BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1716424.2.3
(1842 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW237503.1|CW237503 104_693_11216207_148_37517_082 Sorgh... 96 1e-017
gb|CW265861.1|CW265861 104_735_11232115_116_35269_074 Sorgh... 96 1e-017
gb|CW265862.1|CW265862 104_735_11232115_148_35265_074 Sorgh... 96 1e-017
gb|CW460327.1|CW460327 fsbb001f207h20k0 Sorghum methylation... 96 1e-017
gb|CW481020.1|CW481020 fsbb001f240g01k0 Sorghum methylation... 96 1e-017
gb|BE599417.1|BE599417 PI1_87_C08.b1_A002 Pathogen induced ... 96 1e-017
gb|CD425104.1|CD425104 SA1_10_A05.g1_A002 Salicylic acid-tr... 96 1e-017
gb|CD427429.1|CD427429 SA1_30_F07.g1_A002 Salicylic acid-tr... 96 1e-017
gb|CN133967.1|CN133967 OX1_19_A01.g1_A002 Oxidatively-stres... 96 1e-017
gb|CL151818.1|CL151818 104_334_10779515_114_31361_299 Sorgh... 70 8e-010
gb|CW138607.1|CW138607 104_528_11134785_116_34890_041 Sorgh... 70 8e-010
gb|CW138608.1|CW138608 104_528_11134785_148_34894_041 Sorgh... 70 8e-010
gb|CW207268.1|CW207268 104_636_11188037_116_36971_025 Sorgh... 70 8e-010
gb|CW312225.1|CW312225 104_802_11470645_148_35778_063 Sorgh... 70 8e-010
gb|BE357204.1|BE357204 DG1_147_F07.g1_A002 Dark Grown 1 (DG... 70 8e-010
gb|BE360446.1|BE360446 DG1_63_H09.g1_A002 Dark Grown 1 (DG1... 70 8e-010
gb|BE363172.1|BE363172 DG1_9_G07.g1_A002 Dark Grown 1 (DG1)... 70 8e-010
gb|CD219881.1|CD219881 CCC1_59_D12.g1_A007 Callus culture/c... 70 8e-010
gb|CN126134.1|CN126134 RHOH1_15_H01.b1_A002 Acid- and alkal... 70 8e-010
gb|CN126472.1|CN126472 RHOH1_17_H02.b1_A002 Acid- and alkal... 70 8e-010
gb|CN130724.1|CN130724 RHOH1_43_H05.b1_A002 Acid- and alkal... 70 8e-010
gb|CN132285.1|CN132285 OX1_5_E12.b1_A002 Oxidatively-stress... 70 8e-010
gb|CN135339.1|CN135339 OX1_32_D04.b1_A002 Oxidatively-stres... 70 8e-010
gb|CN135408.1|CN135408 OX1_32_D04.g1_A002 Oxidatively-stres... 70 8e-010
gb|CN135639.1|CN135639 OX1_38_C10.b1_A002 Oxidatively-stres... 70 8e-010
gb|CN138170.1|CN138170 OX1_62_D10.b1_A002 Oxidatively-stres... 70 8e-010
gb|CN141771.1|CN141771 WOUND1_1_F03.g1_A002 Wounded leaves ... 70 8e-010
gb|CN142468.1|CN142468 WOUND1_10_E08.b1_A002 Wounded leaves... 70 8e-010
gb|CN142639.1|CN142639 WOUND1_11_F04.b1_A002 Wounded leaves... 70 8e-010
gb|CN142892.1|CN142892 WOUND1_13_A05.b1_A002 Wounded leaves... 70 8e-010
gb|CN144061.1|CN144061 WOUND1_20_A06.b1_A002 Wounded leaves... 70 8e-010
gb|CN144901.1|CN144901 WOUND1_25_D03.g1_A002 Wounded leaves... 70 8e-010
gb|CN145020.1|CN145020 WOUND1_26_G06.b2_A002 Wounded leaves... 70 8e-010
gb|CN145141.1|CN145141 WOUND1_27_B11.b2_A002 Wounded leaves... 70 8e-010
gb|CN148254.1|CN148254 WOUND1_55_D07.b1_A002 Wounded leaves... 70 8e-010
gb|CN148860.1|CN148860 WOUND1_59_F07.b1_A002 Wounded leaves... 70 8e-010
gb|CN149498.1|CN149498 WOUND1_63_D05.b1_A002 Wounded leaves... 70 8e-010
gb|CN149832.1|CN149832 WOUND1_65_D06.b1_A002 Wounded leaves... 70 8e-010
gb|CN151354.1|CN151354 WOUND1_75_A07.b1_A002 Wounded leaves... 70 8e-010
gb|CF675649.1|CF675649 CYP71E1 Subtractive cDNA library fro... 70 8e-010
gb|CX606656.1|CX606656 ANR1_4_F07.b1_A002 Anaerobic roots S... 70 8e-010
gb|CX606785.1|CX606785 ANR1_5_A08.b1_A002 Anaerobic roots S... 70 8e-010
gb|CX606858.1|CX606858 ANR1_5_H01.b1_A002 Anaerobic roots S... 70 8e-010
gb|CX607037.1|CX607037 ANR1_6_G11.b1_A002 Anaerobic roots S... 70 8e-010
gb|CX607388.1|CX607388 ANR1_8_G10.b1_A002 Anaerobic roots S... 70 8e-010
gb|CX608012.1|CX608012 ANR1_32_D01.b1_A002 Anaerobic roots ... 70 8e-010
gb|CX609508.1|CX609508 ANR1_13_D05.b1_A002 Anaerobic roots ... 70 8e-010
gb|CX610000.1|CX610000 ANR1_16_B12.b1_A002 Anaerobic roots ... 70 8e-010
gb|CX610482.1|CX610482 ANR1_19_B04.b1_A002 Anaerobic roots ... 70 8e-010
gb|CX611220.1|CX611220 ANR1_23_G09.b1_A002 Anaerobic roots ... 70 8e-010
gb|CX611683.1|CX611683 ANR1_26_C10.b1_A002 Anaerobic roots ... 70 8e-010
gb|CX612239.1|CX612239 GABR1_1_G06.b1_A002 GA- or brassinol... 70 8e-010
gb|CX612948.1|CX612948 GABR1_5_H05.b1_A002 GA- or brassinol... 70 8e-010
gb|CX612952.1|CX612952 GABR1_5_H09.b1_A002 GA- or brassinol... 70 8e-010
gb|CX613292.1|CX613292 GABR1_7_H02.b1_A002 GA- or brassinol... 70 8e-010
gb|CX613397.1|CX613397 GABR1_8_A02.b1_A002 GA- or brassinol... 70 8e-010
gb|CX614280.1|CX614280 GABR1_13_D05.b1_A002 GA- or brassino... 70 8e-010
gb|CX615401.1|CX615401 GABR1_20_A01.b1_A002 GA- or brassino... 70 8e-010
gb|CX618160.1|CX618160 GABR1_38_B09.b1_A002 GA- or brassino... 70 8e-010
gb|CX618553.1|CX618553 GABR1_40_G03.b1_A002 GA- or brassino... 70 8e-010
gb|CX620640.1|CX620640 GABR1_53_C11.b1_A002 GA- or brassino... 70 8e-010
gb|CX621968.1|CX621968 GABR1_61_F03.b2_A002 GA- or brassino... 70 8e-010
gb|CX623165.1|CX623165 GABR1_68_C12.b1_A002 GA- or brassino... 70 8e-010
gb|AF029858.1|AF029858 Sorghum bicolor cytochrome P450 CYP7... 70 8e-010
gb|CW301285.1|CW301285 104_785_11464120_148_36268_064 Sorgh... 68 3e-009
gb|CW513405.1|CW513405 115_4_10511569_1_30021 Sorghum unfil... 66 1e-008
gb|CW353347.1|CW353347 fsbb001f016b02k0 Sorghum methylation... 66 1e-008
gb|AW680125.1|AW680125 WS1_4_H04.g1_A002 Water-stressed 1 (... 66 1e-008
gb|AW745851.1|AW745851 WS1_37_E03.g1_A002 Water-stressed 1 ... 66 1e-008
gb|CD426490.1|CD426490 SA1_21_B12.b1_A002 Salicylic acid-tr... 66 1e-008
gb|CD427759.1|CD427759 ETH1_34_F05.b1_A002 Ethylene-treated... 66 1e-008
gb|CF772196.1|CF772196 DSBF1_30_E10.g1_A010 Drought-stresse... 66 1e-008
gb|CN132127.1|CN132127 OX1_4_F03.b1_A002 Oxidatively-stress... 66 1e-008
gb|CN142455.1|CN142455 WOUND1_10_D04.b1_A002 Wounded leaves... 66 1e-008
gb|CN144307.1|CN144307 WOUND1_21_H10.b1_A002 Wounded leaves... 66 1e-008
gb|CN147670.1|CN147670 WOUND1_51_H12.b1_A002 Wounded leaves... 66 1e-008
gb|CN149804.1|CN149804 WOUND1_65_A11.b1_A002 Wounded leaves... 66 1e-008
gb|CN149949.1|CN149949 WOUND1_66_A04.b1_A002 Wounded leaves... 66 1e-008
gb|CN151221.1|CN151221 WOUND1_74_D10.b1_A002 Wounded leaves... 66 1e-008
gb|CN151300.1|CN151300 WOUND1_74_D10.g1_A002 Wounded leaves... 66 1e-008
gb|CN152428.1|CN152428 WOUND1_82_B02.b1_A002 Wounded leaves... 66 1e-008
gb|CX617470.1|CX617470 GABR1_34_A03.b1_A002 GA- or brassino... 66 1e-008
gb|CW030659.1|CW030659 104_258_10500355_114_30403 Sorghum m... 64 5e-008
gb|CW030660.1|CW030660 104_258_10500355_116_30404 Sorghum m... 64 5e-008
gb|CW035561.1|CW035561 104_266_10503232_115_30377 Sorghum m... 64 5e-008
gb|CW128537.1|CW128537 104_510_11114060_116_34759_078 Sorgh... 64 5e-008
gb|CW282937.1|CW282937 104_759_11408981_116_35477_027 Sorgh... 64 5e-008
gb|CW328510.1|CW328510 104_824_11479341_148_35988_085 Sorgh... 64 5e-008
gb|CW433111.1|CW433111 fsbb001f148d02k0 Sorghum methylation... 64 5e-008
gb|CW454186.1|CW454186 fsbb001f198i07k0 Sorghum methylation... 64 5e-008
gb|AW680602.1|AW680602 WS1_6_C01.b1_A002 Water-stressed 1 (... 64 5e-008
gb|AW680736.1|AW680736 WS1_6_C01.g1_A002 Water-stressed 1 (... 64 5e-008
gb|AW747003.1|AW747003 WS1_65_A05.b1_A002 Water-stressed 1 ... 64 5e-008
gb|BE363357.1|BE363357 WS1_62_A01.g1_A002 Water-stressed 1 ... 64 5e-008
gb|BG103237.1|BG103237 RHIZ2_19_H06.g1_A003 Rhizome2 (RHIZ2... 64 5e-008
gb|BG357638.1|BG357638 OV2_32_D07.g1_A002 Ovary 2 (OV2) Sor... 64 5e-008
gb|BI074751.1|BI074751 IP1_15_E01.b1_A002 Immature pannicle... 64 5e-008
gb|CD226485.1|CD226485 CCC1_46_D06.b1_A007 Callus culture/c... 64 5e-008
gb|CD226817.1|CD226817 CCC1_48_F12.b1_A007 Callus culture/c... 64 5e-008
gb|CD426965.1|CD426965 SA1_26_D12.b1_A002 Salicylic acid-tr... 64 5e-008
gb|CF761554.1|CF761554 DSAF1_77_F10.b1_A011 Drought-stresse... 64 5e-008
gb|CW265642.1|CW265642 104_735_11231994_148_35268_079 Sorgh... 62 2e-007
gb|CW475267.1|CW475267 fsbb001f231i17k0 Sorghum methylation... 62 2e-007
gb|BG049964.1|BG049964 FM1_68_F08.g1_A003 Floral-Induced Me... 62 2e-007
gb|BG053008.1|BG053008 RHIZ2_16_C09.g1_A003 Rhizome2 (RHIZ2... 62 2e-007
gb|BG102572.1|BG102572 RHIZ2_34_F11.g1_A003 Rhizome2 (RHIZ2... 62 2e-007
gb|BG103558.1|BG103558 RHIZ2_38_A04.g1_A003 Rhizome2 (RHIZ2... 62 2e-007
gb|BG241437.1|BG241437 RHIZ2_49_B10.g1_A003 Rhizome2 (RHIZ2... 62 2e-007
gb|BG465866.1|BG465866 RHIZ2_45_E08.g1_A003 Rhizome2 (RHIZ2... 62 2e-007
gb|BG465910.1|BG465910 RHIZ2_46_B05.g1_A003 Rhizome2 (RHIZ2... 62 2e-007
gb|BG487882.1|BG487882 RHIZ2_60_E07.g1_A003 Rhizome2 (RHIZ2... 62 2e-007
gb|BG559923.1|BG559923 RHIZ2_75_C11.g1_A003 Rhizome2 (RHIZ2... 62 2e-007
gb|CF431307.1|CF431307 NIT1_5_D02.b1_A002 Nitrogen-deficien... 62 2e-007
gb|CN137853.1|CN137853 OX1_60_C10.b1_A002 Oxidatively-stres... 62 2e-007
gb|CN144424.1|CN144424 WOUND1_22_D09.b1_A002 Wounded leaves... 62 2e-007
gb|CN144817.1|CN144817 WOUND1_25_D03.b2_A002 Wounded leaves... 62 2e-007
gb|CN146974.1|CN146974 WOUND1_46_B05.b1_A002 Wounded leaves... 62 2e-007
gb|CN150613.1|CN150613 WOUND1_70_H03.b1_A002 Wounded leaves... 62 2e-007
gb|CN151700.1|CN151700 WOUND1_77_C01.b1_A002 Wounded leaves... 62 2e-007
gb|CN152586.1|CN152586 WOUND1_83_B01.b1_A002 Wounded leaves... 62 2e-007
gb|CX609348.1|CX609348 ANR1_12_D07.b1_A002 Anaerobic roots ... 62 2e-007
gb|CX611187.1|CX611187 ANR1_23_D08.b1_A002 Anaerobic roots ... 62 2e-007
gb|CX613126.1|CX613126 GABR1_6_H11.b1_A002 GA- or brassinol... 62 2e-007
gb|DN551794.1|DN551794 pSPR-RT-A-H1_B10_S100 pSPR Sorghum p... 62 2e-007
gb|DN552334.1|DN552334 pSPR-RT-A-H2_A01_C319 pSPR Sorghum p... 62 2e-007
gb|CB925139.1|CB925139 ABA1_20_D12.b1_A012 Abscisic acid-tr... 60 8e-007
gb|CD211152.1|CD211152 HS1_61_B07.b1_A012 Heat-shocked seed... 60 8e-007
gb|CD212051.1|CD212051 HS1_68_E12.b1_A012 Heat-shocked seed... 60 8e-007
gb|CD230650.1|CD230650 SS1_47_H08.b1_A012 Salt-stressed see... 60 8e-007
gb|CD232875.1|CD232875 SS1_10_A06.b1_A012 Salt-stressed see... 60 8e-007
gb|CD233287.1|CD233287 SS1_13_A08.b1_A012 Salt-stressed see... 60 8e-007
gb|CD235550.1|CD235550 SS1_36_G09.b1_A012 Salt-stressed see... 60 8e-007
gb|CD235660.1|CD235660 SS1_37_D04.b1_A012 Salt-stressed see... 60 8e-007
gb|CN142791.1|CN142791 WOUND1_12_F02.b1_A002 Wounded leaves... 60 8e-007
gb|CW319376.1|CW319376 104_812_11474456_116_35887_032 Sorgh... 58 3e-006
gb|CW319377.1|CW319377 104_812_11474456_148_35891_032 Sorgh... 58 3e-006
gb|CW498414.1|CW498414 fsbb001f291k03f0 Sorghum methylation... 58 3e-006
gb|BG048273.1|BG048273 OV1_16_B05.g1_A002 Ovary 1 (OV1) Sor... 58 3e-006
gb|BG411908.1|BG411908 OV2_39_F05.g1_A002 Ovary 2 (OV2) Sor... 58 3e-006
gb|CB927326.1|CB927326 ABA1_25_C12.b1_A012 Abscisic acid-tr... 58 3e-006
gb|CN151301.1|CN151301 WOUND1_74_D11.g1_A002 Wounded leaves... 58 3e-006
gb|BZ331488.1|BZ331488 hw08h04.b1 WGS-SbicolorF (JM107 adap... 56 1e-005
gb|CL166631.1|CL166631 104_362_10809500_114_31798_332 Sorgh... 56 1e-005
gb|CL187901.1|CL187901 104_403_10901215_116_32465_018 Sorgh... 56 1e-005
gb|CW122221.1|CW122221 104_501_11110531_116_34677_080 Sorgh... 56 1e-005
gb|CW122222.1|CW122222 104_501_11110531_148_34673_080 Sorgh... 56 1e-005
gb|CW186956.1|CW186956 104_605_11166836_148_36715_078 Sorgh... 56 1e-005
gb|BG101959.1|BG101959 RHIZ2_21_H10.g1_A003 Rhizome2 (RHIZ2... 56 1e-005
gb|BZ336357.1|BZ336357 hz33e08.g1 WGS-SbicolorF (JM107 adap... 54 5e-005
gb|BE600555.1|BE600555 PI1_94_F03.b1_A002 Pathogen induced ... 54 5e-005
gb|CD222278.1|CD222278 CCC1_21_H02.b1_A007 Callus culture/c... 54 5e-005
gb|CD424025.1|CD424025 SA1_3_C01.b1_A002 Salicylic acid-tre... 54 5e-005
gb|CX612550.1|CX612550 GABR1_3_C05.b1_A002 GA- or brassinol... 54 5e-005
gb|CX614948.1|CX614948 GABR1_17_F09.b1_A002 GA- or brassino... 54 5e-005
gb|CW385602.1|CW385602 fsbb001f069c08k0 Sorghum methylation... 52 2e-004
gb|CW389731.1|CW389731 fsbb001f075b04k0 Sorghum methylation... 52 2e-004
gb|CB928668.1|CB928668 ABA1_17_A09.b1_A012 Abscisic acid-tr... 52 2e-004
gb|CN143292.1|CN143292 WOUND1_15_G06.b1_A002 Wounded leaves... 52 2e-004
gb|CW072039.1|CW072039 104_325_10592042_114_30538 Sorghum m... 50 7e-004
gb|CW072040.1|CW072040 104_325_10592042_116_30542 Sorghum m... 50 7e-004
gb|CW132069.1|CW132069 104_515_11116013_148_34794_027 Sorgh... 50 7e-004
gb|CW186955.1|CW186955 104_605_11166836_116_36716_078 Sorgh... 50 7e-004
gb|CW264501.1|CW264501 104_733_11231332_116_35254_010 Sorgh... 50 7e-004
gb|CW282233.1|CW282233 104_758_11408605_116_35465_059 Sorgh... 50 7e-004
gb|CW282234.1|CW282234 104_758_11408605_148_35469_059 Sorgh... 50 7e-004
gb|CL703376.2|CL703376 SP__Ba0095M14.r SP__Ba Sorghum propi... 50 7e-004
gb|BM323991.1|BM323991 PIC1_30_A06.b1_A002 Pathogen-infecte... 50 7e-004
gb|BM328505.1|BM328505 PIC1_30_A06.g1_A002 Pathogen-infecte... 50 7e-004
gb|AC152913.1| Sorghum bicolor clone SB106M24, *** SEQUENCI... 50 7e-004
gb|CW300561.1|CW300561 104_784_11463730_116_36260_047 Sorgh... 48 0.003
gb|CW423885.1|CW423885 fsbb001f133o22k0 Sorghum methylation... 48 0.003
gb|CL153869.1|CL153869 104_338_10781006_114_31369_254 Sorgh... 46 0.012
gb|CL153870.1|CL153870 104_338_10781006_116_31370_254 Sorgh... 46 0.012
gb|CL185716.1|CL185716 104_400_10899733_114_32400_063 Sorgh... 46 0.012
gb|CL185717.1|CL185717 104_400_10899733_116_32404_063 Sorgh... 46 0.012
gb|CW037737.1|CW037737 104_269_10504516_114_30383 Sorghum m... 46 0.012
gb|CW037738.1|CW037738 104_269_10504516_115_30384 Sorghum m... 46 0.012
gb|CW042822.1|CW042822 104_276_10507297_116_30486 Sorghum m... 46 0.012
gb|CW179942.1|CW179942 104_594_11160375_148_36632_060 Sorgh... 46 0.012
gb|CW181209.1|CW181209 104_596_11163377_116_36647_077 Sorgh... 46 0.012
gb|CW192718.1|CW192718 104_615_11179178_148_36775_011 Sorgh... 46 0.012
gb|CW193503.1|CW193503 104_616_11179600_116_36780_058 Sorgh... 46 0.012
gb|CW193504.1|CW193504 104_616_11179600_148_36779_058 Sorgh... 46 0.012
gb|CW229839.1|CW229839 104_671_11207529_148_37263_041 Sorgh... 46 0.012
gb|CW235776.1|CW235776 104_691_11215198_116_37494_091 Sorgh... 46 0.012
gb|CW328098.1|CW328098 104_824_11479113_148_35984_045 Sorgh... 46 0.012
gb|CW424156.1|CW424156 fsbb001f134f17f0 Sorghum methylation... 46 0.012
gb|CW433885.1|CW433885 fsbb001f149f03k0 Sorghum methylation... 46 0.012
gb|CW483941.1|CW483941 fsbb001f245n05k0 Sorghum methylation... 46 0.012
gb|BG356554.1|BG356554 EM1_23_H05.g1_A002 Embryo 1 (EM1) So... 46 0.012
gb|BG410749.1|BG410749 EM1_25_F07.g1_A002 Embryo 1 (EM1) So... 46 0.012
gb|BG557014.1|BG557014 EM1_41_E05.g1_A002 Embryo 1 (EM1) So... 46 0.012
gb|BG557149.1|BG557149 EM1_43_B10.g1_A002 Embryo 1 (EM1) So... 46 0.012
gb|CB924943.1|CB924943 ABA1_29_C07.b1_A012 Abscisic acid-tr... 46 0.012
gb|CB924997.1|CB924997 ABA1_29_C08.b1_A012 Abscisic acid-tr... 46 0.012
gb|CB925454.1|CB925454 ABA1_33_E11.b1_A012 Abscisic acid-tr... 46 0.012
gb|CB927184.1|CB927184 ABA1_14_H08.b1_A012 Abscisic acid-tr... 46 0.012
gb|CB927232.1|CB927232 ABA1_14_H09.b1_A012 Abscisic acid-tr... 46 0.012
gb|CB929259.1|CB929259 ABA1_41_D02.b1_A012 Abscisic acid-tr... 46 0.012
gb|CD233891.1|CD233891 SS1_5_B04.b1_A012 Salt-stressed seed... 46 0.012
gb|CD430773.1|CD430773 ETH1_5_E11.b1_A002 Ethylene-treated ... 46 0.012
gb|CD464006.1|CD464006 ETH1_48_F01.b1_A002 Ethylene-treated... 46 0.012
gb|CF433772.1|CF433772 NIT1_30_A07.b1_A002 Nitrogen-deficie... 46 0.012
gb|CL153773.1|CL153773 104_338_10780950_116_31370_198 Sorgh... 44 0.046
gb|CL174916.1|CL174916 104_379_10892004_148_31768_372 Sorgh... 44 0.046
gb|CW033973.1|CW033973 104_263_10502270_115_30360 Sorghum m... 44 0.046
gb|CW164995.1|CW164995 104_573_11152274_116_36471_011 Sorgh... 44 0.046
gb|CW207619.1|CW207619 104_636_11188248_116_36976_082 Sorgh... 44 0.046
gb|CW207620.1|CW207620 104_636_11188248_148_36968_082 Sorgh... 44 0.046
gb|CW231895.1|CW231895 104_681_11211369_148_37349_041 Sorgh... 44 0.046
gb|CW235176.1|CW235176 104_690_11214843_116_37409_010 Sorgh... 44 0.046
gb|CW238741.1|CW238741 104_695_11216895_116_37527_052 Sorgh... 44 0.046
gb|CW238742.1|CW238742 104_695_11216895_148_37524_052 Sorgh... 44 0.046
gb|CW356439.1|CW356439 fsbb001f021i08k0 Sorghum methylation... 44 0.046
gb|CW423432.1|CW423432 fsbb001f133e01f0 Sorghum methylation... 44 0.046
gb|CW469510.1|CW469510 fsbb001f222e09k0 Sorghum methylation... 44 0.046
gb|CW490044.1|CW490044 fsbb001f275e17f0 Sorghum methylation... 44 0.046
gb|CW490045.1|CW490045 fsbb001f275e17k0 Sorghum methylation... 44 0.046
gb|CD211283.1|CD211283 HS1_59_F05.b1_A012 Heat-shocked seed... 44 0.046
gb|CD219864.1|CD219864 CCC1_59_D12.b1_A007 Callus culture/c... 44 0.046
gb|CD222346.1|CD222346 CCC1_21_C05.b1_A007 Callus culture/c... 44 0.046
gb|CD224264.1|CD224264 CCC1_33_F03.b1_A007 Callus culture/c... 44 0.046
gb|CD231556.1|CD231556 SS1_22_B09.b1_A012 Salt-stressed see... 44 0.046
gb|CD232850.1|CD232850 SS1_10_G12.b1_A012 Salt-stressed see... 44 0.046
gb|CD233293.1|CD233293 SS1_13_E06.b1_A012 Salt-stressed see... 44 0.046
gb|CD235971.1|CD235971 SS1_25_B02.b1_A012 Salt-stressed see... 44 0.046
gb|CD422862.1|CD422862 SA1_38_C11.b1_A002 Salicylic acid-tr... 44 0.046
gb|CF074250.1|CF074250 FE1_23_D05.b1_A002 Iron-deficient se... 44 0.046
gb|CN126076.1|CN126076 RHOH1_15_B06.b1_A002 Acid- and alkal... 44 0.046
gb|CN126811.1|CN126811 RHOH1_19_G01.b1_A002 Acid- and alkal... 44 0.046
gb|CN142012.1|CN142012 WOUND1_3_G05.b1_A002 Wounded leaves ... 44 0.046
gb|CX607535.1|CX607535 ANR1_29_F10.b1_A002 Anaerobic roots ... 44 0.046
gb|CX608661.1|CX608661 ANR1_40_A09.b1_A002 Anaerobic roots ... 44 0.046
gb|CX610538.1|CX610538 ANR1_19_G09.b1_A002 Anaerobic roots ... 44 0.046
gb|CX611043.1|CX611043 ANR1_22_G05.b1_A002 Anaerobic roots ... 44 0.046
gb|CX611163.1|CX611163 ANR1_23_B06.b1_A002 Anaerobic roots ... 44 0.046
gb|CX618571.1|CX618571 GABR1_40_H10.b1_A002 GA- or brassino... 44 0.046
gb|CX619055.1|CX619055 GABR1_43_F06.b1_A002 GA- or brassino... 44 0.046
gb|CX619965.1|CX619965 GABR1_49_B04.b1_A002 GA- or brassino... 44 0.046
gb|CX622143.1|CX622143 GABR1_62_F09.b2_A002 GA- or brassino... 44 0.046
gb|BZ337268.1|BZ337268 ia86c10.g1 WGS-SbicolorF (JM107 adap... 42 0.18
gb|BZ423254.1|BZ423254 id47b10.g1 WGS-SbicolorF (DH5a methy... 42 0.18
gb|CW044186.1|CW044186 104_280_10508807_115_30242 Sorghum m... 42 0.18
gb|CW158071.1|CW158071 104_561_11147859_148_36388_004 Sorgh... 42 0.18
gb|CW163490.1|CW163490 104_571_11151489_116_36457_045 Sorgh... 42 0.18
gb|CW175671.1|CW175671 104_588_11158069_148_36579_059 Sorgh... 42 0.18
gb|CW232735.1|CW232735 104_685_11212981_116_37365_055 Sorgh... 42 0.18
gb|CW272418.1|CW272418 104_744_11403415_116_35346_020 Sorgh... 42 0.18
gb|CW272419.1|CW272419 104_744_11403415_116_36221_020 Sorgh... 42 0.18
gb|CW285908.1|CW285908 104_763_11410595_116_35511_042 Sorgh... 42 0.18
gb|CW327210.1|CW327210 104_822_11478626_116_35968_001 Sorgh... 42 0.18
gb|CW327211.1|CW327211 104_822_11478626_148_35969_001 Sorgh... 42 0.18
gb|CW404590.1|CW404590 fsbb001f096m18f0 Sorghum methylation... 42 0.18
gb|CW412894.1|CW412894 fsbb001f108m08f0 Sorghum methylation... 42 0.18
gb|CW430813.1|CW430813 fsbb001f144l06f0 Sorghum methylation... 42 0.18
gb|CW448048.1|CW448048 fsbb001f181h13k0 Sorghum methylation... 42 0.18
gb|CW469509.1|CW469509 fsbb001f222e09f0 Sorghum methylation... 42 0.18
gb|CW493243.1|CW493243 fsbb001f283o16k0 Sorghum methylation... 42 0.18
gb|AW680035.1|AW680035 WS1_3_H10.g1_A002 Water-stressed 1 (... 42 0.18
gb|BG605901.1|BG605901 RHIZ2_83_A01.g1_A003 Rhizome2 (RHIZ2... 42 0.18
gb|CF071740.1|CF071740 FE1_18_H07.b1_A002 Iron-deficient se... 42 0.18
gb|CF755721.1|CF755721 DSAF1_1_B03.b1_A011 Drought-stressed... 42 0.18
gb|CF761661.1|CF761661 DSAF1_79_C11.b1_A011 Drought-stresse... 42 0.18
gb|CX615720.1|CX615720 GABR1_22_E11.b1_A002 GA- or brassino... 42 0.18
gb|CX619683.1|CX619683 GABR1_47_D04.b1_A002 GA- or brassino... 42 0.18
gb|CX622160.1|CX622160 GABR1_62_H03.b2_A002 GA- or brassino... 42 0.18
>gb|CW237503.1|CW237503 104_693_11216207_148_37517_082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11216207, DNA
sequence
Length = 651
Score = 95.6 bits (48), Expect = 1e-017
Identities = 63/68 (92%)
Strand = Plus / Plus
Query: 327 tcgtgtcgtcgcccagcgccgccgaggccgtgatgcgcacccacgaccacatcttcgcgt 386
|||||||||||||| ||||||||||||||||| ||||||| ||||||||| | |||||||
Sbjct: 511 tcgtgtcgtcgccccgcgccgccgaggccgtgctgcgcacgcacgaccacgtgttcgcgt 570
Query: 387 cccggccg 394
||||||||
Sbjct: 571 cccggccg 578
>gb|CW265861.1|CW265861 104_735_11232115_116_35269_074 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11232115, DNA
sequence
Length = 621
Score = 95.6 bits (48), Expect = 1e-017
Identities = 63/68 (92%)
Strand = Plus / Minus
Query: 327 tcgtgtcgtcgcccagcgccgccgaggccgtgatgcgcacccacgaccacatcttcgcgt 386
|||||||||||||| ||||||||||||||||| ||||||| ||||||||| | |||||||
Sbjct: 591 tcgtgtcgtcgccccgcgccgccgaggccgtgctgcgcacgcacgaccacgtgttcgcgt 532
Query: 387 cccggccg 394
||||||||
Sbjct: 531 cccggccg 524
>gb|CW265862.1|CW265862 104_735_11232115_148_35265_074 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11232115, DNA
sequence
Length = 629
Score = 95.6 bits (48), Expect = 1e-017
Identities = 63/68 (92%)
Strand = Plus / Plus
Query: 327 tcgtgtcgtcgcccagcgccgccgaggccgtgatgcgcacccacgaccacatcttcgcgt 386
|||||||||||||| ||||||||||||||||| ||||||| ||||||||| | |||||||
Sbjct: 434 tcgtgtcgtcgccccgcgccgccgaggccgtgctgcgcacgcacgaccacgtgttcgcgt 493
Query: 387 cccggccg 394
||||||||
Sbjct: 494 cccggccg 501
>gb|CW460327.1|CW460327 fsbb001f207h20k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f207h20, DNA
sequence
Length = 709
Score = 95.6 bits (48), Expect = 1e-017
Identities = 63/68 (92%)
Strand = Plus / Minus
Query: 327 tcgtgtcgtcgcccagcgccgccgaggccgtgatgcgcacccacgaccacatcttcgcgt 386
|||||||||||||| ||||||||||||||||| ||||||| ||||||||| | |||||||
Sbjct: 369 tcgtgtcgtcgccccgcgccgccgaggccgtgctgcgcacgcacgaccacgtgttcgcgt 310
Query: 387 cccggccg 394
||||||||
Sbjct: 309 cccggccg 302
>gb|CW481020.1|CW481020 fsbb001f240g01k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f240g01, DNA
sequence
Length = 641
Score = 95.6 bits (48), Expect = 1e-017
Identities = 63/68 (92%)
Strand = Plus / Plus
Query: 327 tcgtgtcgtcgcccagcgccgccgaggccgtgatgcgcacccacgaccacatcttcgcgt 386
|||||||||||||| ||||||||||||||||| ||||||| ||||||||| | |||||||
Sbjct: 503 tcgtgtcgtcgccccgcgccgccgaggccgtgctgcgcacgcacgaccacgtgttcgcgt 562
Query: 387 cccggccg 394
||||||||
Sbjct: 563 cccggccg 570
>gb|BE599417.1|BE599417 PI1_87_C08.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 505
Score = 95.6 bits (48), Expect = 1e-017
Identities = 63/68 (92%)
Strand = Plus / Plus
Query: 327 tcgtgtcgtcgcccagcgccgccgaggccgtgatgcgcacccacgaccacatcttcgcgt 386
|||||||||||||| ||||||||||||||||| ||||||| ||||||||| | |||||||
Sbjct: 257 tcgtgtcgtcgccccgcgccgccgaggccgtgctgcgcacgcacgaccacgtgttcgcgt 316
Query: 387 cccggccg 394
||||||||
Sbjct: 317 cccggccg 324
>gb|CD425104.1|CD425104 SA1_10_A05.g1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_10_A05_A002 5', mRNA sequence
Length = 538
Score = 95.6 bits (48), Expect = 1e-017
Identities = 63/68 (92%)
Strand = Plus / Plus
Query: 327 tcgtgtcgtcgcccagcgccgccgaggccgtgatgcgcacccacgaccacatcttcgcgt 386
|||||||||||||| ||||||||||||||||| ||||||| ||||||||| | |||||||
Sbjct: 413 tcgtgtcgtcgccccgcgccgccgaggccgtgctgcgcacgcacgaccacgtgttcgcgt 472
Query: 387 cccggccg 394
||||||||
Sbjct: 473 cccggccg 480
>gb|CD427429.1|CD427429 SA1_30_F07.g1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_30_F07_A002 5', mRNA sequence
Length = 624
Score = 95.6 bits (48), Expect = 1e-017
Identities = 63/68 (92%)
Strand = Plus / Plus
Query: 327 tcgtgtcgtcgcccagcgccgccgaggccgtgatgcgcacccacgaccacatcttcgcgt 386
|||||||||||||| ||||||||||||||||| ||||||| ||||||||| | |||||||
Sbjct: 372 tcgtgtcgtcgccccgcgccgccgaggccgtgctgcgcacgcacgaccacgtgttcgcgt 431
Query: 387 cccggccg 394
||||||||
Sbjct: 432 cccggccg 439
>gb|CN133967.1|CN133967 OX1_19_A01.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_19_A01_A002 5', mRNA sequence
Length = 586
Score = 95.6 bits (48), Expect = 1e-017
Identities = 63/68 (92%)
Strand = Plus / Plus
Query: 327 tcgtgtcgtcgcccagcgccgccgaggccgtgatgcgcacccacgaccacatcttcgcgt 386
|||||||||||||| ||||||||||||||||| ||||||| ||||||||| | |||||||
Sbjct: 365 tcgtgtcgtcgccccgcgccgccgaggccgtgctgcgcacgcacgaccacgtgttcgcgt 424
Query: 387 cccggccg 394
||||||||
Sbjct: 425 cccggccg 432
>gb|CL151818.1|CL151818 104_334_10779515_114_31361_299 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10779515, DNA
sequence
Length = 616
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Minus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 575 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 525
>gb|CW138607.1|CW138607 104_528_11134785_116_34890_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11134785, DNA
sequence
Length = 696
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Minus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 636 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 586
>gb|CW138608.1|CW138608 104_528_11134785_148_34894_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11134785, DNA
sequence
Length = 665
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 349 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 399
>gb|CW207268.1|CW207268 104_636_11188037_116_36971_025 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11188037, DNA
sequence
Length = 469
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 221 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 271
>gb|CW312225.1|CW312225 104_802_11470645_148_35778_063 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11470645, DNA
sequence
Length = 673
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 274 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 324
>gb|BE357204.1|BE357204 DG1_147_F07.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 593
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 84 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 134
>gb|BE360446.1|BE360446 DG1_63_H09.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 416
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 47 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 97
>gb|BE363172.1|BE363172 DG1_9_G07.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 410
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 82 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 132
>gb|CD219881.1|CD219881 CCC1_59_D12.g1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_59_D12_A007 5', mRNA sequence
Length = 651
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 112 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 162
>gb|CN126134.1|CN126134 RHOH1_15_H01.b1_A002 Acid- and alkaline-treated roots Sorghum bicolor
cDNA clone RHOH1_15_H01_A002 3', mRNA sequence
Length = 744
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 152 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 202
>gb|CN126472.1|CN126472 RHOH1_17_H02.b1_A002 Acid- and alkaline-treated roots Sorghum bicolor
cDNA clone RHOH1_17_H02_A002 3', mRNA sequence
Length = 722
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 158 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 208
>gb|CN130724.1|CN130724 RHOH1_43_H05.b1_A002 Acid- and alkaline-treated roots Sorghum bicolor
cDNA clone RHOH1_43_H05_A002 3', mRNA sequence
Length = 809
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 217 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 267
>gb|CN132285.1|CN132285 OX1_5_E12.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_5_E12_A002 3', mRNA sequence
Length = 608
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 13 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 63
>gb|CN135339.1|CN135339 OX1_32_D04.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_32_D04_A002 3', mRNA sequence
Length = 713
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 118 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 168
>gb|CN135408.1|CN135408 OX1_32_D04.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_32_D04_A002 5', mRNA sequence
Length = 737
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 483 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 533
>gb|CN135639.1|CN135639 OX1_38_C10.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_38_C10_A002 3', mRNA sequence
Length = 784
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 191 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 241
>gb|CN138170.1|CN138170 OX1_62_D10.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_62_D10_A002 3', mRNA sequence
Length = 747
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 153 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 203
>gb|CN141771.1|CN141771 WOUND1_1_F03.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_1_F03_A002 5', mRNA sequence
Length = 795
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 636 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 686
>gb|CN142468.1|CN142468 WOUND1_10_E08.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_10_E08_A002 3', mRNA sequence
Length = 726
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 129 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 179
>gb|CN142639.1|CN142639 WOUND1_11_F04.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_11_F04_A002 3', mRNA sequence
Length = 732
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 135 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 185
>gb|CN142892.1|CN142892 WOUND1_13_A05.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_13_A05_A002 3', mRNA sequence
Length = 804
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 215 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 265
>gb|CN144061.1|CN144061 WOUND1_20_A06.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_20_A06_A002 3', mRNA sequence
Length = 788
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 197 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 247
>gb|CN144901.1|CN144901 WOUND1_25_D03.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_25_D03_A002 5', mRNA sequence
Length = 811
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 515 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 565
>gb|CN145020.1|CN145020 WOUND1_26_G06.b2_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_26_G06_A002 3', mRNA sequence
Length = 720
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 130 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 180
>gb|CN145141.1|CN145141 WOUND1_27_B11.b2_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_27_B11_A002 3', mRNA sequence
Length = 776
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 187 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 237
>gb|CN148254.1|CN148254 WOUND1_55_D07.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_55_D07_A002 3', mRNA sequence
Length = 722
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 125 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 175
>gb|CN148860.1|CN148860 WOUND1_59_F07.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_59_F07_A002 3', mRNA sequence
Length = 725
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 219 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 269
>gb|CN149498.1|CN149498 WOUND1_63_D05.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_63_D05_A002 3', mRNA sequence
Length = 750
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 52 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 102
>gb|CN149832.1|CN149832 WOUND1_65_D06.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_65_D06_A002 3', mRNA sequence
Length = 624
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 63 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 113
>gb|CN151354.1|CN151354 WOUND1_75_A07.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_75_A07_A002 3', mRNA sequence
Length = 775
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 186 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 236
>gb|CF675649.1|CF675649 CYP71E1 Subtractive cDNA library from sorghum infested by greenbug
aphids Sorghum bicolor cDNA clone CYP71E1 similar to
Cytochrome P450, mRNA sequence
Length = 639
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 35 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 85
>gb|CX606656.1|CX606656 ANR1_4_F07.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_4_F07_A002 3', mRNA sequence
Length = 725
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 131 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 181
>gb|CX606785.1|CX606785 ANR1_5_A08.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_5_A08_A002 3', mRNA sequence
Length = 727
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 138 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 188
>gb|CX606858.1|CX606858 ANR1_5_H01.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_5_H01_A002 3', mRNA sequence
Length = 808
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 214 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 264
>gb|CX607037.1|CX607037 ANR1_6_G11.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_6_G11_A002 3', mRNA sequence
Length = 798
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 204 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 254
>gb|CX607388.1|CX607388 ANR1_8_G10.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_8_G10_A002 3', mRNA sequence
Length = 642
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 53 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 103
>gb|CX608012.1|CX608012 ANR1_32_D01.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_32_D01_A002 3', mRNA sequence
Length = 602
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 41 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 91
>gb|CX609508.1|CX609508 ANR1_13_D05.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_13_D05_A002 3', mRNA sequence
Length = 800
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 208 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 258
>gb|CX610000.1|CX610000 ANR1_16_B12.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_16_B12_A002 3', mRNA sequence
Length = 715
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 121 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 171
>gb|CX610482.1|CX610482 ANR1_19_B04.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_19_B04_A002 3', mRNA sequence
Length = 739
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 150 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 200
>gb|CX611220.1|CX611220 ANR1_23_G09.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_23_G09_A002 3', mRNA sequence
Length = 672
Score = 69.9 bits (35), Expect = 8e-010
Identities = 47/51 (92%)
Strand = Plus / Plus
Query: 1265 gccaacacgcgcgtcctcgtgaacggctgggccatcggcagagacccggcg 1315
||||||||||||||| |||| |||| ||||||||||||||| |||||||||
Sbjct: 78 gccaacacgcgcgtcttcgtcaacgcctgggccatcggcagggacccggcg 128
Database: Sorghum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:54 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 723,768
Number of Sequences: 832831
Number of extensions: 723768
Number of successful extensions: 248989
Number of sequences better than 0.5: 267
Number of HSP's better than 0.5 without gapping: 267
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 248123
Number of HSP's gapped (non-prelim): 860
length of query: 1842
length of database: 491,359,669
effective HSP length: 20
effective length of query: 1822
effective length of database: 474,703,049
effective search space: 864908955278
effective search space used: 864908955278
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)