BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419137.2.4
(591 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW215971.1|CW215971 104_648_11194859_116_37113_038 Sorgh... 351 5e-095
gb|CW287288.1|CW287288 104_765_11411337_116_35521_041 Sorgh... 351 5e-095
gb|CW378467.1|CW378467 fsbb001f057e01f0 Sorghum methylation... 351 5e-095
gb|BI211391.1|BI211391 IP1_60_B08.b1_A002 Immature pannicle... 351 5e-095
gb|BI211648.1|BI211648 IP1_60_B08.g1_A002 Immature pannicle... 351 5e-095
gb|BE917809.1|BE917809 OV1_7_D06.g1_A002 Ovary 1 (OV1) Sorg... 238 5e-061
gb|CF071266.1|CF071266 FE1_16_G05.g1_A002 Iron-deficient se... 194 6e-048
gb|BI245520.1|BI245520 IP1_66_D12.g1_A002 Immature pannicle... 155 5e-036
gb|CD228497.1|CD228497 CCC1_8_E03.b1_A007 Callus culture/ce... 155 5e-036
gb|BG239900.1|BG239900 OV1_30_D09.g1_A002 Ovary 1 (OV1) Sor... 103 2e-020
gb|BG240470.1|BG240470 OV1_30_D09.b1_A002 Ovary 1 (OV1) Sor... 103 2e-020
gb|CW027601.1|CW027601 104_254_10498609_116_30396 Sorghum m... 100 3e-019
gb|CW250209.1|CW250209 104_712_11223262_148_35057_091 Sorgh... 96 4e-018
gb|CX607618.1|CX607618 ANR1_29_F07.g1_A002 Anaerobic roots ... 96 4e-018
gb|CL177113.1|CL177113 104_384_10893611_116_31916_059 Sorgh... 92 7e-017
gb|CL188779.1|CL188779 104_405_10901830_114_32451_087 Sorgh... 92 7e-017
gb|CL194084.1|CL194084 104_418_10941375_114_32283_060 Sorgh... 92 7e-017
gb|CL194504.1|CL194504 104_419_10941680_116_32299_032 Sorgh... 92 7e-017
gb|CW111068.1|CW111068 104_484_11104094_116_34530_059 Sorgh... 92 7e-017
gb|CW111069.1|CW111069 104_484_11104094_148_34526_059 Sorgh... 92 7e-017
gb|CW123404.1|CW123404 104_502_11111195_148_34683_036 Sorgh... 92 7e-017
gb|CW249557.1|CW249557 104_711_11222913_116_35043_041 Sorgh... 92 7e-017
gb|CW249558.1|CW249558 104_711_11222913_148_35047_041 Sorgh... 92 7e-017
gb|CW260830.1|CW260830 104_727_11229178_148_35200_035 Sorgh... 92 7e-017
gb|CW313660.1|CW313660 104_804_11471403_148_35798_016 Sorgh... 92 7e-017
gb|CW314202.1|CW314202 104_804_11471700_148_35799_036 Sorgh... 92 7e-017
gb|CW317823.1|CW317823 104_809_11473619_148_35865_036 Sorgh... 92 7e-017
gb|CW348324.1|CW348324 fsbb001f008k10f0 Sorghum methylation... 92 7e-017
gb|CW348325.1|CW348325 fsbb001f008k10k0 Sorghum methylation... 92 7e-017
gb|CW402031.1|CW402031 fsbb001f093c09f0 Sorghum methylation... 92 7e-017
gb|CW406674.1|CW406674 fsbb001f099m19k0 Sorghum methylation... 92 7e-017
gb|CW450198.1|CW450198 fsbb001f188l14f0 Sorghum methylation... 92 7e-017
gb|CW459118.1|CW459118 fsbb001f205l11f0 Sorghum methylation... 92 7e-017
gb|CW488388.1|CW488388 fsbb001f254m08f0 Sorghum methylation... 92 7e-017
gb|CW496826.1|CW496826 fsbb001f289e08k0 Sorghum methylation... 92 7e-017
gb|CX608294.1|CX608294 ANR1_37_F09.g1_A002 Anaerobic roots ... 92 7e-017
gb|DN552702.1|DN552702 pSHR-RT-MR-H1_G01_C347 pSHR Sorghum ... 92 7e-017
gb|DN552703.1|DN552703 pSHR-RT-MR-H1_G04_C347 pSHR Sorghum ... 92 7e-017
gb|BG240749.1|BG240749 OV1_37_G08.g1_A002 Ovary 1 (OV1) Sor... 90 3e-016
gb|CX611966.1|CX611966 ANR1_27_F02.g1_A002 Anaerobic roots ... 90 3e-016
gb|CL185154.1|CL185154 104_399_10899330_114_32391_079 Sorgh... 88 1e-015
gb|CW271376.1|CW271376 104_743_11402966_148_35345_055 Sorgh... 88 1e-015
gb|CW368350.1|CW368350 fsbb001f042e13f0 Sorghum methylation... 88 1e-015
gb|CW368351.1|CW368351 fsbb001f042e13k0 Sorghum methylation... 88 1e-015
gb|CW392479.1|CW392479 fsbb001f079c02f0 Sorghum methylation... 88 1e-015
gb|CW450199.1|CW450199 fsbb001f188l14k0 Sorghum methylation... 88 1e-015
gb|CL705026.2|CL705026 SP__Bb0033N16.r SP__Bb Sorghum propi... 88 1e-015
gb|AW563480.1|AW563480 LG1_235_D11.b1_A002 Light Grown 1 (L... 88 1e-015
gb|BE355947.1|BE355947 DG1_11_F09.g1_A002 Dark Grown 1 (DG1... 88 1e-015
gb|BE356076.1|BE356076 DG1_122_G06.b1_A002 Dark Grown 1 (DG... 88 1e-015
gb|BE356129.1|BE356129 DG1_122_G06.g1_A002 Dark Grown 1 (DG... 88 1e-015
gb|BE361305.1|BE361305 DG1_71_C12.b1_A002 Dark Grown 1 (DG1... 88 1e-015
gb|BE361357.1|BE361357 DG1_71_C12.g1_A002 Dark Grown 1 (DG1... 88 1e-015
gb|CF430483.1|CF430483 PH1_28_C10.g1_A002 Phosphorous-defic... 88 1e-015
gb|CN124588.1|CN124588 RHOH1_5_F01.g1_A002 Acid- and alkali... 88 1e-015
gb|CN126022.1|CN126022 RHOH1_14_E11.g1_A002 Acid- and alkal... 88 1e-015
gb|CN126432.1|CN126432 RHOH1_17_D04.b1_A002 Acid- and alkal... 88 1e-015
gb|CN126516.1|CN126516 RHOH1_17_D04.g1_A002 Acid- and alkal... 88 1e-015
gb|CN129344.1|CN129344 RHOH1_34_H11.g1_A002 Acid- and alkal... 88 1e-015
gb|CN129907.1|CN129907 RHOH1_38_D11.b1_A002 Acid- and alkal... 88 1e-015
gb|CN129994.1|CN129994 RHOH1_38_D11.g1_A002 Acid- and alkal... 88 1e-015
gb|CN130934.1|CN130934 RHOH1_44_G10.g1_A002 Acid- and alkal... 88 1e-015
gb|CN131095.1|CN131095 RHOH1_45_G09.g1_A002 Acid- and alkal... 88 1e-015
gb|CN131143.1|CN131143 RHOH1_46_E02.b1_A002 Acid- and alkal... 88 1e-015
gb|CN131229.1|CN131229 RHOH1_46_E02.g1_A002 Acid- and alkal... 88 1e-015
gb|CX606062.1|CX606062 ANR1_1_A01.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX606092.1|CX606092 ANR1_1_C09.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX606150.1|CX606150 ANR1_1_A01.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606181.1|CX606181 ANR1_1_C09.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606267.1|CX606267 ANR1_2_C08.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX606356.1|CX606356 ANR1_2_C08.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606372.1|CX606372 ANR1_2_D12.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606375.1|CX606375 ANR1_2_E03.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606513.1|CX606513 ANR1_3_A10.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606576.1|CX606576 ANR1_3_G04.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606609.1|CX606609 ANR1_4_B04.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX606642.1|CX606642 ANR1_4_E04.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX606654.1|CX606654 ANR1_4_F05.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX606700.1|CX606700 ANR1_4_B04.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606722.1|CX606722 ANR1_4_D03.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606735.1|CX606735 ANR1_4_E04.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606748.1|CX606748 ANR1_4_F05.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606936.1|CX606936 ANR1_5_F09.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX606981.1|CX606981 ANR1_6_B07.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX607065.1|CX607065 ANR1_6_B07.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX607129.1|CX607129 ANR1_6_H01.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX607191.1|CX607191 ANR1_7_E06.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX607256.1|CX607256 ANR1_7_C03.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX607283.1|CX607283 ANR1_7_E06.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX607291.1|CX607291 ANR1_7_F02.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX607317.1|CX607317 ANR1_7_H04.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX607362.1|CX607362 ANR1_8_E05.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX607439.1|CX607439 ANR1_8_E05.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX607467.1|CX607467 ANR1_8_H03.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX607532.1|CX607532 ANR1_29_F07.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX607576.1|CX607576 ANR1_29_B10.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX607783.1|CX607783 ANR1_30_E09.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX607975.1|CX607975 ANR1_31_H05.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608135.1|CX608135 ANR1_32_H03.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608171.1|CX608171 ANR1_37_C10.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX608258.1|CX608258 ANR1_37_C06.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608262.1|CX608262 ANR1_37_C10.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608292.1|CX608292 ANR1_37_F07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608343.1|CX608343 ANR1_38_C02.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX608354.1|CX608354 ANR1_38_D01.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX608383.1|CX608383 ANR1_38_G03.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX608405.1|CX608405 ANR1_38_A07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608424.1|CX608424 ANR1_38_C02.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608435.1|CX608435 ANR1_38_D01.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608472.1|CX608472 ANR1_38_G03.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608488.1|CX608488 ANR1_38_H07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608648.1|CX608648 ANR1_39_H03.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608658.1|CX608658 ANR1_40_A04.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX608739.1|CX608739 ANR1_40_A04.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608758.1|CX608758 ANR1_40_C03.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608763.1|CX608763 ANR1_40_C08.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608775.1|CX608775 ANR1_40_D10.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608790.1|CX608790 ANR1_40_F04.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608805.1|CX608805 ANR1_40_G10.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608814.1|CX608814 ANR1_40_H09.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX608866.1|CX608866 ANR1_9_F05.b1_A002 Anaerobic roots S... 88 1e-015
gb|CX608897.1|CX608897 ANR1_9_A04.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX608923.1|CX608923 ANR1_9_C10.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX608925.1|CX608925 ANR1_9_C12.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX608953.1|CX608953 ANR1_9_F05.g1_A002 Anaerobic roots S... 88 1e-015
gb|CX609053.1|CX609053 ANR1_10_H06.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX609139.1|CX609139 ANR1_10_H06.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX609151.1|CX609151 ANR1_11_A09.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX609191.1|CX609191 ANR1_11_E07.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX609233.1|CX609233 ANR1_11_A09.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX609275.1|CX609275 ANR1_11_E07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX609330.1|CX609330 ANR1_12_B09.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX609410.1|CX609410 ANR1_12_B09.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX609411.1|CX609411 ANR1_12_B10.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX609524.1|CX609524 ANR1_13_E09.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX609705.1|CX609705 ANR1_14_F05.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX609710.1|CX609710 ANR1_14_F10.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX609791.1|CX609791 ANR1_14_F05.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX609796.1|CX609796 ANR1_14_F10.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX609925.1|CX609925 ANR1_15_C11.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX609933.1|CX609933 ANR1_15_D07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX610012.1|CX610012 ANR1_16_D04.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX610165.1|CX610165 ANR1_17_B07.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX610197.1|CX610197 ANR1_17_E08.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX610223.1|CX610223 ANR1_17_H01.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX610248.1|CX610248 ANR1_17_B07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX610283.1|CX610283 ANR1_17_E08.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX610310.1|CX610310 ANR1_17_H01.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX610389.1|CX610389 ANR1_18_H11.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX610414.1|CX610414 ANR1_18_C05.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX610467.1|CX610467 ANR1_18_H11.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX610670.1|CX610670 ANR1_20_D05.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX610680.1|CX610680 ANR1_20_E04.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX610704.1|CX610704 ANR1_20_G08.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX610754.1|CX610754 ANR1_20_D05.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX610765.1|CX610765 ANR1_20_E04.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX610791.1|CX610791 ANR1_20_G08.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX610876.1|CX610876 ANR1_21_G09.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX610967.1|CX610967 ANR1_21_H02.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611007.1|CX611007 ANR1_22_D01.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX611031.1|CX611031 ANR1_22_F03.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX611042.1|CX611042 ANR1_22_G04.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX611117.1|CX611117 ANR1_22_F03.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611255.1|CX611255 ANR1_23_C07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611290.1|CX611290 ANR1_23_G03.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611440.1|CX611440 ANR1_24_D11.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611531.1|CX611531 ANR1_25_E07.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX611614.1|CX611614 ANR1_25_E07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611633.1|CX611633 ANR1_25_G02.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611639.1|CX611639 ANR1_25_G08.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611668.1|CX611668 ANR1_26_B04.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX611750.1|CX611750 ANR1_26_B04.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611885.1|CX611885 ANR1_27_F11.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX611899.1|CX611899 ANR1_27_H02.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX611961.1|CX611961 ANR1_27_E09.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611974.1|CX611974 ANR1_27_F11.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611979.1|CX611979 ANR1_27_G04.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX611987.1|CX611987 ANR1_27_H02.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX612035.1|CX612035 ANR1_28_D08.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX612085.1|CX612085 ANR1_28_H10.b1_A002 Anaerobic roots ... 88 1e-015
gb|CX612094.1|CX612094 ANR1_28_A07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX612124.1|CX612124 ANR1_28_D07.g1_A002 Anaerobic roots ... 88 1e-015
gb|CX612172.1|CX612172 ANR1_28_H10.g1_A002 Anaerobic roots ... 88 1e-015
gb|CW260518.1|CW260518 104_727_11229009_148_35201_043 Sorgh... 86 4e-015
gb|CW266912.1|CW266912 104_736_11232692_148_35286_066 Sorgh... 86 4e-015
gb|CW385864.1|CW385864 fsbb001f069i05f0 Sorghum methylation... 86 4e-015
gb|BE361358.1|BE361358 DG1_71_C11.g1_A002 Dark Grown 1 (DG1... 86 4e-015
gb|CL177114.1|CL177114 104_384_10893611_148_31915_059 Sorgh... 84 2e-014
gb|CL194085.1|CL194085 104_418_10941375_116_32287_060 Sorgh... 84 2e-014
gb|CW191540.1|CW191540 104_613_11178549_116_36935_085 Sorgh... 84 2e-014
gb|CW284909.1|CW284909 104_762_11410051_148_35497_080 Sorgh... 84 2e-014
gb|CW319013.1|CW319013 104_811_11474260_148_35883_008 Sorgh... 84 2e-014
gb|AW565436.1|AW565436 LG1_344_G06.g1_A002 Light Grown 1 (L... 84 2e-014
gb|AW922628.1|AW922628 DG1_46_H09.b1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|AW922792.1|AW922792 DG1_46_H10.g1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|AW922793.1|AW922793 DG1_46_H09.g1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE125685.1|BE125685 DG1_54_A09.b1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE126205.1|BE126205 DG1_68_B12.b1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE357421.1|BE357421 DG1_15_H04.b2_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE357508.1|BE357508 DG1_20_H03.b2_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE358186.1|BE358186 DG1_26_A10.b2_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE358822.1|BE358822 DG1_32_E02.b1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE358849.1|BE358849 DG1_32_E02.g1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE360962.1|BE360962 DG1_68_B12.g1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE361786.1|BE361786 DG1_82_D09.b1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|BE361846.1|BE361846 DG1_82_D09.g1_A002 Dark Grown 1 (DG1... 84 2e-014
gb|CD223050.1|CD223050 CCC1_25_D01.g1_A007 Callus culture/c... 84 2e-014
gb|CX606183.1|CX606183 ANR1_1_C12.g1_A002 Anaerobic roots S... 84 2e-014
gb|CX606721.1|CX606721 ANR1_4_D02.g1_A002 Anaerobic roots S... 84 2e-014
gb|CX606842.1|CX606842 ANR1_5_F07.b1_A002 Anaerobic roots S... 84 2e-014
gb|CX606934.1|CX606934 ANR1_5_F07.g1_A002 Anaerobic roots S... 84 2e-014
gb|CX607021.1|CX607021 ANR1_6_F02.b1_A002 Anaerobic roots S... 84 2e-014
gb|CX607106.1|CX607106 ANR1_6_F02.g1_A002 Anaerobic roots S... 84 2e-014
gb|CX607542.1|CX607542 ANR1_29_G06.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX607546.1|CX607546 ANR1_29_G10.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX608004.1|CX608004 ANR1_32_C04.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX608047.1|CX608047 ANR1_32_G04.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX608202.1|CX608202 ANR1_37_F09.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX608514.1|CX608514 ANR1_39_B11.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX608593.1|CX608593 ANR1_39_B11.g1_A002 Anaerobic roots ... 84 2e-014
gb|CX609098.1|CX609098 ANR1_10_D07.g1_A002 Anaerobic roots ... 84 2e-014
gb|CX609189.1|CX609189 ANR1_11_E05.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX609355.1|CX609355 ANR1_12_E04.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX609439.1|CX609439 ANR1_12_E04.g1_A002 Anaerobic roots ... 84 2e-014
gb|CX609672.1|CX609672 ANR1_14_C02.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX609709.1|CX609709 ANR1_14_F09.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX610215.1|CX610215 ANR1_17_G03.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX610490.1|CX610490 ANR1_19_C01.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX610574.1|CX610574 ANR1_19_C01.g1_A002 Anaerobic roots ... 84 2e-014
gb|CX610815.1|CX610815 ANR1_21_A11.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX610898.1|CX610898 ANR1_21_A11.g1_A002 Anaerobic roots ... 84 2e-014
gb|CX611545.1|CX611545 ANR1_25_F11.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX611833.1|CX611833 ANR1_27_B01.b1_A002 Anaerobic roots ... 84 2e-014
gb|CX611920.1|CX611920 ANR1_27_B01.g1_A002 Anaerobic roots ... 84 2e-014
gb|CX612045.1|CX612045 ANR1_28_E06.b1_A002 Anaerobic roots ... 84 2e-014
gb|CW316273.1|CW316273 104_807_11472807_116_35842_054 Sorgh... 82 7e-014
gb|CX611576.1|CX611576 ANR1_25_A11.g1_A002 Anaerobic roots ... 82 7e-014
gb|CX611876.1|CX611876 ANR1_27_F02.b1_A002 Anaerobic roots ... 82 7e-014
gb|CW184166.1|CW184166 104_600_11165008_116_36684_058 Sorgh... 80 3e-013
gb|CW215321.1|CW215321 104_647_11194478_148_37163_053 Sorgh... 80 3e-013
gb|CW367098.1|CW367098 fsbb001f040g14f0 Sorghum methylation... 80 3e-013
gb|CW498034.1|CW498034 fsbb001f291b09f0 Sorghum methylation... 80 3e-013
gb|CF432697.1|CF432697 NIT1_18_G07.g1_A002 Nitrogen-deficie... 80 3e-013
gb|CX606285.1|CX606285 ANR1_2_E03.b1_A002 Anaerobic roots S... 80 3e-013
gb|CX606484.1|CX606484 ANR1_3_G04.b1_A002 Anaerobic roots S... 80 3e-013
gb|CX606844.1|CX606844 ANR1_5_F09.b1_A002 Anaerobic roots S... 80 3e-013
gb|CX607165.1|CX607165 ANR1_7_C03.b1_A002 Anaerobic roots S... 80 3e-013
gb|CX607198.1|CX607198 ANR1_7_F02.b1_A002 Anaerobic roots S... 80 3e-013
gb|CX607392.1|CX607392 ANR1_8_H03.b1_A002 Anaerobic roots S... 80 3e-013
gb|CX607435.1|CX607435 ANR1_8_D10.g1_A002 Anaerobic roots S... 80 3e-013
gb|CX607670.1|CX607670 ANR1_30_C03.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX607698.1|CX607698 ANR1_30_E09.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX607755.1|CX607755 ANR1_30_C03.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX607882.1|CX607882 ANR1_31_G10.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX607889.1|CX607889 ANR1_31_H05.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX608325.1|CX608325 ANR1_38_A07.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX608461.1|CX608461 ANR1_38_F04.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX608465.1|CX608465 ANR1_38_F08.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX608675.1|CX608675 ANR1_40_C03.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX608821.1|CX608821 ANR1_9_A04.b1_A002 Anaerobic roots S... 80 3e-013
gb|CX609057.1|CX609057 ANR1_10_H11.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX609588.1|CX609588 ANR1_13_C10.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX609611.1|CX609611 ANR1_13_E09.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX609847.1|CX609847 ANR1_15_C11.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX609854.1|CX609854 ANR1_15_D07.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX609987.1|CX609987 ANR1_16_A09.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX610072.1|CX610072 ANR1_16_A09.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX610100.1|CX610100 ANR1_16_D04.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX610340.1|CX610340 ANR1_18_C05.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX610648.1|CX610648 ANR1_20_B04.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX610730.1|CX610730 ANR1_20_B04.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX610880.1|CX610880 ANR1_21_H02.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX610889.1|CX610889 ANR1_21_A02.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX611093.1|CX611093 ANR1_22_D01.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX611153.1|CX611153 ANR1_23_A07.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX611235.1|CX611235 ANR1_23_A07.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX611351.1|CX611351 ANR1_24_D11.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX611392.1|CX611392 ANR1_24_H10.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX611481.1|CX611481 ANR1_24_H10.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX611548.1|CX611548 ANR1_25_G02.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX611553.1|CX611553 ANR1_25_G08.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX611872.1|CX611872 ANR1_27_E09.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX611890.1|CX611890 ANR1_27_G04.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX612034.1|CX612034 ANR1_28_D07.b1_A002 Anaerobic roots ... 80 3e-013
gb|CX612125.1|CX612125 ANR1_28_D08.g1_A002 Anaerobic roots ... 80 3e-013
gb|CX619659.1|CX619659 GABR1_47_A10.b1_A002 GA- or brassino... 80 3e-013
gb|CX622412.1|CX622412 GABR1_63_G03.g2_A002 GA- or brassino... 80 3e-013
gb|AW285189.1|AW285189 LG1_235_D11.g1_A002 Light Grown 1 (L... 78 1e-012
gb|CW387416.1|CW387416 fsbb001f071l22k0 Sorghum methylation... 76 4e-012
gb|BE125693.1|BE125693 DG1_54_A09.g1_A002 Dark Grown 1 (DG1... 76 4e-012
gb|BE125741.1|BE125741 DG1_55_C09.b1_A002 Dark Grown 1 (DG1... 76 4e-012
gb|BE359626.1|BE359626 DG1_54_A09.g2_A002 Dark Grown 1 (DG1... 76 4e-012
gb|CD222939.1|CD222939 CCC1_25_D01.b1_A007 Callus culture/c... 76 4e-012
gb|CX609795.1|CX609795 ANR1_14_F09.g1_A002 Anaerobic roots ... 76 4e-012
gb|CX610300.1|CX610300 ANR1_17_G03.g1_A002 Anaerobic roots ... 76 4e-012
gb|CX610434.1|CX610434 ANR1_18_E07.g1_A002 Anaerobic roots ... 76 4e-012
gb|CX610999.1|CX610999 ANR1_22_C04.b1_A002 Anaerobic roots ... 76 4e-012
gb|CX611027.1|CX611027 ANR1_22_E11.b1_A002 Anaerobic roots ... 76 4e-012
gb|CX611114.1|CX611114 ANR1_22_E11.g1_A002 Anaerobic roots ... 76 4e-012
gb|CX611492.1|CX611492 ANR1_25_A11.b1_A002 Anaerobic roots ... 76 4e-012
gb|CX611630.1|CX611630 ANR1_25_F11.g1_A002 Anaerobic roots ... 76 4e-012
gb|CW090171.1|CW090171 104_435_10949129_114_32596_065 Sorgh... 74 2e-011
gb|CW191541.1|CW191541 104_613_11178549_148_36936_085 Sorgh... 74 2e-011
gb|CW289976.1|CW289976 104_769_11412763_116_35555_080 Sorgh... 74 2e-011
gb|CW289977.1|CW289977 104_769_11412763_148_35559_080 Sorgh... 74 2e-011
gb|CW374586.1|CW374586 fsbb001f051i10f0 Sorghum methylation... 74 2e-011
gb|CW437807.1|CW437807 fsbb001f155b22f0 Sorghum methylation... 74 2e-011
gb|CW456387.1|CW456387 fsbb001f201l08k0 Sorghum methylation... 74 2e-011
gb|AW565765.1|AW565765 LG1_349_E05.g1_A002 Light Grown 1 (L... 74 2e-011
gb|AW283194.2|AW283194 LG1_224_A09.g1_A002 Light Grown 1 (L... 74 2e-011
gb|CD204516.1|CD204516 HS1_8_F04.g1_A012 Heat-shocked seedl... 74 2e-011
gb|CD234549.1|CD234549 SS1_14_D05.b1_A012 Salt-stressed see... 74 2e-011
gb|CD422971.1|CD422971 SA1_29_E03.g1_A002 Salicylic acid-tr... 74 2e-011
gb|CD431681.1|CD431681 ETH1_10_H07.b1_A002 Ethylene-treated... 74 2e-011
gb|CD431724.1|CD431724 ETH1_10_H07.g1_A002 Ethylene-treated... 74 2e-011
gb|CD432763.1|CD432763 ETH1_33_A08.b1_A002 Ethylene-treated... 74 2e-011
gb|CD463017.1|CD463017 ETH1_41_H06.g1_A002 Ethylene-treated... 74 2e-011
gb|CF430431.1|CF430431 PH1_28_C10.b1_A002 Phosphorous-defic... 74 2e-011
gb|CN137680.1|CN137680 OX1_58_G12.g1_A002 Oxidatively-stres... 74 2e-011
gb|CN148469.1|CN148469 WOUND1_56_F03.g1_A002 Wounded leaves... 74 2e-011
gb|CN150931.1|CN150931 WOUND1_72_H08.b1_A002 Wounded leaves... 74 2e-011
gb|CX608376.1|CX608376 ANR1_38_F08.b1_A002 Anaerobic roots ... 74 2e-011
gb|CX611499.1|CX611499 ANR1_25_B07.b1_A002 Anaerobic roots ... 74 2e-011
gb|CX611583.1|CX611583 ANR1_25_B07.g1_A002 Anaerobic roots ... 74 2e-011
gb|CX612767.1|CX612767 GABR1_4_G12.b1_A002 GA- or brassinol... 74 2e-011
gb|CW109507.1|CW109507 104_481_11098155_116_34507_004 Sorgh... 72 6e-011
gb|CW392480.1|CW392480 fsbb001f079c02k0 Sorghum methylation... 72 6e-011
gb|CW463335.1|CW463335 fsbb001f211o07k0 Sorghum methylation... 72 6e-011
gb|CN125934.1|CN125934 RHOH1_14_E11.b1_A002 Acid- and alkal... 72 6e-011
gb|CN130865.1|CN130865 RHOH1_44_G10.b1_A002 Acid- and alkal... 72 6e-011
gb|CX607359.1|CX607359 ANR1_8_D10.b1_A002 Anaerobic roots S... 72 6e-011
gb|CX607492.1|CX607492 ANR1_29_B10.b1_A002 Anaerobic roots ... 72 6e-011
gb|CX607968.1|CX607968 ANR1_31_G10.g1_A002 Anaerobic roots ... 72 6e-011
gb|CX608723.1|CX608723 ANR1_40_G10.b1_A002 Anaerobic roots ... 72 6e-011
gb|CX608733.1|CX608733 ANR1_40_H09.b1_A002 Anaerobic roots ... 72 6e-011
gb|CX610715.1|CX610715 ANR1_20_H09.b1_A002 Anaerobic roots ... 72 6e-011
gb|CW215320.1|CW215320 104_647_11194478_116_37164_053 Sorgh... 68 1e-009
gb|CF432650.1|CF432650 NIT1_18_G07.b1_A002 Nitrogen-deficie... 68 1e-009
gb|CX606428.1|CX606428 ANR1_3_A10.b1_A002 Anaerobic roots S... 68 1e-009
gb|CX609273.1|CX609273 ANR1_11_E05.g1_A002 Anaerobic roots ... 68 1e-009
gb|AW283979.1|AW283979 LG1_264_C07.g1_A002 Light Grown 1 (L... 66 4e-009
gb|AW564047.1|AW564047 LG1_281_B12.b1_A002 Light Grown 1 (L... 66 4e-009
gb|CN137068.1|CN137068 OX1_55_B03.b1_A002 Oxidatively-stres... 66 4e-009
gb|CN139577.1|CN139577 OX1_22_H05.g1_A002 Oxidatively-stres... 66 4e-009
gb|CN148404.1|CN148404 WOUND1_56_F03.b1_A002 Wounded leaves... 66 4e-009
gb|CN150445.1|CN150445 WOUND1_69_E11.b1_A002 Wounded leaves... 66 4e-009
gb|CN150519.1|CN150519 WOUND1_69_E11.g1_A002 Wounded leaves... 66 4e-009
gb|CX606093.1|CX606093 ANR1_1_C12.b1_A002 Anaerobic roots S... 66 4e-009
gb|AW922516.1|AW922516 DG1_20_H03.g1_A002 Dark Grown 1 (DG1... 64 2e-008
gb|BE592083.1|BE592083 LG1_224_A09.b2_A002 Light Grown 1 (L... 64 2e-008
gb|CX608054.1|CX608054 ANR1_32_H03.b1_A002 Anaerobic roots ... 64 2e-008
gb|CX609502.1|CX609502 ANR1_13_C10.b1_A002 Anaerobic roots ... 64 2e-008
gb|CX611030.1|CX611030 ANR1_22_F02.b1_A002 Anaerobic roots ... 64 2e-008
gb|CW207938.1|CW207938 104_637_11188415_148_37046_092 Sorgh... 62 6e-008
gb|CW374587.1|CW374587 fsbb001f051i10k0 Sorghum methylation... 62 6e-008
gb|CW475601.1|CW475601 fsbb001f232a14f0 Sorghum methylation... 62 6e-008
gb|AW287003.2|AW287003 LG1_264_C07.b1_A002 Light Grown 1 (L... 62 6e-008
gb|AW671646.1|AW671646 LG1_349_E05.b1_A002 Light Grown 1 (L... 62 6e-008
gb|BE361443.1|BE361443 DG1_72_D03.b1_A002 Dark Grown 1 (DG1... 62 6e-008
gb|BE361616.1|BE361616 DG1_72_D03.g1_A002 Dark Grown 1 (DG1... 62 6e-008
gb|BE362263.1|BE362263 DG1_85_B10.b1_A002 Dark Grown 1 (DG1... 62 6e-008
gb|BE362328.1|BE362328 DG1_85_B10.g1_A002 Dark Grown 1 (DG1... 62 6e-008
gb|CN124368.1|CN124368 RHOH1_4_F11.b1_A002 Acid- and alkali... 62 6e-008
gb|CN124443.1|CN124443 RHOH1_4_F11.g1_A002 Acid- and alkali... 62 6e-008
gb|CN139487.1|CN139487 OX1_22_H05.b1_A002 Oxidatively-stres... 62 6e-008
gb|CN140237.1|CN140237 OX1_35_A03.b1_A002 Oxidatively-stres... 62 6e-008
gb|CN151010.1|CN151010 WOUND1_72_H08.g1_A002 Wounded leaves... 62 6e-008
gb|CX606865.1|CX606865 ANR1_5_H09.b1_A002 Anaerobic roots S... 62 6e-008
gb|CX606959.1|CX606959 ANR1_5_H09.g1_A002 Anaerobic roots S... 62 6e-008
gb|CX608496.1|CX608496 ANR1_39_A04.b1_A002 Anaerobic roots ... 62 6e-008
gb|CX608578.1|CX608578 ANR1_39_A04.g1_A002 Anaerobic roots ... 62 6e-008
gb|CW231329.1|CW231329 104_680_11211059_116_37343_040 Sorgh... 60 2e-007
gb|CW284908.1|CW284908 104_762_11410051_116_35501_080 Sorgh... 60 2e-007
gb|CW305047.1|CW305047 104_790_11466110_116_37435_059 Sorgh... 60 2e-007
gb|AW283316.1|AW283316 LG1_281_B12.g1_A002 Light Grown 1 (L... 60 2e-007
gb|CX606629.1|CX606629 ANR1_4_D03.b1_A002 Anaerobic roots S... 60 2e-007
gb|CX608168.1|CX608168 ANR1_37_C06.b1_A002 Anaerobic roots ... 60 2e-007
gb|CX608504.1|CX608504 ANR1_39_B01.b1_A002 Anaerobic roots ... 60 2e-007
gb|CX612003.1|CX612003 ANR1_28_A07.b1_A002 Anaerobic roots ... 60 2e-007
gb|CW109508.1|CW109508 104_481_11098155_148_34503_004 Sorgh... 58 1e-006
gb|CW147878.1|CW147878 104_542_11140121_148_35006_075 Sorgh... 58 1e-006
gb|CW224565.1|CW224565 104_660_11203511_148_37194_082 Sorgh... 58 1e-006
gb|BF656586.1|BF656586 FM1_51_H11.g1_A003 Floral-Induced Me... 58 1e-006
gb|CX610521.1|CX610521 ANR1_19_F01.b1_A002 Anaerobic roots ... 58 1e-006
gb|CX610608.1|CX610608 ANR1_19_F01.g1_A002 Anaerobic roots ... 58 1e-006
gb|CW207937.1|CW207937 104_637_11188415_116_37043_092 Sorgh... 56 4e-006
gb|CW225507.1|CW225507 104_663_11204389_116_37211_061 Sorgh... 56 4e-006
gb|CW412229.1|CW412229 fsbb001f107m08f0 Sorghum methylation... 56 4e-006
gb|CW143516.1|CW143516 104_535_11137456_116_34953_058 Sorgh... 54 1e-005
gb|CW143517.1|CW143517 104_535_11137456_148_34957_058 Sorgh... 54 1e-005
gb|AW565772.1|AW565772 LG1_349_D08.g1_A002 Light Grown 1 (L... 54 1e-005
gb|AW922474.1|AW922474 DG1_19_C09.g1_A002 Dark Grown 1 (DG1... 54 1e-005
gb|BE125342.1|BE125342 DG1_19_C09.b1_A002 Dark Grown 1 (DG1... 54 1e-005
gb|BE125537.1|BE125537 DG1_27_C09.b1_A002 Dark Grown 1 (DG1... 54 1e-005
gb|BE356955.1|BE356955 DG1_145_F04.g1_A002 Dark Grown 1 (DG... 54 1e-005
gb|BE360952.1|BE360952 DG1_68_B01.g1_A002 Dark Grown 1 (DG1... 54 1e-005
gb|CX609554.1|CX609554 ANR1_13_H07.b1_A002 Anaerobic roots ... 54 1e-005
gb|CX609643.1|CX609643 ANR1_13_H07.g1_A002 Anaerobic roots ... 54 1e-005
gb|CX607628.1|CX607628 ANR1_29_G06.g1_A002 Anaerobic roots ... 52 6e-005
gb|CX608085.1|CX608085 ANR1_32_C04.g1_A002 Anaerobic roots ... 52 6e-005
gb|CX609755.1|CX609755 ANR1_14_C02.g1_A002 Anaerobic roots ... 52 6e-005
gb|CX611129.1|CX611129 ANR1_22_G04.g1_A002 Anaerobic roots ... 52 6e-005
gb|CX612135.1|CX612135 ANR1_28_E06.g1_A002 Anaerobic roots ... 52 6e-005
gb|CL167398.1|CL167398 104_364_10810050_114_31802_114 Sorgh... 50 2e-004
gb|CL177723.1|CL177723 104_385_10894028_148_31913_092 Sorgh... 50 2e-004
gb|CD232991.1|CD232991 SS1_11_G10.b1_A012 Salt-stressed see... 50 2e-004
gb|CD428171.1|CD428171 ETH1_28_H04.b1_A002 Ethylene-treated... 50 2e-004
gb|CF072206.1|CF072206 FE1_6_D06.b1_A002 Iron-deficient see... 50 2e-004
gb|CF432484.1|CF432484 NIT1_17_E06.b1_A002 Nitrogen-deficie... 50 2e-004
gb|CN124063.1|CN124063 RHOH1_2_H11.b1_A002 Acid- and alkali... 50 2e-004
gb|CN131106.1|CN131106 RHOH1_46_A02.b1_A002 Acid- and alkal... 50 2e-004
gb|CN137083.1|CN137083 OX1_55_C09.b1_A002 Oxidatively-stres... 50 2e-004
gb|CN138968.1|CN138968 OX1_15_F01.b1_A002 Oxidatively-stres... 50 2e-004
gb|CN141238.1|CN141238 OX1_50_E03.b1_A002 Oxidatively-stres... 50 2e-004
gb|CN144970.1|CN144970 WOUND1_26_B08.b2_A002 Wounded leaves... 50 2e-004
gb|CN145334.1|CN145334 WOUND1_28_F11.b2_A002 Wounded leaves... 50 2e-004
gb|CN152472.1|CN152472 WOUND1_82_G01.b1_A002 Wounded leaves... 50 2e-004
gb|CX607710.1|CX607710 ANR1_30_F11.b1_A002 Anaerobic roots ... 50 2e-004
gb|CX609999.1|CX609999 ANR1_16_B11.b1_A002 Anaerobic roots ... 50 2e-004
gb|CL173446.1|CL173446 104_377_10890876_116_31793_012 Sorgh... 48 0.001
gb|CL173447.1|CL173447 104_377_10890876_148_31792_012 Sorgh... 48 0.001
gb|CL181322.1|CL181322 104_392_10896668_148_31925_044 Sorgh... 48 0.001
gb|CW256058.1|CW256058 104_720_11226573_116_35402_081 Sorgh... 48 0.001
gb|CW256059.1|CW256059 104_720_11226573_148_35403_081 Sorgh... 48 0.001
gb|CW447078.1|CW447078 fsbb001f180a10f0 Sorghum methylation... 48 0.001
gb|AW283119.1|AW283119 LG1_225_A09.g1_A002 Light Grown 1 (L... 48 0.001
gb|CX608201.1|CX608201 ANR1_37_F07.b1_A002 Anaerobic roots ... 48 0.001
gb|CL148992.1|CL148992 104_329_10593471_148_31784_211 Sorgh... 46 0.004
gb|CW049065.1|CW049065 104_288_10513807_114_30200 Sorghum m... 46 0.004
gb|CW447079.1|CW447079 fsbb001f180a10k0 Sorghum methylation... 46 0.004
gb|BE359211.1|BE359211 DG1_39_C01.g1_A002 Dark Grown 1 (DG1... 46 0.004
gb|BE360467.1|BE360467 DG1_63_F07.g1_A002 Dark Grown 1 (DG1... 46 0.004
gb|BE362714.1|BE362714 DG1_88_D06.g1_A002 Dark Grown 1 (DG1... 46 0.004
gb|CW472407.1|CW472407 fsbb001f227f09f0 Sorghum methylation... 44 0.014
gb|AW285514.1|AW285514 LG1_241_E11.g1_A002 Light Grown 1 (L... 44 0.014
gb|AW283787.2|AW283787 LG1_255_F02.g1_A002 Light Grown 1 (L... 44 0.014
gb|AW565363.1|AW565363 LG1_343_C04.g1_A002 Light Grown 1 (L... 44 0.014
gb|AW677264.1|AW677264 DG1_6_C10.g1_A002 Dark Grown 1 (DG1)... 44 0.014
gb|AW923640.1|AW923640 DG1_56_C09.g1_A002 Dark Grown 1 (DG1... 44 0.014
gb|BE125068.1|BE125068 DG1_15_D11.b1_A002 Dark Grown 1 (DG1... 44 0.014
gb|BE125230.1|BE125230 DG1_16_G01.b1_A002 Dark Grown 1 (DG1... 44 0.014
gb|BE356503.1|BE356503 DG1_125_G04.g1_A002 Dark Grown 1 (DG... 44 0.014
gb|BE357145.1|BE357145 DG1_147_D10.b1_A002 Dark Grown 1 (DG... 44 0.014
gb|BE357212.1|BE357212 DG1_147_D10.g1_A002 Dark Grown 1 (DG... 44 0.014
gb|BE357294.1|BE357294 DG1_148_B12.b1_A002 Dark Grown 1 (DG... 44 0.014
gb|BE357363.1|BE357363 DG1_148_B12.g1_A002 Dark Grown 1 (DG... 44 0.014
gb|BE357447.1|BE357447 DG1_15_D11.b2_A002 Dark Grown 1 (DG1... 44 0.014
gb|BE358659.1|BE358659 DG1_30_E01.g1_A002 Dark Grown 1 (DG1... 44 0.014
gb|BE358728.1|BE358728 DG1_31_D06.g1_A002 Dark Grown 1 (DG1... 44 0.014
gb|BE359643.1|BE359643 DG1_56_C09.b2_A002 Dark Grown 1 (DG1... 44 0.014
gb|BE359764.1|BE359764 DG1_56_C09.g2_A002 Dark Grown 1 (DG1... 44 0.014
gb|BE362845.1|BE362845 DG1_89_F06.g2_A002 Dark Grown 1 (DG1... 44 0.014
gb|BG051102.1|BG051102 FM1_56_C10.b1_A003 Floral-Induced Me... 44 0.014
gb|BG051103.1|BG051103 FM1_56_C11.b1_A003 Floral-Induced Me... 44 0.014
gb|BG051426.1|BG051426 FM1_56_C10.g1_A003 Floral-Induced Me... 44 0.014
gb|BG051427.1|BG051427 FM1_56_C11.g1_A003 Floral-Induced Me... 44 0.014
gb|BG053435.1|BG053435 RHIZ2_8_G12.g1_A003 Rhizome2 (RHIZ2)... 44 0.014
gb|BG053622.1|BG053622 RHIZ2_11_F12.g1_A003 Rhizome2 (RHIZ2... 44 0.014
gb|BG053711.1|BG053711 RHIZ2_8_G12.b1_A003 Rhizome2 (RHIZ2)... 44 0.014
gb|BG053923.1|BG053923 RHIZ2_11_F12.b1_A003 Rhizome2 (RHIZ2... 44 0.014
gb|BG102016.1|BG102016 RHIZ2_23_G12.g1_A003 Rhizome2 (RHIZ2... 44 0.014
gb|BG102051.1|BG102051 RHIZ2_24_C03.g1_A003 Rhizome2 (RHIZ2... 44 0.014
gb|BG102239.1|BG102239 RHIZ2_23_G12.b1_A003 Rhizome2 (RHIZ2... 44 0.014
gb|BG487884.1|BG487884 RHIZ2_60_E09.g1_A003 Rhizome2 (RHIZ2... 44 0.014
gb|BG488183.1|BG488183 RHIZ2_60_E09.b1_A003 Rhizome2 (RHIZ2... 44 0.014
gb|BG947206.1|BG947206 IP1_3_G08.g1_A002 Immature pannicle ... 44 0.014
gb|CD427650.1|CD427650 SA1_37_F04.g1_A002 Salicylic acid-tr... 44 0.014
gb|CD430267.1|CD430267 ETH1_17_G01.g1_A002 Ethylene-treated... 44 0.014
gb|CD431997.1|CD431997 ETH1_12_A06.b1_A002 Ethylene-treated... 44 0.014
gb|CD432050.1|CD432050 ETH1_12_A06.g1_A002 Ethylene-treated... 44 0.014
gb|CD432450.1|CD432450 ETH1_30_G04.b1_A002 Ethylene-treated... 44 0.014
gb|CD432546.1|CD432546 ETH1_30_G04.g1_A002 Ethylene-treated... 44 0.014
gb|CN129258.1|CN129258 RHOH1_34_H11.b3_A002 Acid- and alkal... 44 0.014
gb|CN133606.1|CN133606 OX1_17_F03.b1_A002 Oxidatively-stres... 44 0.014
gb|CN133689.1|CN133689 OX1_17_F03.g1_A002 Oxidatively-stres... 44 0.014
gb|CN133784.1|CN133784 OX1_18_G05.b1_A002 Oxidatively-stres... 44 0.014
gb|CN133867.1|CN133867 OX1_18_G05.g1_A002 Oxidatively-stres... 44 0.014
gb|CN134570.1|CN134570 OX1_27_E01.b1_A002 Oxidatively-stres... 44 0.014
gb|CN134579.1|CN134579 OX1_27_E12.b1_A002 Oxidatively-stres... 44 0.014
gb|CN134657.1|CN134657 OX1_27_E01.g1_A002 Oxidatively-stres... 44 0.014
gb|CN134667.1|CN134667 OX1_27_E12.g1_A002 Oxidatively-stres... 44 0.014
gb|CN134734.1|CN134734 OX1_28_D04.b1_A002 Oxidatively-stres... 44 0.014
gb|CN134808.1|CN134808 OX1_28_D04.g1_A002 Oxidatively-stres... 44 0.014
gb|CN137055.1|CN137055 OX1_55_A02.b1_A002 Oxidatively-stres... 44 0.014
gb|CN137069.1|CN137069 OX1_55_B05.b1_A002 Oxidatively-stres... 44 0.014
gb|CN137138.1|CN137138 OX1_55_A02.g1_A002 Oxidatively-stres... 44 0.014
gb|CN137509.1|CN137509 OX1_57_F06.g1_A002 Oxidatively-stres... 44 0.014
gb|CN140188.1|CN140188 OX1_34_D03.g1_A002 Oxidatively-stres... 44 0.014
gb|CN140601.1|CN140601 OX1_45_A07.g1_A002 Oxidatively-stres... 44 0.014
gb|CN141004.1|CN141004 OX1_48_F02.g1_A002 Oxidatively-stres... 44 0.014
gb|CN141374.1|CN141374 OX1_51_D04.b1_A002 Oxidatively-stres... 44 0.014
gb|CN144674.1|CN144674 WOUND1_23_F12.g1_A002 Wounded leaves... 44 0.014
gb|CN147763.1|CN147763 WOUND1_51_H11.g1_A002 Wounded leaves... 44 0.014
gb|CN148443.1|CN148443 WOUND1_56_C03.g1_A002 Wounded leaves... 44 0.014
gb|CN149632.1|CN149632 WOUND1_64_A10.b1_A002 Wounded leaves... 44 0.014
gb|CN149714.1|CN149714 WOUND1_64_A10.g1_A002 Wounded leaves... 44 0.014
gb|CN150451.1|CN150451 WOUND1_69_F06.b1_A002 Wounded leaves... 44 0.014
gb|CN150525.1|CN150525 WOUND1_69_F06.g1_A002 Wounded leaves... 44 0.014
gb|CX607632.1|CX607632 ANR1_29_G10.g1_A002 Anaerobic roots ... 44 0.014
gb|CX608127.1|CX608127 ANR1_32_G04.g1_A002 Anaerobic roots ... 44 0.014
>gb|CW215971.1|CW215971 104_648_11194859_116_37113_038 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11194859, DNA
sequence
Length = 604
Score = 351 bits (177), Expect = 5e-095
Identities = 234/253 (92%)
Strand = Plus / Plus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 306 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 365
Query: 209 tgggcaggttgaggttgatgcccaggacgttggccctgaggacggtgcagaggcacaccg 268
|||| |||||||||||||||||||||| |||||| | || |||||||||| |||||||
Sbjct: 366 tggggaggttgaggttgatgcccaggatgttggctcgcagcgcggtgcagagacacaccg 425
Query: 269 ccgcctccaggtccgccagcccctggatcagcgtgcagcacggcgtcctgggcggcgtcc 328
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 426 ccgcctcaaggtccgccagcccctggatcagcgtgcagcacggcgtcctcggcggtgtcc 485
Query: 329 ccagggtcgcgttgatcagcccgttcagcaagttggcgcacacgcccagcttcagcgcgt 388
||||| || ||||||||||||||||||||| ||||||||||||||||| |||||||| ||
Sbjct: 486 ccaggttcacgttgatcagcccgttcagcacgttggcgcacacgcccaacttcagcgtgt 545
Query: 389 ccacggggcaacg 401
|||| ||||||||
Sbjct: 546 ccacagggcaacg 558
>gb|CW287288.1|CW287288 104_765_11411337_116_35521_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11411337, DNA
sequence
Length = 682
Score = 351 bits (177), Expect = 5e-095
Identities = 234/253 (92%)
Strand = Plus / Plus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 11 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 70
Query: 209 tgggcaggttgaggttgatgcccaggacgttggccctgaggacggtgcagaggcacaccg 268
|||| |||||||||||||||||||||| |||||| | || |||||||||| |||||||
Sbjct: 71 tggggaggttgaggttgatgcccaggatgttggctcgcagcgcggtgcagagacacaccg 130
Query: 269 ccgcctccaggtccgccagcccctggatcagcgtgcagcacggcgtcctgggcggcgtcc 328
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 131 ccgcctcaaggtccgccagcccctggatcagcgtgcagcacggcgtcctcggcggtgtcc 190
Query: 329 ccagggtcgcgttgatcagcccgttcagcaagttggcgcacacgcccagcttcagcgcgt 388
||||| || ||||||||||||||||||||| ||||||||||||||||| |||||||| ||
Sbjct: 191 ccaggttcacgttgatcagcccgttcagcacgttggcgcacacgcccaacttcagcgtgt 250
Query: 389 ccacggggcaacg 401
|||| ||||||||
Sbjct: 251 ccacagggcaacg 263
>gb|CW378467.1|CW378467 fsbb001f057e01f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f057e01, DNA
sequence
Length = 603
Score = 351 bits (177), Expect = 5e-095
Identities = 234/253 (92%)
Strand = Plus / Plus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 180 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 239
Query: 209 tgggcaggttgaggttgatgcccaggacgttggccctgaggacggtgcagaggcacaccg 268
|||| |||||||||||||||||||||| |||||| | || |||||||||| |||||||
Sbjct: 240 tggggaggttgaggttgatgcccaggatgttggctcgcagcgcggtgcagagacacaccg 299
Query: 269 ccgcctccaggtccgccagcccctggatcagcgtgcagcacggcgtcctgggcggcgtcc 328
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 300 ccgcctcaaggtccgccagcccctggatcagcgtgcagcacggcgtcctcggcggtgtcc 359
Query: 329 ccagggtcgcgttgatcagcccgttcagcaagttggcgcacacgcccagcttcagcgcgt 388
||||| || ||||||||||||||||||||| ||||||||||||||||| |||||||| ||
Sbjct: 360 ccaggttcacgttgatcagcccgttcagcacgttggcgcacacgcccaacttcagcgtgt 419
Query: 389 ccacggggcaacg 401
|||| ||||||||
Sbjct: 420 ccacagggcaacg 432
>gb|BI211391.1|BI211391 IP1_60_B08.b1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 509
Score = 351 bits (177), Expect = 5e-095
Identities = 234/253 (92%)
Strand = Plus / Minus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 229
Query: 209 tgggcaggttgaggttgatgcccaggacgttggccctgaggacggtgcagaggcacaccg 268
|||| |||||||||||||||||||||| |||||| | || |||||||||| |||||||
Sbjct: 228 tggggaggttgaggttgatgcccaggatgttggctcgcagcgcggtgcagagacacaccg 169
Query: 269 ccgcctccaggtccgccagcccctggatcagcgtgcagcacggcgtcctgggcggcgtcc 328
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 168 ccgcctcaaggtccgccagcccctggatcagcgtgcagcacggcgtcctcggcggtgtcc 109
Query: 329 ccagggtcgcgttgatcagcccgttcagcaagttggcgcacacgcccagcttcagcgcgt 388
||||| || ||||||||||||||||||||| ||||||||||||||||| |||||||| ||
Sbjct: 108 ccaggttcacgttgatcagcccgttcagcacgttggcgcacacgcccaacttcagcgtgt 49
Query: 389 ccacggggcaacg 401
|||| ||||||||
Sbjct: 48 ccacagggcaacg 36
>gb|BI211648.1|BI211648 IP1_60_B08.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 500
Score = 351 bits (177), Expect = 5e-095
Identities = 234/253 (92%)
Strand = Plus / Minus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 229
Query: 209 tgggcaggttgaggttgatgcccaggacgttggccctgaggacggtgcagaggcacaccg 268
|||| |||||||||||||||||||||| |||||| | || |||||||||| |||||||
Sbjct: 228 tggggaggttgaggttgatgcccaggatgttggctcgcagcgcggtgcagagacacaccg 169
Query: 269 ccgcctccaggtccgccagcccctggatcagcgtgcagcacggcgtcctgggcggcgtcc 328
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||
Sbjct: 168 ccgcctcaaggtccgccagcccctggatcagcgtgcagcacggcgtcctcggcggtgtcc 109
Query: 329 ccagggtcgcgttgatcagcccgttcagcaagttggcgcacacgcccagcttcagcgcgt 388
||||| || ||||||||||||||||||||| ||||||||||||||||| |||||||| ||
Sbjct: 108 ccaggttcacgttgatcagcccgttcagcacgttggcgcacacgcccaacttcagcgtgt 49
Query: 389 ccacggggcaacg 401
|||| ||||||||
Sbjct: 48 ccacagggcaacg 36
>gb|BE917809.1|BE917809 OV1_7_D06.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA sequence
Length = 355
Score = 238 bits (120), Expect = 5e-061
Identities = 171/188 (90%)
Strand = Plus / Minus
Query: 214 aggttgaggttgatgcccaggacgttggccctgaggacggtgcagaggcacaccgccgcc 273
||||||||||||||||||| || |||||| | || |||||||||| ||||||||||||
Sbjct: 354 aggttgaggttgatgcccatgatgttggctcgcagcgcggtgcagagacacaccgccgcc 295
Query: 274 tccaggtccgccagcccctggatcagcgtgcagcacggcgtcctgggcggcgtccccagg 333
|| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 294 tcaaggtccgccagcccctggatcagcgtgcagcacggcgtcctcggcggtgtccccagg 235
Query: 334 gtcgcgttgatcagcccgttcagcaagttggcgcacacgcccagcttcagcgcgtccacg 393
|| ||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||
Sbjct: 234 ttcacgttgatcagcccgttcagcacgttggcgcacacgcccaacttcagcgtgtccaca 175
Query: 394 gggcaacg 401
||||||||
Sbjct: 174 gggcaacg 167
>gb|CF071266.1|CF071266 FE1_16_G05.g1_A002 Iron-deficient seedlings Sorghum bicolor cDNA
clone FE1_16_G05_A002 5', mRNA sequence
Length = 366
Score = 194 bits (98), Expect = 6e-048
Identities = 137/150 (91%)
Strand = Plus / Plus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 217 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 276
Query: 209 tgggcaggttgaggttgatgcccaggacgttggccctgaggacggtgcagaggcacaccg 268
|||| ||||||||||||||||||| || |||||| | || |||||||||| |||||||
Sbjct: 277 tggggaggttgaggttgatgcccacgatgttggctcgcagcgcggtgcagagacacaccg 336
Query: 269 ccgcctccaggtccgccagcccctggatca 298
|||||| ||||||||||||||||||||||
Sbjct: 337 gcgcctcaaggtccgccagcccctggatca 366
>gb|BI245520.1|BI245520 IP1_66_D12.g1_A002 Immature pannicle 1 (IP1) Sorghum bicolor cDNA,
mRNA sequence
Length = 558
Score = 155 bits (78), Expect = 5e-036
Identities = 90/94 (95%)
Strand = Plus / Minus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 113 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 54
Query: 209 tgggcaggttgaggttgatgcccaggacgttggc 242
|||| |||||||||||||||||||||| ||||||
Sbjct: 53 tggggaggttgaggttgatgcccaggatgttggc 20
>gb|CD228497.1|CD228497 CCC1_8_E03.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_8_E03_A007 3', mRNA sequence
Length = 553
Score = 155 bits (78), Expect = 5e-036
Identities = 90/94 (95%)
Strand = Plus / Minus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 104 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 45
Query: 209 tgggcaggttgaggttgatgcccaggacgttggc 242
|||| |||||||||||||||||||||| ||||||
Sbjct: 44 tggggaggttgaggttgatgcccaggatgttggc 11
>gb|BG239900.1|BG239900 OV1_30_D09.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 624
Score = 103 bits (52), Expect = 2e-020
Identities = 58/60 (96%)
Strand = Plus / Minus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 117
>gb|BG240470.1|BG240470 OV1_30_D09.b1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 535
Score = 103 bits (52), Expect = 2e-020
Identities = 58/60 (96%)
Strand = Plus / Minus
Query: 149 agcactggaagcccgatgggacgcgcctgccgcagtagttgacgaggaggctgaggttga 208
|||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 372 agcactggaatcccgaggggacgcgcctgccgcagtagttgacgaggaggctgaggttga 313
>gb|CW027601.1|CW027601 104_254_10498609_116_30396 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10498609, DNA
sequence
Length = 788
Score = 99.6 bits (50), Expect = 3e-019
Identities = 92/106 (86%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 468 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 409
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | ||||||||||||| || || |||||||||||
Sbjct: 408 cgttggccttgatggcggtgcagaggcagacggcggcctccaggtc 363
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 286 ttggcgcacacgcccagcttca 265
>gb|CW250209.1|CW250209 104_712_11223262_148_35057_091 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11223262, DNA
sequence
Length = 621
Score = 95.6 bits (48), Expect = 4e-018
Identities = 60/64 (93%)
Strand = Plus / Minus
Query: 338 cgttgatcagcccgttcagcaagttggcgcacacgcccagcttcagcgcgtccacggggc 397
||||||||||||||||||||| ||||||||||||||||| |||||||| |||||| ||||
Sbjct: 615 cgttgatcagcccgttcagcacgttggcgcacacgcccaacttcagcgtgtccacagggc 556
Query: 398 aacg 401
||||
Sbjct: 555 aacg 552
>gb|CX607618.1|CX607618 ANR1_29_F07.g1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_29_F07_A002 5', mRNA sequence
Length = 718
Score = 95.6 bits (48), Expect = 4e-018
Identities = 78/88 (88%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 438 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 379
Query: 236 cgttggccctgaggacggtgcagaggca 263
||||||||||| | |||||||||||||
Sbjct: 378 tgttggccctgatggcggtgcagaggca 351
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 269 gttcagcacgttggcacacacctccagcttcagcgcgt 232
>gb|CL177113.1|CL177113 104_384_10893611_116_31916_059 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10893611, DNA
sequence
Length = 723
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 553 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 612
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 613 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 658
>gb|CL188779.1|CL188779 104_405_10901830_114_32451_087 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10901830, DNA
sequence
Length = 364
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 114 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 173
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 174 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 219
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 289 cagcacgttggcgcacacgcccagcttcaacgcgtcc 325
>gb|CL194084.1|CL194084 104_418_10941375_114_32283_060 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10941375, DNA
sequence
Length = 711
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 623 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 564
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 563 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 518
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Minus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 448 cagcacgttggcgcacacgcccagcttcaacgcgtcc 412
>gb|CL194504.1|CL194504 104_419_10941680_116_32299_032 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10941680, DNA
sequence
Length = 667
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 95 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 154
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 155 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 200
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 270 cagcacgttggcgcacacgcccagcttcaacgcgtcc 306
>gb|CW111068.1|CW111068 104_484_11104094_116_34530_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11104094, DNA
sequence
Length = 565
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 483 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 424
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 423 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 378
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 301 ttggcgcacacgcccagcttca 280
>gb|CW111069.1|CW111069 104_484_11104094_148_34526_059 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11104094, DNA
sequence
Length = 652
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 327 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 386
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 387 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 432
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 509 ttggcgcacacgcccagcttca 530
>gb|CW123404.1|CW123404 104_502_11111195_148_34683_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11111195, DNA
sequence
Length = 572
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 42 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 101
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 102 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 147
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 224 ttggcgcacacgcccagcttca 245
>gb|CW249557.1|CW249557 104_711_11222913_116_35043_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11222913, DNA
sequence
Length = 766
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 582 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 641
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 642 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 687
>gb|CW249558.1|CW249558 104_711_11222913_148_35047_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11222913, DNA
sequence
Length = 779
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 422 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 363
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 362 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 317
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Minus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 247 cagcacgttggcgcacacgcccagcttcaacgcgtcc 211
>gb|CW260830.1|CW260830 104_727_11229178_148_35200_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11229178, DNA
sequence
Length = 618
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 305 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 364
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 365 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 410
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 480 cagcacgttggcgcacacgcccagcttcaacgcgtcc 516
>gb|CW313660.1|CW313660 104_804_11471403_148_35798_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11471403, DNA
sequence
Length = 705
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 91 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 150
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 151 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 196
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 273 ttggcgcacacgcccagcttca 294
>gb|CW314202.1|CW314202 104_804_11471700_148_35799_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11471700, DNA
sequence
Length = 662
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 191 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 250
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 251 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 296
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 373 ttggcgcacacgcccagcttca 394
>gb|CW317823.1|CW317823 104_809_11473619_148_35865_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11473619, DNA
sequence
Length = 707
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 86 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 145
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 146 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 191
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 261 cagcacgttggcgcacacgcccagcttcaacgcgtcc 297
>gb|CW348324.1|CW348324 fsbb001f008k10f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f008k10, DNA
sequence
Length = 782
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 563 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 622
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 623 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 668
>gb|CW348325.1|CW348325 fsbb001f008k10k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f008k10, DNA
sequence
Length = 655
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 446 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 387
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 386 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 341
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 264 ttggcgcacacgcccagcttca 243
>gb|CW402031.1|CW402031 fsbb001f093c09f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f093c09, DNA
sequence
Length = 626
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 109 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 168
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 169 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 214
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 291 ttggcgcacacgcccagcttca 312
>gb|CW406674.1|CW406674 fsbb001f099m19k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f099m19, DNA
sequence
Length = 574
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 90 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 149
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 150 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 195
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 265 cagcacgttggcgcacacgcccagcttcaacgcgtcc 301
>gb|CW450198.1|CW450198 fsbb001f188l14f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f188l14, DNA
sequence
Length = 632
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 248 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 307
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 308 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 353
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 430 ttggcgcacacgcccagcttca 451
>gb|CW459118.1|CW459118 fsbb001f205l11f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f205l11, DNA
sequence
Length = 520
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 233 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 292
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 293 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 338
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 408 cagcacgttggcgcacacgcccagcttcaacgcgtcc 444
>gb|CW488388.1|CW488388 fsbb001f254m08f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f254m08, DNA
sequence
Length = 704
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 420 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 479
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 480 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 525
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 595 cagcacgttggcgcacacgcccagcttcaacgcgtcc 631
>gb|CW496826.1|CW496826 fsbb001f289e08k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f289e08, DNA
sequence
Length = 660
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||
Sbjct: 38 tgccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgagga 97
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 98 cgttggccttgatggcggtgcagagacagacggcggcctccaggtc 143
Score = 58.0 bits (29), Expect = 1e-006
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 354 cagcaagttggcgcacacgcccagcttcagcgcgtcc 390
||||| ||||||||||||||||||||||| |||||||
Sbjct: 213 cagcacgttggcgcacacgcccagcttcaacgcgtcc 249
>gb|CX608294.1|CX608294 ANR1_37_F09.g1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_37_F09_A002 5', mRNA sequence
Length = 575
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
|||| |||| ||||| || ||||||||||| |||||| ||||| ||||||||||| ||||
Sbjct: 413 tgccacagttgttgaggatgaggctgaggtcgatggggaggttcaggttgatgccgagga 354
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
||||||||||| ||||||||||||| || || |||||||||||
Sbjct: 353 tgttggccctgatagcggtgcagaggcagacggcggcctccaggtc 308
Score = 52.0 bits (26), Expect = 6e-005
Identities = 29/30 (96%)
Strand = Plus / Minus
Query: 354 cagcaagttggcgcacacgcccagcttcag 383
||||| ||||||||||||||||||||||||
Sbjct: 237 cagcacgttggcgcacacgcccagcttcag 208
>gb|DN552702.1|DN552702 pSHR-RT-MR-H1_G01_C347 pSHR Sorghum halepense cDNA, mRNA sequence
Length = 520
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
|||| |||| ||||| || ||||||||||| |||||| ||||| ||||||||||| ||||
Sbjct: 341 tgccacagttgttgaggatgaggctgaggtcgatggggaggttcaggttgatgccgagga 400
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
||||||| ||| | ||||||||||||| || || |||||||||||
Sbjct: 401 tgttggccttgatggcggtgcagaggcagacggcggcctccaggtc 446
>gb|DN552703.1|DN552703 pSHR-RT-MR-H1_G04_C347 pSHR Sorghum halepense cDNA, mRNA sequence
Length = 520
Score = 91.7 bits (46), Expect = 7e-017
Identities = 91/106 (85%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
|||| |||| ||||| || ||||||||||| |||||| ||||| ||||||||||| ||||
Sbjct: 341 tgccacagttgttgaggatgaggctgaggtcgatggggaggttcaggttgatgccgagga 400
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
||||||| ||| | ||||||||||||| || || |||||||||||
Sbjct: 401 tgttggccttgatggcggtgcagaggcagacggcggcctccaggtc 446
>gb|BG240749.1|BG240749 OV1_37_G08.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA
sequence
Length = 157
Score = 89.7 bits (45), Expect = 3e-016
Identities = 57/61 (93%)
Strand = Plus / Minus
Query: 341 tgatcagcccgttcagcaagttggcgcacacgcccagcttcagcgcgtccacggggcaac 400
|||||||||||||||||| ||||||||||||||||| |||||||| |||||| |||||||
Sbjct: 151 tgatcagcccgttcagcacgttggcgcacacgcccaacttcagcgtgtccacagggcaac 92
Query: 401 g 401
|
Sbjct: 91 g 91
>gb|CX611966.1|CX611966 ANR1_27_F02.g1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_27_F02_A002 5', mRNA sequence
Length = 804
Score = 89.7 bits (45), Expect = 3e-016
Identities = 99/117 (84%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 437 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 378
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtccgccagcccct 292
||||||| ||| | ||||||||||||| || || || || |||||| |||| ||||
Sbjct: 377 tgttggccttgatggcggtgcagaggcagacggcggcgtctaggtccaccaggccct 321
>gb|CL185154.1|CL185154 104_399_10899330_114_32391_079 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10899330, DNA
sequence
Length = 742
Score = 87.7 bits (44), Expect = 1e-015
Identities = 77/88 (87%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 74 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 133
Query: 236 cgttggccctgaggacggtgcagaggca 263
||||||| ||| | |||||||||||||
Sbjct: 134 tgttggccttgatggcggtgcagaggca 161
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 243 gttcagcacgttggcacacacctccagcttcagcgcgt 280
>gb|CW271376.1|CW271376 104_743_11402966_148_35345_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11402966, DNA
sequence
Length = 699
Score = 87.7 bits (44), Expect = 1e-015
Identities = 77/88 (87%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 166 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 225
Query: 236 cgttggccctgaggacggtgcagaggca 263
||||||| ||| | |||||||||||||
Sbjct: 226 tgttggccttgatggcggtgcagaggca 253
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 335 gttcagcacgttggcacacacctccagcttcagcgcgt 372
>gb|CW368350.1|CW368350 fsbb001f042e13f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f042e13, DNA
sequence
Length = 712
Score = 87.7 bits (44), Expect = 1e-015
Identities = 77/88 (87%)
Strand = Plus / Plus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 348 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 407
Query: 236 cgttggccctgaggacggtgcagaggca 263
||||||| ||| | |||||||||||||
Sbjct: 408 tgttggccttgatggcggtgcagaggca 435
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 517 gttcagcacgttggcacacacctccagcttcagcgcgt 554
>gb|CW368351.1|CW368351 fsbb001f042e13k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f042e13, DNA
sequence
Length = 710
Score = 87.7 bits (44), Expect = 1e-015
Identities = 77/88 (87%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 616 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 557
Query: 236 cgttggccctgaggacggtgcagaggca 263
||||||| ||| | |||||||||||||
Sbjct: 556 tgttggccttgatggcggtgcagaggca 529
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 447 gttcagcacgttggcacacacctccagcttcagcgcgt 410
>gb|CW392479.1|CW392479 fsbb001f079c02f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f079c02, DNA
sequence
Length = 664
Score = 87.7 bits (44), Expect = 1e-015
Identities = 77/88 (87%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 492 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 433
Query: 236 cgttggccctgaggacggtgcagaggca 263
||||||| ||| | |||||||||||||
Sbjct: 432 tgttggccttgatggcggtgcagaggca 405
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 323 gttcagcacgttggcacacacctccagcttcagcgcgt 286
>gb|CW450199.1|CW450199 fsbb001f188l14k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f188l14, DNA
sequence
Length = 635
Score = 87.7 bits (44), Expect = 1e-015
Identities = 89/104 (85%)
Strand = Plus / Minus
Query: 178 ccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccaggacg 237
||||||||||||| || ||||||||| | || |||| ||||||||||||||| ||||||
Sbjct: 635 ccgcagtagttgaggatgaggctgagatcgagtggcacgttgaggttgatgccgaggacg 576
Query: 238 ttggccctgaggacggtgcagaggcacaccgccgcctccaggtc 281
|||||| ||| | |||||||||| || || || |||||||||||
Sbjct: 575 ttggccttgatggcggtgcagagacagacggcggcctccaggtc 532
Score = 44.1 bits (22), Expect = 0.014
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 361 ttggcgcacacgcccagcttca 382
||||||||||||||||||||||
Sbjct: 455 ttggcgcacacgcccagcttca 434
>gb|CL705026.2|CL705026 SP__Bb0033N16.r SP__Bb Sorghum propinquum genomic clone
SP__Bb0033N16 3', DNA sequence
Length = 570
Score = 87.7 bits (44), Expect = 1e-015
Identities = 95/112 (84%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||| ||
Sbjct: 346 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccaaga 287
Query: 236 cgttggccctgaggacggtgcagaggcacaccgccgcctccaggtccgccag 287
||||||| ||| | ||||||||||||| || || || ||||||||| ||||
Sbjct: 286 tgttggccttgatggcggtgcagaggcagacggcggcgtccaggtccaccag 235
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 177 gttcagcacgttggcacacacctccagcttcagcgcgt 140
>gb|AW563480.1|AW563480 LG1_235_D11.b1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 533
Score = 87.7 bits (44), Expect = 1e-015
Identities = 77/88 (87%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 325 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 266
Query: 236 cgttggccctgaggacggtgcagaggca 263
||||||| ||| | |||||||||||||
Sbjct: 265 tgttggccttgatggcggtgcagaggca 238
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 156 gttcagcacgttggcacacacctccagcttcagcgcgt 119
>gb|BE355947.1|BE355947 DG1_11_F09.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 624
Score = 87.7 bits (44), Expect = 1e-015
Identities = 77/88 (87%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 391 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 332
Query: 236 cgttggccctgaggacggtgcagaggca 263
||||||| ||| | |||||||||||||
Sbjct: 331 tgttggccttgatggcggtgcagaggca 304
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 222 gttcagcacgttggcacacacctccagcttcagcgcgt 185
>gb|BE356076.1|BE356076 DG1_122_G06.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 634
Score = 87.7 bits (44), Expect = 1e-015
Identities = 77/88 (87%)
Strand = Plus / Minus
Query: 176 tgccgcagtagttgacgaggaggctgaggttgatgggcaggttgaggttgatgcccagga 235
||||||||| ||||| ||||||| | |||| || ||||| ||||||||||||||||||||
Sbjct: 435 tgccgcagtggttgaggaggagggtcaggtcgacgggcacgttgaggttgatgcccagga 376
Query: 236 cgttggccctgaggacggtgcagaggca 263
||||||| ||| | |||||||||||||
Sbjct: 375 tgttggccttgatggcggtgcagaggca 348
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 351 gttcagcaagttggcgcacacgcccagcttcagcgcgt 388
|||||||| |||||| ||||| |||||||||||||||
Sbjct: 266 gttcagcacgttggcacacacctccagcttcagcgcgt 229
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 158,365
Number of Sequences: 832831
Number of extensions: 158365
Number of successful extensions: 48842
Number of sequences better than 0.5: 533
Number of HSP's better than 0.5 without gapping: 533
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47872
Number of HSP's gapped (non-prelim): 953
length of query: 591
length of database: 491,359,669
effective HSP length: 19
effective length of query: 572
effective length of database: 475,535,880
effective search space: 272006523360
effective search space used: 272006523360
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)