BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419536.2.1
(1366 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW021587.1|CW021587 104_160_10431349_1_30004 Sorghum met... 167 3e-039
gb|CW513014.1|CW513014 115_3_10511155_1_30020 Sorghum unfil... 145 1e-032
gb|CW192117.1|CW192117 104_614_11178853_148_36948_057 Sorgh... 90 6e-016
gb|CW209941.1|CW209941 104_640_11189528_148_36995_028 Sorgh... 90 6e-016
gb|CW347988.1|CW347988 fsbb001f008c13f0 Sorghum methylation... 90 6e-016
gb|CW480060.1|CW480060 fsbb001f238o16k0 Sorghum methylation... 90 6e-016
gb|CD208536.1|CD208536 HS1_38_H12.g1_A012 Heat-shocked seed... 90 6e-016
gb|BG103046.1|BG103046 RHIZ2_36_D11.b1_A003 Rhizome2 (RHIZ2... 82 2e-013
gb|BG159154.1|BG159154 RHIZ2_28_G08.b1_A003 Rhizome2 (RHIZ2... 82 2e-013
gb|CW480059.1|CW480059 fsbb001f238o16f0 Sorghum methylation... 76 1e-011
gb|CW245145.1|CW245145 104_706_11220910_116_35081_093 Sorgh... 74 4e-011
gb|CW404976.1|CW404976 fsbb001f097f17f0 Sorghum methylation... 74 4e-011
gb|BG102714.1|BG102714 RHIZ2_36_D11.g1_A003 Rhizome2 (RHIZ2... 74 4e-011
gb|CN144107.1|CN144107 WOUND1_20_E12.b1_A002 Wounded leaves... 74 4e-011
gb|CN144191.1|CN144191 WOUND1_20_E12.g1_A002 Wounded leaves... 74 4e-011
gb|CN148282.1|CN148282 WOUND1_55_G06.b1_A002 Wounded leaves... 74 4e-011
gb|CN148351.1|CN148351 WOUND1_55_G06.g1_A002 Wounded leaves... 74 4e-011
gb|CN150641.1|CN150641 WOUND1_70_C05.g1_A002 Wounded leaves... 74 4e-011
gb|CN151544.1|CN151544 WOUND1_76_C11.b1_A002 Wounded leaves... 74 4e-011
gb|CN151625.1|CN151625 WOUND1_76_C11.g1_A002 Wounded leaves... 74 4e-011
gb|CN151920.1|CN151920 WOUND1_78_C02.g1_A002 Wounded leaves... 74 4e-011
gb|CN150569.1|CN150569 WOUND1_70_C05.b1_A002 Wounded leaves... 66 9e-009
gb|CL152121.1|CL152121 104_335_10779735_114_31363_135 Sorgh... 64 4e-008
gb|CL152964.1|CL152964 104_337_10780377_114_31367_009 Sorgh... 64 4e-008
gb|CW124855.1|CW124855 104_504_11112012_148_34702_034 Sorgh... 64 4e-008
gb|CW155257.1|CW155257 104_557_11146040_116_36358_020 Sorgh... 64 4e-008
gb|CW255680.1|CW255680 104_720_11226371_116_35402_042 Sorgh... 64 4e-008
gb|CW343244.1|CW343244 104_845_11487314_116_36184_007 Sorgh... 64 4e-008
gb|AW923012.1|AW923012 DG1_48_G01.b1_A002 Dark Grown 1 (DG1... 64 4e-008
gb|CD231893.1|CD231893 SS1_30_E08.g1_A012 Salt-stressed see... 64 4e-008
gb|CD232077.1|CD232077 SS1_38_E04.b1_A012 Salt-stressed see... 64 4e-008
gb|CD234308.1|CD234308 SS1_26_B02.g1_A012 Salt-stressed see... 64 4e-008
gb|CD236240.1|CD236240 SS1_32_H03.g1_A012 Salt-stressed see... 64 4e-008
gb|CN141757.1|CN141757 WOUND1_1_E01.g1_A002 Wounded leaves ... 64 4e-008
gb|CN141909.1|CN141909 WOUND1_2_D08.g1_A002 Wounded leaves ... 64 4e-008
gb|CN142079.1|CN142079 WOUND1_3_E12.g1_A002 Wounded leaves ... 64 4e-008
gb|CN143379.1|CN143379 WOUND1_15_H07.g1_A002 Wounded leaves... 64 4e-008
gb|CN143714.1|CN143714 WOUND1_17_H12.g1_A002 Wounded leaves... 64 4e-008
gb|CN145362.1|CN145362 WOUND1_28_A10.g1_A002 Wounded leaves... 64 4e-008
gb|CN145372.1|CN145372 WOUND1_28_B08.g1_A002 Wounded leaves... 64 4e-008
gb|CN146609.1|CN146609 WOUND1_42_A04.g1_A002 Wounded leaves... 64 4e-008
gb|CN146754.1|CN146754 WOUND1_43_B07.g1_A002 Wounded leaves... 64 4e-008
gb|CN147854.1|CN147854 WOUND1_52_E02.g1_A002 Wounded leaves... 64 4e-008
gb|CN148348.1|CN148348 WOUND1_55_G02.g1_A002 Wounded leaves... 64 4e-008
gb|CN149132.1|CN149132 WOUND1_60_H10.g1_A002 Wounded leaves... 64 4e-008
gb|CN150048.1|CN150048 WOUND1_66_C07.g1_A002 Wounded leaves... 64 4e-008
gb|CN150084.1|CN150084 WOUND1_66_G08.g1_A002 Wounded leaves... 64 4e-008
gb|CN150092.1|CN150092 WOUND1_66_H05.g1_A002 Wounded leaves... 64 4e-008
gb|CN150096.1|CN150096 WOUND1_66_H09.g1_A002 Wounded leaves... 64 4e-008
gb|CX618812.1|CX618812 GABR1_41_G07.g1_A002 GA- or brassino... 64 4e-008
gb|CX622200.1|CX622200 GABR1_62_C09.g2_A002 GA- or brassino... 64 4e-008
gb|CW245147.1|CW245147 104_706_11220910_148_35077_093 Sorgh... 58 2e-006
gb|CW245148.1|CW245148 104_706_11220910_148_37599_093 Sorgh... 58 2e-006
gb|CW404977.1|CW404977 fsbb001f097f17k0 Sorghum methylation... 58 2e-006
gb|CN129547.1|CN129547 RHOH1_36_B08.b3_A002 Acid- and alkal... 58 2e-006
gb|CX607042.1|CX607042 ANR1_6_H06.b1_A002 Anaerobic roots S... 58 2e-006
gb|CX608050.1|CX608050 ANR1_32_G10.b1_A002 Anaerobic roots ... 58 2e-006
gb|CX620993.1|CX620993 GABR1_55_G09.b1_A002 GA- or brassino... 58 2e-006
gb|CW209940.1|CW209940 104_640_11189528_116_36996_028 Sorgh... 56 9e-006
gb|CW223611.1|CW223611 104_659_11203008_148_37191_088 Sorgh... 56 9e-006
gb|CW324653.1|CW324653 104_819_11477275_116_35916_076 Sorgh... 56 9e-006
gb|CW347989.1|CW347989 fsbb001f008c13k0 Sorghum methylation... 56 9e-006
gb|CN124765.1|CN124765 RHOH1_6_F06.g1_A002 Acid- and alkali... 56 9e-006
gb|CN144196.1|CN144196 WOUND1_20_F05.g1_A002 Wounded leaves... 56 9e-006
gb|CN144667.1|CN144667 WOUND1_23_F05.g1_A002 Wounded leaves... 56 9e-006
gb|CN146181.1|CN146181 WOUND1_38_A06.g1_A002 Wounded leaves... 56 9e-006
gb|CN150856.1|CN150856 WOUND1_71_H03.g1_A002 Wounded leaves... 56 9e-006
gb|CL167616.1|CL167616 104_364_10810203_116_31803_267 Sorgh... 54 4e-005
gb|CW433620.1|CW433620 fsbb001f148o16f0 Sorghum methylation... 54 4e-005
gb|CW433621.1|CW433621 fsbb001f148o16k0 Sorghum methylation... 54 4e-005
gb|CW063049.1|CW063049 104_308_10521687_1_30092 Sorghum met... 52 1e-004
gb|CW152280.1|CW152280 104_553_11144405_116_36323_023 Sorgh... 52 1e-004
gb|CW392630.1|CW392630 fsbb001f079f09f0 Sorghum methylation... 52 1e-004
gb|CF490081.1|CF490081 POL1_62_H01.b1_A002 Pollen Sorghum b... 52 1e-004
gb|CW130305.1|CW130305 104_512_11115043_116_34768_068 Sorgh... 50 5e-004
gb|CW469992.1|CW469992 fsbb001f222p16f0 Sorghum methylation... 50 5e-004
gb|BG052711.1|BG052711 RHIZ2_28_G08.g1_A003 Rhizome2 (RHIZ2... 50 5e-004
gb|CF427655.1|CF427655 PH1_10_F04.b1_A002 Phosphorous-defic... 50 5e-004
gb|CF429614.1|CF429614 PH1_23_D07.b1_A002 Phosphorous-defic... 50 5e-004
gb|CF429902.1|CF429902 PH1_25_D10.b1_A002 Phosphorous-defic... 50 5e-004
gb|CF755720.1|CF755720 DSAF1_1_B02.b1_A011 Drought-stressed... 50 5e-004
gb|CF771144.1|CF771144 DSBF1_14_E10.g1_A010 Drought-stresse... 50 5e-004
gb|CN124537.1|CN124537 RHOH1_5_A06.g1_A002 Acid- and alkali... 50 5e-004
gb|CN128566.1|CN128566 RHOH1_30_G06.b1_A002 Acid- and alkal... 50 5e-004
gb|CN129718.1|CN129718 RHOH1_37_B03.b1_A002 Acid- and alkal... 50 5e-004
gb|CN130050.1|CN130050 RHOH1_39_A12.b1_A002 Acid- and alkal... 50 5e-004
gb|CN135665.1|CN135665 OX1_38_F05.b1_A002 Oxidatively-stres... 50 5e-004
gb|CX606431.1|CX606431 ANR1_3_B02.b1_A002 Anaerobic roots S... 50 5e-004
gb|CX606801.1|CX606801 ANR1_5_B12.b1_A002 Anaerobic roots S... 50 5e-004
gb|CX608043.1|CX608043 ANR1_32_F11.b1_A002 Anaerobic roots ... 50 5e-004
gb|CX610703.1|CX610703 ANR1_20_G07.b1_A002 Anaerobic roots ... 50 5e-004
gb|CX614913.1|CX614913 GABR1_17_C07.b1_A002 GA- or brassino... 50 5e-004
gb|CX616691.1|CX616691 GABR1_29_H04.b1_A002 GA- or brassino... 50 5e-004
gb|CX621118.1|CX621118 GABR1_56_D04.b1_A002 GA- or brassino... 50 5e-004
gb|CW097149.1|CW097149 104_463_11002295_116_34344_094 Sorgh... 48 0.002
gb|CW245146.1|CW245146 104_706_11220910_116_37600_093 Sorgh... 48 0.002
gb|CW364958.1|CW364958 fsbb001f037d22f0 Sorghum methylation... 48 0.002
gb|CF431162.1|CF431162 NIT1_6_C08.b1_A002 Nitrogen-deficien... 48 0.002
gb|CF433158.1|CF433158 NIT1_25_E08.b1_A002 Nitrogen-deficie... 48 0.002
gb|CL167615.1|CL167615 104_364_10810203_114_31802_267 Sorgh... 46 0.009
gb|CW126598.1|CW126598 104_507_11112983_148_34728_090 Sorgh... 46 0.009
gb|CW353559.1|CW353559 fsbb001f016f20k0 Sorghum methylation... 46 0.009
gb|BE361208.1|BE361208 DG1_70_H09.g1_A002 Dark Grown 1 (DG1... 46 0.009
gb|BE596903.1|BE596903 PI1_60_A01.g1_A002 Pathogen induced ... 46 0.009
gb|BG463466.1|BG463466 EM1_49_H04.b1_A002 Embryo 1 (EM1) So... 46 0.009
gb|BM328717.1|BM328717 PIC1_25_G03.g1_A002 Pathogen-infecte... 46 0.009
gb|CL152122.1|CL152122 104_335_10779735_116_31364_135 Sorgh... 44 0.034
gb|CW108984.1|CW108984 104_480_11097815_116_34493_082 Sorgh... 44 0.034
gb|CW255681.1|CW255681 104_720_11226371_148_35403_042 Sorgh... 44 0.034
gb|CW332999.1|CW332999 104_830_11481709_116_36036_049 Sorgh... 44 0.034
gb|AW923055.1|AW923055 DG1_48_G01.g1_A002 Dark Grown 1 (DG1... 44 0.034
gb|CD234204.1|CD234204 SS1_26_B02.b1_A012 Salt-stressed see... 44 0.034
gb|CD235375.1|CD235375 SS1_29_H10.b1_A012 Salt-stressed see... 44 0.034
gb|CF431021.1|CF431021 NIT1_4_H02.b1_A002 Nitrogen-deficien... 44 0.034
gb|CF432260.1|CF432260 NIT1_15_D05.b1_A002 Nitrogen-deficie... 44 0.034
gb|CN135321.1|CN135321 OX1_32_B07.b1_A002 Oxidatively-stres... 44 0.034
gb|CN141678.1|CN141678 WOUND1_1_E01.b1_A002 Wounded leaves ... 44 0.034
gb|CN145288.1|CN145288 WOUND1_28_A10.b2_A002 Wounded leaves... 44 0.034
gb|CN146677.1|CN146677 WOUND1_43_B07.b1_A002 Wounded leaves... 44 0.034
gb|CN149045.1|CN149045 WOUND1_60_H10.b1_A002 Wounded leaves... 44 0.034
gb|CN150014.1|CN150014 WOUND1_66_H05.b1_A002 Wounded leaves... 44 0.034
gb|CN150018.1|CN150018 WOUND1_66_H09.b1_A002 Wounded leaves... 44 0.034
gb|CN151211.1|CN151211 WOUND1_74_C10.b1_A002 Wounded leaves... 44 0.034
gb|CX618728.1|CX618728 GABR1_41_G07.b1_A002 GA- or brassino... 44 0.034
gb|CX622109.1|CX622109 GABR1_62_C09.b2_A002 GA- or brassino... 44 0.034
gb|CW092078.1|CW092078 104_454_10998930_116_33041_073 Sorgh... 42 0.13
gb|CW128167.1|CW128167 104_509_11113857_148_34750_037 Sorgh... 42 0.13
gb|CW351997.1|CW351997 fsbb001f014a15k0 Sorghum methylation... 42 0.13
gb|AI723825.1|AI723825 RHIZ1_12_H04.y1_A001 Rhizome1 (RHIZ1... 42 0.13
gb|AW677158.1|AW677158 DG1_5_C12.b1_A002 Dark Grown 1 (DG1)... 42 0.13
gb|CB925746.1|CB925746 ABA1_23_E12.b1_A012 Abscisic acid-tr... 42 0.13
gb|CF432253.1|CF432253 NIT1_15_E06.b1_A002 Nitrogen-deficie... 42 0.13
gb|CN150866.1|CN150866 WOUND1_72_A06.b1_A002 Wounded leaves... 42 0.13
gb|CN150938.1|CN150938 WOUND1_72_A06.g1_A002 Wounded leaves... 42 0.13
gb|CX606124.1|CX606124 ANR1_1_F10.b1_A002 Anaerobic roots S... 42 0.13
>gb|CW021587.1|CW021587 104_160_10431349_1_30004 Sorghum methylation filtered library (LibID:
104) Sorghum bicolor genomic clone 10431349, DNA sequence
Length = 655
Score = 167 bits (84), Expect = 3e-039
Identities = 188/224 (83%), Gaps = 19/224 (8%)
Strand = Plus / Plus
Query: 840 cggtcttgcatgattgggaccatgacgactgcgtgaagatactgaagaattgcaa----- 894
|||| ||||||||||||||||| || | ||||||| ||||||||||||| |||||
Sbjct: 289 cggttttgcatgattgggaccacgatgcctgcgtgtagatactgaagaactgcaaattaa 348
Query: 895 -----aaaggctattcctccaagagaagccggtggaaaggtgataataataa------ac 943
||| ||||||||||| ||||| |||||||| |||||||||||||||| ||
Sbjct: 349 aaaaaaaaagctattcctccgagagaggccggtgggaaggtgataataataataataaac 408
Query: 944 atggtagttggagctgggcc---atctgacatgaagcacaaagagatgcaggccatattc 1000
|||||| |||||||| | || ||| ||| ||||||||||||||||||||||||| |||
Sbjct: 409 atggtaattggagctagaccgtcatcagacttgaagcacaaagagatgcaggccattttc 468
Query: 1001 gatgtctatatcatgttcatcaatggcatggaacgagatgagca 1044
||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 469 gatgtctatatcatgctcatcaatggcatggaacgagatgagca 512
Score = 89.7 bits (45), Expect = 6e-016
Identities = 82/93 (88%), Gaps = 1/93 (1%)
Strand = Plus / Plus
Query: 1051 gagcaagattttctccgaagctggatatagcgattacagaataataccggtcttaggtgt 1110
|||||||||||||| ||||||||||| |||| ||||||||||||||| |||||||||||
Sbjct: 508 gagcaagattttctgcgaagctggatttagcagttacagaataataccagtcttaggtgt 567
Query: 1111 tcggtctataatcgaggtctatccataaccatt 1143
|| || |||||||||||| |||| ||| ||||
Sbjct: 568 tc-atccataatcgaggtccatccttaatcatt 599
>gb|CW513014.1|CW513014 115_3_10511155_1_30020 Sorghum unfiltered library (LibID: 115)
Sorghum bicolor genomic clone 10511155, DNA sequence
Length = 626
Score = 145 bits (73), Expect = 1e-032
Identities = 112/125 (89%)
Strand = Plus / Minus
Query: 423 tgctcgatccaaccatcgtctcccccttctccgagctcggcgcgtggttccagcacgagc 482
|||||||||||||||| || |||||||||| ||||||||| | ||||||||||| ||||
Sbjct: 126 tgctcgatccaaccattgtatcccccttctttgagctcggcacatggttccagcatgagc 67
Query: 483 tcccagacccgtgcatcttcaagcacacgcacggccgaggcatctgggagttgaccaaag 542
||||||||||||||||||||||||||| |||||||| || ||||| |||| ||||||||
Sbjct: 66 tcccagacccgtgcatcttcaagcacatgcacggccaagccatctaggagatgaccaaac 7
Query: 543 atgac 547
|||||
Sbjct: 6 atgac 2
Score = 77.8 bits (39), Expect = 2e-012
Identities = 87/103 (84%)
Strand = Plus / Minus
Query: 33 atcagcgtatcatggagctcagccccaacaacagcacggaccagagcttgctcgatgcgc 92
||||| |||| |||||||||| | |||| |||||| | | ||| ||||||| ||||| |
Sbjct: 492 atcagtgtatgatggagctcaccgccaattacagcatgaagcagtgcttgcttgatgcac 433
Query: 93 agctcgagctctggcacaccaccttcgcgttcatgaagtccat 135
|||| ||||| ||||||| ||||||||||||||| ||||||||
Sbjct: 432 agctagagctttggcacaacaccttcgcgttcataaagtccat 390
Score = 46.1 bits (23), Expect = 0.009
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 257 cgtcgcctgatgcgcgtgctaacaaccaccaatgtcttc 295
|||| |||||||| | ||||||||||||||||||||||
Sbjct: 292 cgtcacctgatgcatgcgctaacaaccaccaatgtcttc 254
>gb|CW192117.1|CW192117 104_614_11178853_148_36948_057 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11178853, DNA
sequence
Length = 677
Score = 89.7 bits (45), Expect = 6e-016
Identities = 66/73 (90%)
Strand = Plus / Plus
Query: 78 gcttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatgg 137
|||||||||| || ||||||||||||||||||| ||| ||||| ||||| ||||||||||
Sbjct: 130 gcttgctcgacgctcagctcgagctctggcacagcacattcgccttcatcaagtccatgg 189
Query: 138 cgctcaagtccgc 150
|| ||||||||||
Sbjct: 190 cgttcaagtccgc 202
>gb|CW209941.1|CW209941 104_640_11189528_148_36995_028 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11189528, DNA
sequence
Length = 644
Score = 89.7 bits (45), Expect = 6e-016
Identities = 66/73 (90%)
Strand = Plus / Plus
Query: 78 gcttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatgg 137
|||||||||| || ||||||||||||||||||| ||| ||||| ||||| ||||||||||
Sbjct: 97 gcttgctcgacgctcagctcgagctctggcacagcacattcgccttcatcaagtccatgg 156
Query: 138 cgctcaagtccgc 150
|| ||||||||||
Sbjct: 157 cgttcaagtccgc 169
>gb|CW347988.1|CW347988 fsbb001f008c13f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f008c13, DNA
sequence
Length = 698
Score = 89.7 bits (45), Expect = 6e-016
Identities = 66/73 (90%)
Strand = Plus / Plus
Query: 78 gcttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatgg 137
|||||||||| || ||||||||||||||||||| ||| ||||| ||||| ||||||||||
Sbjct: 152 gcttgctcgacgctcagctcgagctctggcacagcacattcgccttcatcaagtccatgg 211
Query: 138 cgctcaagtccgc 150
|| ||||||||||
Sbjct: 212 cgttcaagtccgc 224
>gb|CW480060.1|CW480060 fsbb001f238o16k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f238o16, DNA
sequence
Length = 668
Score = 89.7 bits (45), Expect = 6e-016
Identities = 102/121 (84%)
Strand = Plus / Plus
Query: 80 ttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcg 139
|||||||| || ||||||||||||||| |||||||||| | ||| ||||||||||||
Sbjct: 263 ttgctcgacgctcagctcgagctctggaacaccaccttttcccacatcaagtccatggcg 322
Query: 140 ctcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcggtgccgcc 199
||||| ||||| | ||||||| |||||||||||||||||| ||||| ||| ||||||
Sbjct: 323 ctcaaatccgctctggacctccgtattgccgatgccatccacaaccatgccggcgccgcc 382
Query: 200 a 200
|
Sbjct: 383 a 383
>gb|CD208536.1|CD208536 HS1_38_H12.g1_A012 Heat-shocked seedlings Sorghum bicolor cDNA
clone HS1_38_H12_A012 5', mRNA sequence
Length = 650
Score = 89.7 bits (45), Expect = 6e-016
Identities = 102/121 (84%)
Strand = Plus / Plus
Query: 80 ttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcg 139
|||||||| || ||||||||||||||| |||||||||| | ||| ||||||||||||
Sbjct: 48 ttgctcgacgctcagctcgagctctggaacaccaccttttcccacatcaagtccatggcg 107
Query: 140 ctcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcggtgccgcc 199
||||| ||||| | ||||||| |||||||||||||||||| ||||| ||| ||||||
Sbjct: 108 ctcaaatccgctctggacctccgtattgccgatgccatccacaaccatgccggcgccgcc 167
Query: 200 a 200
|
Sbjct: 168 a 168
Score = 46.1 bits (23), Expect = 0.009
Identities = 65/79 (82%)
Strand = Plus / Plus
Query: 440 gtctcccccttctccgagctcggcgcgtggttccagcacgagctcccagacccgtgcatc 499
|||||||| ||| |||||| ||| | ||||||||||| ||||| || | || ||| ||
Sbjct: 387 gtctccccgttcctcgagcttggcacatggttccagcaggagctaccgggtccatgcgtc 446
Query: 500 ttcaagcacacgcacggcc 518
|||||||| ||||||||||
Sbjct: 447 ttcaagcagacgcacggcc 465
>gb|BG103046.1|BG103046 RHIZ2_36_D11.b1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 539
Score = 81.8 bits (41), Expect = 2e-013
Identities = 62/69 (89%)
Strand = Plus / Plus
Query: 79 cttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggc 138
|||||| || || ||||| |||||||||||||| |||||||| | |||||||||||||||
Sbjct: 80 cttgcttgacgctcagctagagctctggcacacgaccttcgcttacatgaagtccatggc 139
Query: 139 gctcaagtc 147
|||||||||
Sbjct: 140 gctcaagtc 148
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
|||||| ||||||||||||| |||| | |||||||||
Sbjct: 453 ctcggcacgtggttccagcaagagcactcagacccgt 489
>gb|BG159154.1|BG159154 RHIZ2_28_G08.b1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 336
Score = 81.8 bits (41), Expect = 2e-013
Identities = 62/69 (89%)
Strand = Plus / Plus
Query: 79 cttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggc 138
|||||| || || ||||| |||||||||||||| |||||||| | |||||||||||||||
Sbjct: 80 cttgcttgacgctcagctagagctctggcacacgaccttcgcttacatgaagtccatggc 139
Query: 139 gctcaagtc 147
|||||||||
Sbjct: 140 gctcaagtc 148
>gb|CW480059.1|CW480059 fsbb001f238o16f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f238o16, DNA
sequence
Length = 732
Score = 75.8 bits (38), Expect = 1e-011
Identities = 102/122 (83%), Gaps = 1/122 (0%)
Strand = Plus / Minus
Query: 80 ttgctcgatgcgcagctcgagctctggcacaccaccttcg-cgttcatgaagtccatggc 138
|||||||| || ||||||||||||||| |||||||||| | ||| |||||||||||
Sbjct: 718 ttgctcgacgctcagctcgagctctggaacaccacctttttcccacatcaagtccatggc 659
Query: 139 gctcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcggtgccgc 198
|||||| ||||| | ||||||| |||||||||||||||||| ||||| ||| |||||
Sbjct: 658 gctcaaatccgctctggacctccgtattgccgatgccatccacaaccatgccggcgccgc 599
Query: 199 ca 200
||
Sbjct: 598 ca 597
Score = 56.0 bits (28), Expect = 9e-006
Identities = 127/160 (79%)
Strand = Plus / Minus
Query: 638 caggggataagctcgctcgtcgacgtcggtgggggcatcggtacggcggcccaagccatc 697
|||||||||||||| | || |||||||||||||| |||| | || || || ||||||
Sbjct: 180 caggggataagctccttggtggacgtcggtgggggtctcggcgcagctgcacaggccatc 121
Query: 698 tcaaaggcgttcccgcacgtcaagtgtagcgtgctggaccttgcccacgtcgttgcgaag 757
|||||||| |||||| | || || |||||||| |||| | | |||||| || || |||
Sbjct: 120 tcaaaggccttcccggatgtgaaatgtagcgttttggatttggaccacgttgtcgccaag 61
Query: 758 gctccaactcacacggacgtgcaatttatcgctggcgaca 797
||||| | | |||||||||||| | |||||| |||||||
Sbjct: 60 gctccgagtggcacggacgtgcagtatatcgccggcgaca 21
Score = 46.1 bits (23), Expect = 0.009
Identities = 65/79 (82%)
Strand = Plus / Minus
Query: 440 gtctcccccttctccgagctcggcgcgtggttccagcacgagctcccagacccgtgcatc 499
|||||||| ||| |||||| ||| | ||||||||||| ||||| || | || ||| ||
Sbjct: 378 gtctccccgttcctcgagcttggcacatggttccagcaggagctaccgggtccatgcgtc 319
Query: 500 ttcaagcacacgcacggcc 518
|||||||| ||||||||||
Sbjct: 318 ttcaagcagacgcacggcc 300
>gb|CW245145.1|CW245145 104_706_11220910_116_35081_093 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11220910, DNA
sequence
Length = 634
Score = 73.8 bits (37), Expect = 4e-011
Identities = 61/69 (88%)
Strand = Plus / Plus
Query: 79 cttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggc 138
|||||| || || ||||| |||||||||||||| ||||| || | |||||||||||||||
Sbjct: 221 cttgcttgacgctcagctagagctctggcacacgacctttgcttacatgaagtccatggc 280
Query: 139 gctcaagtc 147
|||||||||
Sbjct: 281 gctcaagtc 289
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
|||||| ||||||||||||| |||| | |||||||||
Sbjct: 594 ctcggcacgtggttccagcaagagcactcagacccgt 630
>gb|CW404976.1|CW404976 fsbb001f097f17f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f097f17, DNA
sequence
Length = 677
Score = 73.8 bits (37), Expect = 4e-011
Identities = 61/69 (88%)
Strand = Plus / Plus
Query: 79 cttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggc 138
|||||| || || ||||| |||||||||||||| ||||| || | |||||||||||||||
Sbjct: 149 cttgcttgacgctcagctagagctctggcacacgacctttgcttacatgaagtccatggc 208
Query: 139 gctcaagtc 147
|||||||||
Sbjct: 209 gctcaagtc 217
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
|||||| ||||||||||||| |||| | |||||||||
Sbjct: 522 ctcggcacgtggttccagcaagagcactcagacccgt 558
>gb|BG102714.1|BG102714 RHIZ2_36_D11.g1_A003 Rhizome2 (RHIZ2) Sorghum propinquum cDNA, mRNA
sequence
Length = 632
Score = 73.8 bits (37), Expect = 4e-011
Identities = 121/149 (81%)
Strand = Plus / Plus
Query: 788 gctggcgacatgtttgagagcattccaccagcagacgccgtactgttgaagtcggtcttg 847
||||| ||||||||||||||||||||||| ||||| ||||| | | |||| ||| |||
Sbjct: 207 gctggtgacatgtttgagagcattccaccggcagatgccgtcttccttaagtgggttttg 266
Query: 848 catgattgggaccatgacgactgcgtgaagatactgaagaattgcaaaaaggctattcct 907
||||| |||| | ||| || || | ||||||||||||||||| || || ||||| |||
Sbjct: 267 catgactggggcgatgctgattgtatcaagatactgaagaattgtaagaaagctatacct 326
Query: 908 ccaagagaagccggtggaaaggtgataat 936
|| || || || || ||||||||||||||
Sbjct: 327 cctagggatgcaggaggaaaggtgataat 355
Score = 44.1 bits (22), Expect = 0.034
Identities = 133/170 (78%)
Strand = Plus / Plus
Query: 969 acatgaagcacaaagagatgcaggccatattcgatgtctatatcatgttcatcaatggca 1028
|||| ||||||||||||| |||| | | || ||| ||| |||||||| ||||||||
Sbjct: 388 acattaagcacaaagagactcaggtcttgtttgatctcttcatcatgtttgtcaatggcg 447
Query: 1029 tggaacgagatgagcaggagtggagcaagattttctccgaagctggatatagcgattaca 1088
| || ||||| ||||| || |||| ||||| ||| ||||| |||| |||||||||||
Sbjct: 448 tcgagcgagacgagcaagaatggaagaagatcatctttgaagccggatttagcgattaca 507
Query: 1089 gaataataccggtcttaggtgttcggtctataatcgaggtctatccataa 1138
||| ||||| || | |||||||| || || || |||||||| ||||||
Sbjct: 508 aaatcatacctgttcttggtgttcgatccatcattgaggtctacccataa 557
>gb|CN144107.1|CN144107 WOUND1_20_E12.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_20_E12_A002 3', mRNA sequence
Length = 473
Score = 73.8 bits (37), Expect = 4e-011
Identities = 121/149 (81%)
Strand = Plus / Plus
Query: 788 gctggcgacatgtttgagagcattccaccagcagacgccgtactgttgaagtcggtcttg 847
||||| ||||||||||||||||||||||| ||| ||||||| | | |||| ||| |||
Sbjct: 76 gctggtgacatgtttgagagcattccaccggcaaacgccgtcttccttaagtgggttttg 135
Query: 848 catgattgggaccatgacgactgcgtgaagatactgaagaattgcaaaaaggctattcct 907
||||| |||| | ||| || || | ||||||||||||||||| || || ||||| |||
Sbjct: 136 catgactggggcgatgctgattgtatcaagatactgaagaattgtaagaatgctatccct 195
Query: 908 ccaagagaagccggtggaaaggtgataat 936
| ||||| || || ||||||||||||||
Sbjct: 196 tctagagatgcaggaggaaaggtgataat 224
>gb|CN144191.1|CN144191 WOUND1_20_E12.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_20_E12_A002 5', mRNA sequence
Length = 642
Score = 73.8 bits (37), Expect = 4e-011
Identities = 61/69 (88%)
Strand = Plus / Plus
Query: 79 cttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggc 138
|||||| || || ||||| |||||||||||||| ||||| || | |||||||||||||||
Sbjct: 76 cttgcttgacgctcagctagagctctggcacacgacctttgcttacatgaagtccatggc 135
Query: 139 gctcaagtc 147
|||||||||
Sbjct: 136 gctcaagtc 144
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
|||||| ||||||||||||| |||| | |||||||||
Sbjct: 449 ctcggcacgtggttccagcaagagcactcagacccgt 485
>gb|CN148282.1|CN148282 WOUND1_55_G06.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_55_G06_A002 3', mRNA sequence
Length = 741
Score = 73.8 bits (37), Expect = 4e-011
Identities = 121/149 (81%)
Strand = Plus / Plus
Query: 788 gctggcgacatgtttgagagcattccaccagcagacgccgtactgttgaagtcggtcttg 847
||||| ||||||||||||||||||||||| ||| ||||||| | | |||| ||| |||
Sbjct: 346 gctggtgacatgtttgagagcattccaccggcaaacgccgtcttccttaagtgggttttg 405
Query: 848 catgattgggaccatgacgactgcgtgaagatactgaagaattgcaaaaaggctattcct 907
||||| |||| | ||| || || | ||||||||||||||||| || || ||||| |||
Sbjct: 406 catgactggggcgatgctgattgtatcaagatactgaagaattgtaagaatgctatacct 465
Query: 908 ccaagagaagccggtggaaaggtgataat 936
| ||||| || || ||||||||||||||
Sbjct: 466 tctagagatgcaggaggaaaggtgataat 494
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
|||||| ||||||||||||| |||| | |||||||||
Sbjct: 16 ctcggcacgtggttccagcaagagcactcagacccgt 52
>gb|CN148351.1|CN148351 WOUND1_55_G06.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_55_G06_A002 5', mRNA sequence
Length = 816
Score = 73.8 bits (37), Expect = 4e-011
Identities = 61/69 (88%)
Strand = Plus / Plus
Query: 79 cttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggc 138
|||||| || || ||||| |||||||||||||| ||||| || | |||||||||||||||
Sbjct: 85 cttgcttgacgctcagctagagctctggcacacgacctttgcttacatgaagtccatggc 144
Query: 139 gctcaagtc 147
|||||||||
Sbjct: 145 gctcaagtc 153
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 788 gctggcgacatgtttgagagcattccacc 816
||||| |||||||||||||||||||||||
Sbjct: 788 gctggtgacatgtttgagagcattccacc 816
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
|||||| ||||||||||||| |||| | |||||||||
Sbjct: 458 ctcggcacgtggttccagcaagagcactcagacccgt 494
>gb|CN150641.1|CN150641 WOUND1_70_C05.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_70_C05_A002 5', mRNA sequence
Length = 712
Score = 73.8 bits (37), Expect = 4e-011
Identities = 61/69 (88%)
Strand = Plus / Plus
Query: 79 cttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggc 138
|||||| || || ||||| |||||||||||||| ||||| || | |||||||||||||||
Sbjct: 86 cttgcttgacgctcagctagagctctggcacacgacctttgcttacatgaagtccatggc 145
Query: 139 gctcaagtc 147
|||||||||
Sbjct: 146 gctcaagtc 154
>gb|CN151544.1|CN151544 WOUND1_76_C11.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_76_C11_A002 3', mRNA sequence
Length = 620
Score = 73.8 bits (37), Expect = 4e-011
Identities = 121/149 (81%)
Strand = Plus / Plus
Query: 788 gctggcgacatgtttgagagcattccaccagcagacgccgtactgttgaagtcggtcttg 847
||||| ||||||||||||||||||||||| ||| ||||||| | | |||| ||| |||
Sbjct: 121 gctggtgacatgtttgagagcattccaccggcaaacgccgtcttccttaagtgggttttg 180
Query: 848 catgattgggaccatgacgactgcgtgaagatactgaagaattgcaaaaaggctattcct 907
||||| |||| | ||| || || | ||||||||||||||||| || || ||||| |||
Sbjct: 181 catgactggggcgatgctgattgtatcaagatactgaagaattgtaagaatgctatacct 240
Query: 908 ccaagagaagccggtggaaaggtgataat 936
| ||||| || || ||||||||||||||
Sbjct: 241 tctagagatgcaggaggaaaggtgataat 269
>gb|CN151625.1|CN151625 WOUND1_76_C11.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_76_C11_A002 5', mRNA sequence
Length = 793
Score = 73.8 bits (37), Expect = 4e-011
Identities = 61/69 (88%)
Strand = Plus / Plus
Query: 79 cttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggc 138
|||||| || || ||||| |||||||||||||| ||||| || | |||||||||||||||
Sbjct: 76 cttgcttgacgctcagctagagctctggcacacgacctttgcttacatgaagtccatggc 135
Query: 139 gctcaagtc 147
|||||||||
Sbjct: 136 gctcaagtc 144
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
|||||| ||||||||||||| |||| | |||||||||
Sbjct: 449 ctcggcacgtggttccagcaagagcactcagacccgt 485
>gb|CN151920.1|CN151920 WOUND1_78_C02.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_78_C02_A002 5', mRNA sequence
Length = 130
Score = 73.8 bits (37), Expect = 4e-011
Identities = 61/69 (88%)
Strand = Plus / Plus
Query: 79 cttgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggc 138
|||||| || || ||||| |||||||||||||| ||||| || | |||||||||||||||
Sbjct: 37 cttgcttgacgctcagctagagctctggcacacgacctttgcttacatgaagtccatggc 96
Query: 139 gctcaagtc 147
|||||||||
Sbjct: 97 gctcaagtc 105
>gb|CN150569.1|CN150569 WOUND1_70_C05.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_70_C05_A002 3', mRNA sequence
Length = 749
Score = 65.9 bits (33), Expect = 9e-009
Identities = 120/149 (80%)
Strand = Plus / Plus
Query: 788 gctggcgacatgtttgagagcattccaccagcagacgccgtactgttgaagtcggtcttg 847
||||| ||||||||||||||||||||||| ||| ||||||| | | |||| ||| |||
Sbjct: 252 gctggtgacatgtttgagagcattccaccggcaaacgccgtcttccttaagtgggttttg 311
Query: 848 catgattgggaccatgacgactgcgtgaagatactgaagaattgcaaaaaggctattcct 907
||||| |||| | || || || | ||||||||||||||||| || || ||||| |||
Sbjct: 312 catgactggggcggtgctgattgtatcaagatactgaagaattgtaagaatgctatacct 371
Query: 908 ccaagagaagccggtggaaaggtgataat 936
| ||||| || || ||||||||||||||
Sbjct: 372 tctagagatgcaggaggaaaggtgataat 400
>gb|CL152121.1|CL152121 104_335_10779735_114_31363_135 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10779735, DNA
sequence
Length = 765
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 114 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 173
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 174 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 225
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 479 ctcggcgagtggttccagcacgagctgccggacccgt 515
Score = 44.1 bits (22), Expect = 0.034
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 687 cccaagccatctcaaaggcgttcccgcacgtcaagtgtagcgtgct 732
|||| |||||| ||||||||||||||||| || | ||||| |||||
Sbjct: 711 cccaggccatcgcaaaggcgttcccgcacatcgaatgtagtgtgct 756
>gb|CL152964.1|CL152964 104_337_10780377_114_31367_009 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10780377, DNA
sequence
Length = 413
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 114 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 173
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 174 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 225
>gb|CW124855.1|CW124855 104_504_11112012_148_34702_034 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11112012, DNA
sequence
Length = 615
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 389 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 448
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 449 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 500
>gb|CW155257.1|CW155257 104_557_11146040_116_36358_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11146040, DNA
sequence
Length = 732
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 359 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 418
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 419 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 470
>gb|CW255680.1|CW255680 104_720_11226371_116_35402_042 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226371, DNA
sequence
Length = 667
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 191 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 250
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 251 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 302
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 556 ctcggcgagtggttccagcacgagctgccggacccgt 592
>gb|CW343244.1|CW343244 104_845_11487314_116_36184_007 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11487314, DNA
sequence
Length = 687
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Minus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 262 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 203
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 202 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 151
>gb|AW923012.1|AW923012 DG1_48_G01.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 477
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 53 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 112
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 113 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 164
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 418 ctcggcgagtggttccagcacgagctgccggacccgt 454
>gb|CD231893.1|CD231893 SS1_30_E08.g1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_30_E08_A012 5', mRNA sequence
Length = 618
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 66 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 125
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 126 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 177
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 431 ctcggcgagtggttccagcacgagctgccggacccgt 467
>gb|CD232077.1|CD232077 SS1_38_E04.b1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_38_E04_A012 3', mRNA sequence
Length = 631
Score = 63.9 bits (32), Expect = 4e-008
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 769 cacggacgtgcaatttatcgctggcgacatgtttgagagcattccacc 816
|||||||||||| | |||||| |||||||||||||||||| |||||||
Sbjct: 62 cacggacgtgcagtatatcgccggcgacatgtttgagagcgttccacc 109
Score = 50.1 bits (25), Expect = 5e-004
Identities = 67/81 (82%)
Strand = Plus / Plus
Query: 972 tgaagcacaaagagatgcaggccatattcgatgtctatatcatgttcatcaatggcatgg 1031
||||||||||||||| ||||||| | || ||| | ||||||||| | | |||||||| |
Sbjct: 265 tgaagcacaaagagacgcaggccttgtttgatttatatatcatgcttgtaaatggcattg 324
Query: 1032 aacgagatgagcaggagtgga 1052
| |||||||||| |||||||
Sbjct: 325 agagagatgagcaagagtgga 345
>gb|CD234308.1|CD234308 SS1_26_B02.g1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_26_B02_A012 5', mRNA sequence
Length = 656
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 138 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 197
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 198 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 249
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 503 ctcggcgagtggttccagcacgagctgccggacccgt 539
>gb|CD236240.1|CD236240 SS1_32_H03.g1_A012 Salt-stressed seedlings Sorghum bicolor cDNA
clone SS1_32_H03_A012 5', mRNA sequence
Length = 570
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 86 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 145
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 146 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 197
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 451 ctcggcgagtggttccagcacgagctgccggacccgt 487
>gb|CN141757.1|CN141757 WOUND1_1_E01.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_1_E01_A002 5', mRNA sequence
Length = 256
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 94 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 153
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 154 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 205
>gb|CN141909.1|CN141909 WOUND1_2_D08.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_2_D08_A002 5', mRNA sequence
Length = 649
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 103 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 162
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 163 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 214
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 468 ctcggcgagtggttccagcacgagctgccggacccgt 504
>gb|CN142079.1|CN142079 WOUND1_3_E12.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_3_E12_A002 5', mRNA sequence
Length = 832
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 85 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 144
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 145 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 196
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 450 ctcggcgagtggttccagcacgagctgccggacccgt 486
Score = 44.1 bits (22), Expect = 0.034
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 785 atcgctggcgacatgtttgagagcattcca 814
||||| |||||||||||||||||| |||||
Sbjct: 780 atcgccggcgacatgtttgagagcgttcca 809
Score = 44.1 bits (22), Expect = 0.034
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 687 cccaagccatctcaaaggcgttcccgcacgtcaagtgtagcgtgct 732
|||| |||||| ||||||||||||||||| || | ||||| |||||
Sbjct: 682 cccaggccatcgcaaaggcgttcccgcacatcgaatgtagtgtgct 727
>gb|CN143379.1|CN143379 WOUND1_15_H07.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_15_H07_A002 5', mRNA sequence
Length = 702
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 31 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 90
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 91 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 142
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 396 ctcggcgagtggttccagcacgagctgccggacccgt 432
Score = 44.1 bits (22), Expect = 0.034
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 687 cccaagccatctcaaaggcgttcccgcacgtcaagtgtagcgtgct 732
|||| |||||| ||||||||||||||||| || | ||||| |||||
Sbjct: 628 cccaggccatcgcaaaggcgttcccgcacatcgaatgtagtgtgct 673
>gb|CN143714.1|CN143714 WOUND1_17_H12.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_17_H12_A002 5', mRNA sequence
Length = 592
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 84 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 143
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 144 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 195
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 449 ctcggcgagtggttccagcacgagctgccggacccgt 485
>gb|CN145362.1|CN145362 WOUND1_28_A10.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_28_A10_A002 5', mRNA sequence
Length = 648
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 71 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 130
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 131 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 182
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 436 ctcggcgagtggttccagcacgagctgccggacccgt 472
>gb|CN145372.1|CN145372 WOUND1_28_B08.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_28_B08_A002 5', mRNA sequence
Length = 618
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 43 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 102
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 103 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 154
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 408 ctcggcgagtggttccagcacgagctgccggacccgt 444
>gb|CN146609.1|CN146609 WOUND1_42_A04.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_42_A04_A002 5', mRNA sequence
Length = 710
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 81 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 140
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 141 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 192
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 392 ctcggcgagtggttccagcacgagctgccggacccgt 428
Score = 44.1 bits (22), Expect = 0.034
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 687 cccaagccatctcaaaggcgttcccgcacgtcaagtgtagcgtgct 732
|||| |||||| ||||||||||||||||| || | ||||| |||||
Sbjct: 624 cccaggccatcgcaaaggcgttcccgcacatcgaatgtagtgtgct 669
>gb|CN146754.1|CN146754 WOUND1_43_B07.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_43_B07_A002 5', mRNA sequence
Length = 775
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 33 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 92
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 93 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 144
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 398 ctcggcgagtggttccagcacgagctgccggacccgt 434
Score = 44.1 bits (22), Expect = 0.034
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 785 atcgctggcgacatgtttgagagcattcca 814
||||| |||||||||||||||||| |||||
Sbjct: 728 atcgccggcgacatgtttgagagcgttcca 757
Score = 44.1 bits (22), Expect = 0.034
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 687 cccaagccatctcaaaggcgttcccgcacgtcaagtgtagcgtgct 732
|||| |||||| ||||||||||||||||| || | ||||| |||||
Sbjct: 630 cccaggccatcgcaaaggcgttcccgcacatcgaatgtagtgtgct 675
>gb|CN147854.1|CN147854 WOUND1_52_E02.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_52_E02_A002 5', mRNA sequence
Length = 739
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 42 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 101
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 102 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 153
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 407 ctcggcgagtggttccagcacgagctgccggacccgt 443
Score = 44.1 bits (22), Expect = 0.034
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 687 cccaagccatctcaaaggcgttcccgcacgtcaagtgtagcgtgct 732
|||| |||||| ||||||||||||||||| || | ||||| |||||
Sbjct: 639 cccaggccatcgcaaaggcgttcccgcacatcgaatgtagtgtgct 684
>gb|CN148348.1|CN148348 WOUND1_55_G02.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_55_G02_A002 5', mRNA sequence
Length = 814
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 88 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 147
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 148 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 199
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 453 ctcggcgagtggttccagcacgagctgccggacccgt 489
Score = 44.1 bits (22), Expect = 0.034
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 785 atcgctggcgacatgtttgagagcattcca 814
||||| |||||||||||||||||| |||||
Sbjct: 783 atcgccggcgacatgtttgagagcgttcca 812
Score = 44.1 bits (22), Expect = 0.034
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 687 cccaagccatctcaaaggcgttcccgcacgtcaagtgtagcgtgct 732
|||| |||||| ||||||||||||||||| || | ||||| |||||
Sbjct: 685 cccaggccatcgcaaaggcgttcccgcacatcgaatgtagtgtgct 730
>gb|CN149132.1|CN149132 WOUND1_60_H10.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_60_H10_A002 5', mRNA sequence
Length = 861
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 90 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 149
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 150 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 201
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 455 ctcggcgagtggttccagcacgagctgccggacccgt 491
Score = 44.1 bits (22), Expect = 0.034
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 785 atcgctggcgacatgtttgagagcattcca 814
||||| |||||||||||||||||| |||||
Sbjct: 785 atcgccggcgacatgtttgagagcgttcca 814
Score = 44.1 bits (22), Expect = 0.034
Identities = 40/46 (86%)
Strand = Plus / Plus
Query: 687 cccaagccatctcaaaggcgttcccgcacgtcaagtgtagcgtgct 732
|||| |||||| ||||||||||||||||| || | ||||| |||||
Sbjct: 687 cccaggccatcgcaaaggcgttcccgcacatcgaatgtagtgtgct 732
>gb|CN150048.1|CN150048 WOUND1_66_C07.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_66_C07_A002 5', mRNA sequence
Length = 815
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 98 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 157
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 158 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 209
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 409 ctcggcgagtggttccagcacgagctgccggacccgt 445
Score = 44.1 bits (22), Expect = 0.034
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 785 atcgctggcgacatgtttgagagcattcca 814
||||| |||||||||||||||||| |||||
Sbjct: 739 atcgccggcgacatgtttgagagcgttcca 768
>gb|CN150084.1|CN150084 WOUND1_66_G08.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_66_G08_A002 5', mRNA sequence
Length = 824
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 213 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 272
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 273 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 324
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 578 ctcggcgagtggttccagcacgagctgccggacccgt 614
>gb|CN150092.1|CN150092 WOUND1_66_H05.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_66_H05_A002 5', mRNA sequence
Length = 678
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 151 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 210
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 211 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 262
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 516 ctcggcgagtggttccagcacgagctgccggacccgt 552
>gb|CN150096.1|CN150096 WOUND1_66_H09.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_66_H09_A002 5', mRNA sequence
Length = 661
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| |||||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 87 tgcttgatgctcagctccagctctggcaccacaccttcggctacatcaaatccatggcgc 146
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| || |||| |||||||||| ||||||||
Sbjct: 147 tcaaggccgcgctagacctccgcatccccgacgccatccaccagcatggcgg 198
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 458 ctcggcgcgtggttccagcacgagctcccagacccgt 494
||||||| |||||||||||||||||| || |||||||
Sbjct: 452 ctcggcgagtggttccagcacgagctgccggacccgt 488
>gb|CX618812.1|CX618812 GABR1_41_G07.g1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_41_G07_A002 5', mRNA sequence
Length = 405
Score = 63.9 bits (32), Expect = 4e-008
Identities = 92/112 (82%)
Strand = Plus / Plus
Query: 81 tgctcgatgcgcagctcgagctctggcacaccaccttcgcgttcatgaagtccatggcgc 140
|||| ||||| || ||| ||||||||||| |||||||| | ||| || ||||||||||
Sbjct: 65 tgcttgatgctcatctccagctctggcaccacaccttcggctacatcaaatccatggcgc 124
Query: 141 tcaagtccgcaatacacctccgaattgccgatgccatccacctccatggcgg 192
||||| |||| || ||||||| ||| |||| |||||||||| ||||||||
Sbjct: 125 tcaaggccgcgctagacctccgcattcccgacgccatccaccagcatggcgg 176
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 326,587
Number of Sequences: 832831
Number of extensions: 326587
Number of successful extensions: 91125
Number of sequences better than 0.5: 135
Number of HSP's better than 0.5 without gapping: 134
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 90608
Number of HSP's gapped (non-prelim): 508
length of query: 1366
length of database: 491,359,669
effective HSP length: 20
effective length of query: 1346
effective length of database: 474,703,049
effective search space: 638950303954
effective search space used: 638950303954
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)