
Length = 638
Score = 48.1 bits (24), Expect = 0.002
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 43 ctcctctccgccgtcgccgccgccgccg 70
||||||||||||| ||||||||||||||
Sbjct: 233 ctcctctccgccgccgccgccgccgccg 206
>gb|CW220938.1|CW220938 104_655_11197629_148_37158_083 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11197629, DNA
sequence
Length = 712
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 218 tatatctatacctaataataaaga 241
>gb|CW253236.1|CW253236 104_716_11224974_116_35105_019 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11224974, DNA
sequence
Length = 568
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 146 tatatctatacctaataataaaga 123
>gb|CW275477.1|CW275477 104_748_11404985_148_35384_067 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11404985, DNA
sequence
Length = 652
Score = 48.1 bits (24), Expect = 0.002
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 45 cctctccgccgtcgccgccgccgccggg 72
||||||||||| ||||||||||||||||
Sbjct: 332 cctctccgccgccgccgccgccgccggg 305
>gb|CW283411.1|CW283411 104_759_11409232_116_35478_050 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11409232, DNA
sequence
Length = 579
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 507 tatatctatacctaataataaaga 530
>gb|CW283453.1|CW283453 104_759_11409255_148_35475_050 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11409255, DNA
sequence
Length = 638
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 493 tatatctatacctaataataaaga 470
>gb|CW317443.1|CW317443 104_809_11473416_148_35864_092 Sorghum methylation filtered
library (LibID: 104) Sorghum bicolor genomic clone
11473416, DNA sequence
Length = 703
Score = 48.1 bits (24), Expect = 0.002
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 45 cctctccgccgtcgccgccgccgccggg 72
||||||||||| ||||||||||||||||
Sbjct: 70 cctctccgccgccgccgccgccgccggg 43
>gb|CW333375.1|CW333375 104_831_11481907_148_36044_074 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11481907, DNA
sequence
Length = 488
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 186 tatatctatacctaataataaaga 163
>gb|CW362112.1|CW362112 fsbb001f033a10f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f033a10, DNA
sequence
Length = 693
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 620 tatatctatacctaataataaaga 643
>gb|CW406822.1|CW406822 fsbb001f100a12f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f100a12, DNA
sequence
Length = 664
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 393 tatatctatacctaataataaaga 416
>gb|CW406823.1|CW406823 fsbb001f100a12k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f100a12, DNA
sequence
Length = 705
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 652 tatatctatacctaataataaaga 629
>gb|CW410081.1|CW410081 fsbb001f104k19k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f104k19, DNA
sequence
Length = 752
Score = 48.1 bits (24), Expect = 0.002
Identities = 24/24 (100%)
Strand = Plus / Minus
Query: 1409 tatatctatacctaataataaaga 1432
||||||||||||||||||||||||
Sbjct: 138 tatatctatacctaataataaaga 115
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 531,373
Number of Sequences: 832831
Number of extensions: 531373
Number of successful extensions: 199629
Number of sequences better than 0.5: 179
Number of HSP's better than 0.5 without gapping: 179
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 199142
Number of HSP's gapped (non-prelim): 352
length of query: 1437
length of database: 491,359,669
effective HSP length: 20
effective length of query: 1417
effective length of database: 474,703,049
effective search space: 672654220433
effective search space used: 672654220433
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)