BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.452
(1348 letters)
Database: Sorghum_nucl_with_EST.fasta
832,831 sequences; 491,359,669 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CW094630.1|CW094630 104_459_11000809_148_34271_011 Sorgh... 94 4e-017
gb|CW350282.1|CW350282 fsbb001f011i03k0 Sorghum methylation... 94 4e-017
gb|CW415630.1|CW415630 fsbb001f115n04f0 Sorghum methylation... 68 2e-009
gb|CW350281.1|CW350281 fsbb001f011i03f0 Sorghum methylation... 66 9e-009
gb|CW033793.1|CW033793 104_263_10502159_114_30359 Sorghum m... 64 4e-008
gb|CW084303.1|CW084303 104_427_10945702_114_32506_095 Sorgh... 64 4e-008
gb|CW126527.1|CW126527 104_507_11112946_116_34735_043 Sorgh... 64 4e-008
gb|CW148333.1|CW148333 104_542_11140364_148_35007_066 Sorgh... 64 4e-008
gb|CW404087.1|CW404087 fsbb001f096b12k0 Sorghum methylation... 64 4e-008
gb|CW407745.1|CW407745 fsbb001f101f16f0 Sorghum methylation... 64 4e-008
gb|CW463488.1|CW463488 fsbb001f212c08f0 Sorghum methylation... 64 4e-008
gb|BE363874.1|BE363874 PI1_10_D09.b1_A002 Pathogen induced ... 64 4e-008
gb|CW052383.1|CW052383 104_292_10515531_114_30286 Sorghum m... 62 1e-007
gb|CW094629.1|CW094629 104_459_11000809_116_34275_011 Sorgh... 62 1e-007
gb|CW132498.1|CW132498 104_515_11116244_148_34793_066 Sorgh... 62 1e-007
gb|CW342248.1|CW342248 104_844_11486771_116_36177_048 Sorgh... 56 9e-006
gb|CW357527.1|CW357527 fsbb001f024d13f0 Sorghum methylation... 56 9e-006
gb|CW243915.1|CW243915 104_704_11220309_116_37577_085 Sorgh... 54 3e-005
gb|CW255366.1|CW255366 104_720_11226196_148_35135_016 Sorgh... 54 3e-005
gb|CW269445.1|CW269445 104_740_11401847_148_35314_086 Sorgh... 54 3e-005
gb|CW279473.1|CW279473 104_754_11407096_116_35436_060 Sorgh... 54 3e-005
gb|CW500296.1|CW500296 fsbb001f295i21f0 Sorghum methylation... 54 3e-005
gb|BZ412858.1|BZ412858 122c5_59 Subclones from BAC clones m... 52 1e-004
gb|BZ412953.1|BZ412953 48c11_59 Subclones from BAC clones m... 52 1e-004
gb|CL162934.1|CL162934 104_355_10806773_114_31832_293 Sorgh... 52 1e-004
gb|CW032509.1|CW032509 104_261_10501416_114_30363 Sorghum m... 52 1e-004
gb|CW090626.1|CW090626 104_436_10949386_116_32609_037 Sorgh... 52 1e-004
gb|CW092912.1|CW092912 104_455_10999455_114_33045_052 Sorgh... 52 1e-004
gb|CW096655.1|CW096655 104_462_11002018_116_34351_041 Sorgh... 52 1e-004
gb|CW096656.1|CW096656 104_462_11002018_148_34355_041 Sorgh... 52 1e-004
gb|CW110021.1|CW110021 104_482_11103456_116_34512_088 Sorgh... 52 1e-004
gb|CW169339.1|CW169339 104_579_11154622_116_36506_091 Sorgh... 52 1e-004
gb|CW169340.1|CW169340 104_579_11154622_148_36505_091 Sorgh... 52 1e-004
gb|CW177622.1|CW177622 104_591_11159125_148_36612_063 Sorgh... 52 1e-004
gb|CW207823.1|CW207823 104_637_11188356_148_37047_046 Sorgh... 52 1e-004
gb|CW233146.1|CW233146 104_686_11213214_116_37376_029 Sorgh... 52 1e-004
gb|CW337876.1|CW337876 104_838_11484447_116_36122_064 Sorgh... 52 1e-004
gb|CF756177.1|CF756177 DSAF1_4_B11.b1_A011 Drought-stressed... 52 1e-004
gb|CC059212.1|CC059212 ii20g12.b1 WGS-SbicolorF (DH5a methy... 50 5e-004
gb|CL190420.1|CL190420 104_408_10906072_114_32486_056 Sorgh... 50 5e-004
gb|CW020813.1|CW020813 104_109_10409182_116_30500 Sorghum m... 50 5e-004
gb|CW045992.1|CW045992 104_282_10509894_114_30231 Sorghum m... 50 5e-004
gb|CW063654.1|CW063654 104_309_10522127_114_30134 Sorghum m... 50 5e-004
gb|CW063930.1|CW063930 104_309_10522281_115_30140 Sorghum m... 50 5e-004
gb|CW125365.1|CW125365 104_505_11112290_148_34710_005 Sorgh... 50 5e-004
gb|CW167320.1|CW167320 104_576_11153539_148_36490_072 Sorgh... 50 5e-004
gb|CW172499.1|CW172499 104_583_11156324_116_36536_068 Sorgh... 50 5e-004
gb|CW177728.1|CW177728 104_591_11159182_116_36614_093 Sorgh... 50 5e-004
gb|CW181665.1|CW181665 104_596_11163633_116_36651_035 Sorgh... 50 5e-004
gb|CW181666.1|CW181666 104_596_11163633_148_36652_035 Sorgh... 50 5e-004
gb|CW220785.1|CW220785 104_655_11197546_148_37155_037 Sorgh... 50 5e-004
gb|CW228912.1|CW228912 104_670_11207026_148_37261_047 Sorgh... 50 5e-004
gb|CW233326.1|CW233326 104_686_11213341_148_37370_055 Sorgh... 50 5e-004
gb|CW235889.1|CW235889 104_691_11215272_116_37493_088 Sorgh... 50 5e-004
gb|CW299007.1|CW299007 104_781_11462878_148_35657_083 Sorgh... 50 5e-004
gb|CW312700.1|CW312700 104_802_11470900_148_35777_004 Sorgh... 50 5e-004
gb|CW339578.1|CW339578 104_840_11485344_116_36145_092 Sorgh... 50 5e-004
gb|CW342215.1|CW342215 104_844_11486753_116_36173_079 Sorgh... 50 5e-004
gb|CW350609.1|CW350609 fsbb001f012a05f0 Sorghum methylation... 50 5e-004
gb|CW355093.1|CW355093 fsbb001f019j09k0 Sorghum methylation... 50 5e-004
gb|CW358418.1|CW358418 fsbb001f025i22k0 Sorghum methylation... 50 5e-004
gb|CW364232.1|CW364232 fsbb001f036c22k0 Sorghum methylation... 50 5e-004
gb|CW377497.1|CW377497 fsbb001f055n11k0 Sorghum methylation... 50 5e-004
gb|CW412562.1|CW412562 fsbb001f108e03k0 Sorghum methylation... 50 5e-004
gb|CW438914.1|CW438914 fsbb001f156m16k0 Sorghum methylation... 50 5e-004
gb|CW441372.1|CW441372 fsbb001f160h21k0 Sorghum methylation... 50 5e-004
gb|CW442671.1|CW442671 fsbb001f162h03k0 Sorghum methylation... 50 5e-004
gb|CW447676.1|CW447676 fsbb001f180o15k0 Sorghum methylation... 50 5e-004
gb|CW450007.1|CW450007 fsbb001f188g21f0 Sorghum methylation... 50 5e-004
gb|CW450335.1|CW450335 fsbb001f188o18f0 Sorghum methylation... 50 5e-004
gb|CW483773.1|CW483773 fsbb001f245j03k0 Sorghum methylation... 50 5e-004
gb|CW485477.1|CW485477 fsbb001f248e02f0 Sorghum methylation... 50 5e-004
gb|AW565183.1|AW565183 LG1_328_A06.b1_A002 Light Grown 1 (L... 50 5e-004
gb|BE355165.1|BE355165 DG1_10_E04.g1_A002 Dark Grown 1 (DG1... 50 5e-004
gb|BE355167.1|BE355167 DG1_10_E02.g1_A002 Dark Grown 1 (DG1... 50 5e-004
gb|BE600418.1|BE600418 PI1_96_A09.g1_A002 Pathogen induced ... 50 5e-004
gb|BM318083.1|BM318083 PI1_78_C11.g9_A002 Pathogen induced ... 50 5e-004
gb|CB927244.1|CB927244 ABA1_14_A11.b1_A012 Abscisic acid-tr... 50 5e-004
gb|CD204014.1|CD204014 HS1_3_A08.b1_A012 Heat-shocked seedl... 50 5e-004
gb|CF755727.1|CF755727 DSAF1_1_B09.b1_A011 Drought-stressed... 50 5e-004
gb|CN142795.1|CN142795 WOUND1_12_F08.b1_A002 Wounded leaves... 50 5e-004
gb|CX611168.1|CX611168 ANR1_23_B11.b1_A002 Anaerobic roots ... 50 5e-004
gb|CX613758.1|CX613758 GABR1_10_B11.b1_A002 GA- or brassino... 50 5e-004
gb|CL171866.1|CL171866 104_374_10889738_116_31775_026 Sorgh... 48 0.002
gb|CL171867.1|CL171867 104_374_10889738_148_31774_026 Sorgh... 48 0.002
gb|CW031904.1|CW031904 104_260_10501071_114_30365 Sorghum m... 48 0.002
gb|CW059389.1|CW059389 104_302_10519289_115_30168 Sorghum m... 48 0.002
gb|CW164285.1|CW164285 104_572_11151907_148_36462_076 Sorgh... 48 0.002
gb|CW166151.1|CW166151 104_574_11152897_116_36484_001 Sorgh... 48 0.002
gb|CW183829.1|CW183829 104_599_11164825_116_36675_001 Sorgh... 48 0.002
gb|CW208558.1|CW208558 104_638_11188735_116_36981_030 Sorgh... 48 0.002
gb|CW208559.1|CW208559 104_638_11188735_148_36982_030 Sorgh... 48 0.002
gb|CW277960.1|CW277960 104_752_11406303_148_35680_060 Sorgh... 48 0.002
gb|CW346528.1|CW346528 fsbb001f006b10k0 Sorghum methylation... 48 0.002
gb|CW387840.1|CW387840 fsbb001f072f17k0 Sorghum methylation... 48 0.002
gb|CW406146.1|CW406146 fsbb001f099a13f0 Sorghum methylation... 48 0.002
gb|CW459813.1|CW459813 fsbb001f206l22f0 Sorghum methylation... 48 0.002
gb|CW474821.1|CW474821 fsbb001f230o07f0 Sorghum methylation... 48 0.002
gb|CD461990.1|CD461990 SA1_36_H04.b1_A002 Salicylic acid-tr... 48 0.002
gb|CF073150.1|CF073150 FE1_28_G06.b1_A002 Iron-deficient se... 48 0.002
gb|CX611331.1|CX611331 ANR1_24_B11.b1_A002 Anaerobic roots ... 48 0.002
gb|CL153924.1|CL153924 104_338_10781043_116_31370_291 Sorgh... 46 0.008
gb|CL178917.1|CL178917 104_387_10894930_116_31906_226 Sorgh... 46 0.008
gb|CL178918.1|CL178918 104_387_10894930_148_31905_226 Sorgh... 46 0.008
gb|CW032924.1|CW032924 104_262_10501666_114_30361 Sorghum m... 46 0.008
gb|CW068017.1|CW068017 104_316_10524767_115_30145 Sorghum m... 46 0.008
gb|CW081545.1|CW081545 104_420_10942122_116_32307_077 Sorgh... 46 0.008
gb|CW112723.1|CW112723 104_486_11105045_148_34541_019 Sorgh... 46 0.008
gb|CW188083.1|CW188083 104_607_11172832_148_36723_052 Sorgh... 46 0.008
gb|CW233147.1|CW233147 104_686_11213214_148_37375_029 Sorgh... 46 0.008
gb|CW262007.1|CW262007 104_729_11229818_148_35206_009 Sorgh... 46 0.008
gb|CW303145.1|CW303145 104_787_11465086_148_35673_087 Sorgh... 46 0.008
gb|CW386358.1|CW386358 fsbb001f070d14f0 Sorghum methylation... 46 0.008
gb|CW397254.1|CW397254 fsbb001f086b11k0 Sorghum methylation... 46 0.008
gb|CW433928.1|CW433928 fsbb001f149g02f0 Sorghum methylation... 46 0.008
gb|CW450135.1|CW450135 fsbb001f188k02k0 Sorghum methylation... 46 0.008
gb|CW454497.1|CW454497 fsbb001f198p13f0 Sorghum methylation... 46 0.008
gb|CW790650.1|CW790650 SP__Ba0071C14.r SP__Ba Sorghum propi... 46 0.008
gb|CW792563.1|CW792563 SP__Ba0095F01.r SP__Ba Sorghum propi... 46 0.008
gb|CN124403.1|CN124403 RHOH1_4_C02.g1_A002 Acid- and alkali... 46 0.008
gb|CN135620.1|CN135620 OX1_38_A11.b1_A002 Oxidatively-stres... 46 0.008
gb|CN135699.1|CN135699 OX1_38_A11.g1_A002 Oxidatively-stres... 46 0.008
gb|CN146780.1|CN146780 WOUND1_43_E01.g1_A002 Wounded leaves... 46 0.008
gb|CL162355.1|CL162355 104_354_10806351_114_31830_255 Sorgh... 44 0.033
gb|CW084773.1|CW084773 104_427_10945998_114_32508_019 Sorgh... 44 0.033
gb|CW174363.1|CW174363 104_586_11157363_148_36559_008 Sorgh... 44 0.033
gb|CW196282.1|CW196282 104_620_11181088_116_36812_060 Sorgh... 44 0.033
gb|CW212892.1|CW212892 104_644_11191263_116_37026_060 Sorgh... 44 0.033
gb|CW216985.1|CW216985 104_650_11195414_148_37135_063 Sorgh... 44 0.033
gb|CW243463.1|CW243463 104_704_11220059_148_37578_048 Sorgh... 44 0.033
gb|CW261533.1|CW261533 104_728_11229564_116_35175_036 Sorgh... 44 0.033
gb|CW261761.1|CW261761 104_729_11229688_148_35206_064 Sorgh... 44 0.033
gb|CW277847.1|CW277847 104_752_11406242_148_35418_013 Sorgh... 44 0.033
gb|CW309573.1|CW309573 104_798_11469264_148_35742_090 Sorgh... 44 0.033
gb|CW357266.1|CW357266 fsbb001f023n06k0 Sorghum methylation... 44 0.033
gb|CW358834.1|CW358834 fsbb001f026d07f0 Sorghum methylation... 44 0.033
gb|CW383124.1|CW383124 fsbb001f065h13f0 Sorghum methylation... 44 0.033
gb|CW384884.1|CW384884 fsbb001f068b21f0 Sorghum methylation... 44 0.033
gb|CW410104.1|CW410104 fsbb001f104l07f0 Sorghum methylation... 44 0.033
gb|CW425305.1|CW425305 fsbb001f136c04k0 Sorghum methylation... 44 0.033
gb|CW456245.1|CW456245 fsbb001f201i03k0 Sorghum methylation... 44 0.033
gb|CW500396.1|CW500396 fsbb001f295l08k0 Sorghum methylation... 44 0.033
gb|CW501341.1|CW501341 fsbb001f297b17k0 Sorghum methylation... 44 0.033
gb|CW501343.1|CW501343 fsbb001f297b18k0 Sorghum methylation... 44 0.033
gb|BE362047.1|BE362047 DG1_83_A06.g1_A002 Dark Grown 1 (DG1... 44 0.033
gb|CL148241.1|CL148241 104_328_10592954_148_31782_078 Sorgh... 42 0.13
gb|CL168136.1|CL168136 104_365_10810586_114_31804_266 Sorgh... 42 0.13
gb|CL171423.1|CL171423 104_373_10889416_148_31776_088 Sorgh... 42 0.13
gb|CL178303.1|CL178303 104_386_10894485_116_31912_165 Sorgh... 42 0.13
gb|CW026861.1|CW026861 104_253_10498187_114_30532 Sorghum m... 42 0.13
gb|CW040454.1|CW040454 104_273_10506161_114_30265 Sorghum m... 42 0.13
gb|CW043738.1|CW043738 104_279_10508552_114_30276 Sorghum m... 42 0.13
gb|CW063749.1|CW063749 104_309_10522182_115_30140 Sorghum m... 42 0.13
gb|CW076696.1|CW076696 104_373_10889416_116_31777_088 Sorgh... 42 0.13
gb|CW107324.1|CW107324 104_477_11096522_116_34477_007 Sorgh... 42 0.13
gb|CW107325.1|CW107325 104_477_11096522_148_34473_007 Sorgh... 42 0.13
gb|CW177387.1|CW177387 104_590_11158997_116_36590_019 Sorgh... 42 0.13
gb|CW187259.1|CW187259 104_605_11166997_148_36718_055 Sorgh... 42 0.13
gb|CW217295.1|CW217295 104_650_11195581_116_37129_055 Sorgh... 42 0.13
gb|CW217296.1|CW217296 104_650_11195581_148_37130_055 Sorgh... 42 0.13
gb|CW269736.1|CW269736 104_740_11401968_148_35317_082 Sorgh... 42 0.13
gb|CW269737.1|CW269737 104_740_11401968_148_36232_082 Sorgh... 42 0.13
gb|CW273184.1|CW273184 104_745_11403761_148_35358_069 Sorgh... 42 0.13
gb|CW291056.1|CW291056 104_770_11413348_116_35566_006 Sorgh... 42 0.13
gb|CW299893.1|CW299893 104_783_11463359_116_36249_096 Sorgh... 42 0.13
gb|CW301911.1|CW301911 104_785_11464447_148_36266_018 Sorgh... 42 0.13
gb|CW303765.1|CW303765 104_788_11465414_148_35698_057 Sorgh... 42 0.13
gb|CW309446.1|CW309446 104_798_11469200_116_35734_028 Sorgh... 42 0.13
gb|CW309447.1|CW309447 104_798_11469200_148_35742_028 Sorgh... 42 0.13
gb|CW321367.1|CW321367 104_814_11475512_148_35937_020 Sorgh... 42 0.13
gb|CW324354.1|CW324354 104_818_11477117_116_35904_017 Sorgh... 42 0.13
gb|CW399997.1|CW399997 fsbb001f090b14f0 Sorghum methylation... 42 0.13
gb|CW409709.1|CW409709 fsbb001f104c04k0 Sorghum methylation... 42 0.13
gb|CW428265.1|CW428265 fsbb001f140m05k0 Sorghum methylation... 42 0.13
gb|CW431016.1|CW431016 fsbb001f145a05k0 Sorghum methylation... 42 0.13
gb|AW745956.1|AW745956 WS1_38_B07.g1_A002 Water-stressed 1 ... 42 0.13
gb|BE597509.1|BE597509 PI1_70_D09.b1_A002 Pathogen induced ... 42 0.13
gb|BE918309.1|BE918309 OV1_1_G12.g1_A002 Ovary 1 (OV1) Sorg... 42 0.13
gb|BG051190.1|BG051190 FM1_57_D07.b1_A003 Floral-Induced Me... 42 0.13
gb|CD426959.1|CD426959 SA1_26_C02.b1_A002 Salicylic acid-tr... 42 0.13
gb|BZ628384.1|BZ628384 ih59h03.b1 WGS-SbicolorF (DH5a methy... 40 0.52
gb|BZ628385.1|BZ628385 ih59h03.g1 WGS-SbicolorF (DH5a methy... 40 0.52
gb|CL178163.1|CL178163 104_386_10894366_148_31911_046 Sorgh... 40 0.52
gb|CL195599.1|CL195599 104_421_10942489_114_32310_013 Sorgh... 40 0.52
gb|CW037365.1|CW037365 104_269_10504298_114_30383 Sorghum m... 40 0.52
gb|CW072603.1|CW072603 104_325_10592362_114_30536 Sorghum m... 40 0.52
gb|CW097525.1|CW097525 104_463_11002503_148_34358_054 Sorgh... 40 0.52
gb|CW109709.1|CW109709 104_482_11103275_148_34513_046 Sorgh... 40 0.52
gb|CW125720.1|CW125720 104_506_11112492_116_34721_046 Sorgh... 40 0.52
gb|CW184253.1|CW184253 104_600_11165054_148_36683_055 Sorgh... 40 0.52
gb|CW194074.1|CW194074 104_617_11179908_116_36788_046 Sorgh... 40 0.52
gb|CW256501.1|CW256501 104_721_11226825_148_35142_037 Sorgh... 40 0.52
gb|CW321545.1|CW321545 104_815_11475611_148_35940_048 Sorgh... 40 0.52
gb|CW380964.1|CW380964 fsbb001f062b11k0 Sorghum methylation... 40 0.52
gb|CW448789.1|CW448789 fsbb001f182j09k0 Sorghum methylation... 40 0.52
gb|CW464177.1|CW464177 fsbb001f213e18f0 Sorghum methylation... 40 0.52
gb|CW485776.1|CW485776 fsbb001f248k23k0 Sorghum methylation... 40 0.52
gb|BE356408.1|BE356408 DG1_125_A04.b1_A002 Dark Grown 1 (DG... 40 0.52
gb|BE360293.1|BE360293 DG1_62_G03.g1_A002 Dark Grown 1 (DG1... 40 0.52
gb|CD221220.1|CD221220 CCC1_74_H07.b1_A007 Callus culture/c... 40 0.52
gb|CN142994.1|CN142994 WOUND1_13_B11.g1_A002 Wounded leaves... 40 0.52
gb|CX622337.1|CX622337 GABR1_63_H09.b2_A002 GA- or brassino... 40 0.52
gb|BZ343887.1|BZ343887 hp57f04.b1 WGS-SbicolorF (JM107 adap... 38 2.1
gb|BZ343888.1|BZ343888 hp57f04.b2 WGS-SbicolorF (JM107 adap... 38 2.1
gb|BZ351532.1|BZ351532 hw02e09.g1 WGS-SbicolorF (JM107 adap... 38 2.1
gb|CL148058.1|CL148058 104_327_10592826_116_31781_334 Sorgh... 38 2.1
gb|CL151895.1|CL151895 104_334_10779565_116_31362_349 Sorgh... 38 2.1
gb|CL162433.1|CL162433 104_354_10806404_114_31830_308 Sorgh... 38 2.1
gb|CL162434.1|CL162434 104_354_10806404_116_31831_308 Sorgh... 38 2.1
gb|CL164990.1|CL164990 104_359_10808286_114_31816_270 Sorgh... 38 2.1
gb|CL169291.1|CL169291 104_367_10812514_148_31786_370 Sorgh... 38 2.1
gb|CL173751.1|CL173751 104_377_10891091_116_31793_227 Sorgh... 38 2.1
gb|CL173752.1|CL173752 104_377_10891091_148_31792_227 Sorgh... 38 2.1
gb|CL191189.1|CL191189 104_410_10906618_114_32533_047 Sorgh... 38 2.1
gb|CL191190.1|CL191190 104_410_10906618_116_32537_047 Sorgh... 38 2.1
gb|CW028826.1|CW028826 104_256_10499325_114_30399 Sorghum m... 38 2.1
gb|CW028827.1|CW028827 104_256_10499325_116_30400 Sorghum m... 38 2.1
gb|CW034801.1|CW034801 104_265_10502776_114_30378 Sorghum m... 38 2.1
gb|CW036528.1|CW036528 104_267_10503811_114_30374 Sorghum m... 38 2.1
gb|CW044079.1|CW044079 104_279_10508749_114_30275 Sorghum m... 38 2.1
gb|CW063340.1|CW063340 104_309_10521947_114_30136 Sorghum m... 38 2.1
gb|CW065242.1|CW065242 104_311_10523031_115_30121 Sorghum m... 38 2.1
gb|CW074359.1|CW074359 104_346_10803333_116_31376_309 Sorgh... 38 2.1
gb|CW080240.1|CW080240 104_408_10906067_114_32485_040 Sorgh... 38 2.1
gb|CW083172.1|CW083172 104_425_10944142_114_32353_089 Sorgh... 38 2.1
gb|CW083173.1|CW083173 104_425_10944142_114_32389_089 Sorgh... 38 2.1
gb|CW083174.1|CW083174 104_425_10944142_116_32357_089 Sorgh... 38 2.1
gb|CW091585.1|CW091585 104_453_10998640_114_33029_054 Sorgh... 38 2.1
gb|CW091586.1|CW091586 104_453_10998640_116_33033_054 Sorgh... 38 2.1
gb|CW112600.1|CW112600 104_486_11104977_148_34543_039 Sorgh... 38 2.1
gb|CW146077.1|CW146077 104_538_11138798_148_34981_049 Sorgh... 38 2.1
gb|CW157140.1|CW157140 104_560_11147067_148_36384_010 Sorgh... 38 2.1
gb|CW163425.1|CW163425 104_571_11151453_148_36458_095 Sorgh... 38 2.1
gb|CW165072.1|CW165072 104_573_11152312_148_36476_060 Sorgh... 38 2.1
gb|CW165973.1|CW165973 104_574_11152796_116_36481_072 Sorgh... 38 2.1
gb|CW174796.1|CW174796 104_587_11157597_148_36839_095 Sorgh... 38 2.1
gb|CW179664.1|CW179664 104_593_11160220_116_36626_002 Sorgh... 38 2.1
gb|CW210597.1|CW210597 104_641_11189876_116_37004_078 Sorgh... 38 2.1
gb|CW210598.1|CW210598 104_641_11189876_148_37003_078 Sorgh... 38 2.1
gb|CW227207.1|CW227207 104_665_11205292_116_37230_008 Sorgh... 38 2.1
gb|CW227376.1|CW227376 104_665_11205382_148_37225_083 Sorgh... 38 2.1
gb|CW233833.1|CW233833 104_687_11213656_116_37384_060 Sorgh... 38 2.1
gb|CW233834.1|CW233834 104_687_11213656_148_37383_060 Sorgh... 38 2.1
gb|CW241237.1|CW241237 104_700_11218657_116_37547_009 Sorgh... 38 2.1
gb|CW243462.1|CW243462 104_704_11220059_116_37577_048 Sorgh... 38 2.1
gb|CW248654.1|CW248654 104_710_11222416_148_35034_062 Sorgh... 38 2.1
gb|CW251743.1|CW251743 104_714_11224101_148_35070_087 Sorgh... 38 2.1
gb|CW256097.1|CW256097 104_721_11226597_148_35142_095 Sorgh... 38 2.1
gb|CW277751.1|CW277751 104_752_11406193_148_35680_015 Sorgh... 38 2.1
gb|CW314127.1|CW314127 104_804_11471657_116_35794_069 Sorgh... 38 2.1
gb|CW317837.1|CW317837 104_809_11473628_148_35866_068 Sorgh... 38 2.1
gb|CW329224.1|CW329224 104_825_11479732_116_36003_004 Sorgh... 38 2.1
gb|CW353072.1|CW353072 fsbb001f015k11f0 Sorghum methylation... 38 2.1
gb|CW353216.1|CW353216 fsbb001f015n24k0 Sorghum methylation... 38 2.1
gb|CW358776.1|CW358776 fsbb001f026b21k0 Sorghum methylation... 38 2.1
gb|CW360136.1|CW360136 fsbb001f028b12k0 Sorghum methylation... 38 2.1
gb|CW360442.1|CW360442 fsbb001f028i13k0 Sorghum methylation... 38 2.1
gb|CW365429.1|CW365429 fsbb001f037p11k0 Sorghum methylation... 38 2.1
gb|CW374689.1|CW374689 fsbb001f051k18k0 Sorghum methylation... 38 2.1
gb|CW388212.1|CW388212 fsbb001f072o02f0 Sorghum methylation... 38 2.1
gb|CW402411.1|CW402411 fsbb001f093k20f0 Sorghum methylation... 38 2.1
gb|CW403826.1|CW403826 fsbb001f095l14k0 Sorghum methylation... 38 2.1
gb|CW409407.1|CW409407 fsbb001f103l06f0 Sorghum methylation... 38 2.1
gb|CW417478.1|CW417478 fsbb001f120i06k0 Sorghum methylation... 38 2.1
gb|CW417882.1|CW417882 fsbb001f121b13k0 Sorghum methylation... 38 2.1
gb|CW422401.1|CW422401 fsbb001f131k18k0 Sorghum methylation... 38 2.1
gb|CW424233.1|CW424233 fsbb001f134h10k0 Sorghum methylation... 38 2.1
gb|CW426423.1|CW426423 fsbb001f137m23f0 Sorghum methylation... 38 2.1
gb|CW426424.1|CW426424 fsbb001f137m23k0 Sorghum methylation... 38 2.1
gb|CW443886.1|CW443886 fsbb001f164d13k0 Sorghum methylation... 38 2.1
gb|CW448603.1|CW448603 fsbb001f182e22k0 Sorghum methylation... 38 2.1
gb|CW470115.1|CW470115 fsbb001f223c18k0 Sorghum methylation... 38 2.1
gb|CW487963.1|CW487963 fsbb001f254b18f0 Sorghum methylation... 38 2.1
gb|CW496277.1|CW496277 fsbb001f288h06f0 Sorghum methylation... 38 2.1
gb|CW498819.1|CW498819 fsbb001f293e01k0 Sorghum methylation... 38 2.1
gb|CL697489.2|CL697489 SP__Ba0012B16.f SP__Ba Sorghum propi... 38 2.1
gb|CF434095.1|CF434095 NIT1_32_F02.b1_A002 Nitrogen-deficie... 38 2.1
gb|CX618525.1|CX618525 GABR1_40_D08.b1_A002 GA- or brassino... 38 2.1
gb|AZ922213.1|AZ922213 MRCot2H08 Sorghum bicolor MRCot Sorg... 36 8.1
gb|BZ336257.1|BZ336257 hz30d02.g1 WGS-SbicolorF (JM107 adap... 36 8.1
gb|BZ342095.1|BZ342095 ic80e04.g1 WGS-SbicolorF (JM107 adap... 36 8.1
gb|BZ342523.1|BZ342523 ic84c01.g1 WGS-SbicolorF (JM107 adap... 36 8.1
gb|BZ345860.1|BZ345860 ht57h02.b1 WGS-SbicolorF (JM107 adap... 36 8.1
gb|BZ350556.1|BZ350556 ht57h02.g1 WGS-SbicolorF (JM107 adap... 36 8.1
gb|BZ625725.1|BZ625725 ih40b11.g1 WGS-SbicolorF (DH5a methy... 36 8.1
gb|BZ780143.1|BZ780143 ii37f04.b1 WGS-SbicolorF (DH5a methy... 36 8.1
gb|CL147900.1|CL147900 104_327_10592712_148_31780_220 Sorgh... 36 8.1
gb|CL151174.1|CL151174 104_333_10779060_114_31359_228 Sorgh... 36 8.1
gb|CL167654.1|CL167654 104_364_10810230_116_31803_294 Sorgh... 36 8.1
gb|CL183812.1|CL183812 104_396_10898424_114_31923_264 Sorgh... 36 8.1
gb|CL186595.1|CL186595 104_401_10900314_114_32409_071 Sorgh... 36 8.1
gb|CW512231.1|CW512231 115_1_10510340_1_30023 Sorghum unfil... 36 8.1
gb|CW512848.1|CW512848 115_2_10510983_1_30019 Sorghum unfil... 36 8.1
gb|CW030081.1|CW030081 104_258_10500047_114_30403 Sorghum m... 36 8.1
gb|CW030082.1|CW030082 104_258_10500047_116_30404 Sorghum m... 36 8.1
gb|CW030587.1|CW030587 104_258_10500319_114_30403 Sorghum m... 36 8.1
gb|CW030588.1|CW030588 104_258_10500319_116_30404 Sorghum m... 36 8.1
gb|CW031604.1|CW031604 104_260_10500904_115_30366 Sorghum m... 36 8.1
gb|CW033036.1|CW033036 104_262_10501728_115_30362 Sorghum m... 36 8.1
gb|CW033091.1|CW033091 104_262_10501758_115_30362 Sorghum m... 36 8.1
gb|CW034406.1|CW034406 104_264_10502529_115_30380 Sorghum m... 36 8.1
gb|CW036429.1|CW036429 104_267_10503753_115_30375 Sorghum m... 36 8.1
gb|CW036526.1|CW036526 104_267_10503810_114_30374 Sorghum m... 36 8.1
gb|CW036527.1|CW036527 104_267_10503810_115_30375 Sorghum m... 36 8.1
gb|CW045058.1|CW045058 104_281_10509334_114_30239 Sorghum m... 36 8.1
gb|CW058253.1|CW058253 104_300_10518635_1_30028 Sorghum met... 36 8.1
gb|CW058510.1|CW058510 104_301_10518775_114_30160 Sorghum m... 36 8.1
gb|CW065496.1|CW065496 104_312_10523181_114_30128 Sorghum m... 36 8.1
gb|CW065497.1|CW065497 104_312_10523181_115_30130 Sorghum m... 36 8.1
gb|CW073573.1|CW073573 104_337_10780441_116_31368_073 Sorgh... 36 8.1
gb|CW081025.1|CW081025 104_416_10940761_114_32267_005 Sorgh... 36 8.1
gb|CW081026.1|CW081026 104_416_10940761_114_32343_005 Sorgh... 36 8.1
gb|CW081027.1|CW081027 104_416_10940761_116_32271_005 Sorgh... 36 8.1
gb|CW082716.1|CW082716 104_425_10943964_114_32351_048 Sorgh... 36 8.1
gb|CW082717.1|CW082717 104_425_10943964_114_32387_048 Sorgh... 36 8.1
gb|CW082718.1|CW082718 104_425_10943964_116_32355_048 Sorgh... 36 8.1
gb|CW089359.1|CW089359 104_434_10948665_114_32601_035 Sorgh... 36 8.1
gb|CW098671.1|CW098671 104_465_11003131_148_34370_076 Sorgh... 36 8.1
gb|CW130317.1|CW130317 104_512_11115049_116_34770_003 Sorgh... 36 8.1
gb|CW130318.1|CW130318 104_512_11115049_148_34774_003 Sorgh... 36 8.1
gb|CW147027.1|CW147027 104_540_11139301_116_34998_061 Sorgh... 36 8.1
gb|CW147469.1|CW147469 104_540_11139526_116_34997_083 Sorgh... 36 8.1
gb|CW161424.1|CW161424 104_568_11150406_116_36432_025 Sorgh... 36 8.1
gb|CW161425.1|CW161425 104_568_11150406_148_36431_025 Sorgh... 36 8.1
gb|CW167940.1|CW167940 104_577_11153876_116_36494_074 Sorgh... 36 8.1
gb|CW179149.1|CW179149 104_593_11159947_148_36629_078 Sorgh... 36 8.1
gb|CW186545.1|CW186545 104_604_11166626_116_36708_005 Sorgh... 36 8.1
gb|CW186546.1|CW186546 104_604_11166626_148_36707_005 Sorgh... 36 8.1
gb|CW186675.1|CW186675 104_604_11166691_148_36706_068 Sorgh... 36 8.1
gb|CW208355.1|CW208355 104_637_11188628_148_37045_066 Sorgh... 36 8.1
gb|CW216050.1|CW216050 104_648_11194907_116_37113_036 Sorgh... 36 8.1
gb|CW216051.1|CW216051 104_648_11194907_148_37114_036 Sorgh... 36 8.1
gb|CW221073.1|CW221073 104_656_11197702_148_37170_095 Sorgh... 36 8.1
gb|CW221739.1|CW221739 104_657_11202007_148_37174_032 Sorgh... 36 8.1
gb|CW225470.1|CW225470 104_663_11204370_116_37210_077 Sorgh... 36 8.1
gb|CW227134.1|CW227134 104_665_11205253_148_37228_057 Sorgh... 36 8.1
gb|CW227416.1|CW227416 104_665_11205405_148_37228_083 Sorgh... 36 8.1
gb|CW233777.1|CW233777 104_687_11213626_148_37379_043 Sorgh... 36 8.1
gb|CW257940.1|CW257940 104_723_11227606_148_35155_085 Sorgh... 36 8.1
gb|CW259060.1|CW259060 104_725_11228219_148_35178_044 Sorgh... 36 8.1
gb|CW262689.1|CW262689 104_730_11230218_116_35227_073 Sorgh... 36 8.1
gb|CW262690.1|CW262690 104_730_11230218_148_35222_073 Sorgh... 36 8.1
gb|CW263564.1|CW263564 104_731_11230781_116_35213_017 Sorgh... 36 8.1
gb|CW265242.1|CW265242 104_734_11231756_148_35264_074 Sorgh... 36 8.1
gb|CW265527.1|CW265527 104_734_11231929_116_35259_001 Sorgh... 36 8.1
gb|CW272251.1|CW272251 104_744_11403353_116_36225_071 Sorgh... 36 8.1
gb|CW283379.1|CW283379 104_759_11409214_148_35476_083 Sorgh... 36 8.1
gb|CW293572.1|CW293572 104_774_11414727_116_35773_062 Sorgh... 36 8.1
gb|CW293573.1|CW293573 104_774_11414727_148_35772_062 Sorgh... 36 8.1
gb|CW311568.1|CW311568 104_801_11470300_116_36284_014 Sorgh... 36 8.1
gb|CW315583.1|CW315583 104_806_11472440_148_35828_020 Sorgh... 36 8.1
gb|CW315950.1|CW315950 104_807_11472635_116_35840_044 Sorgh... 36 8.1
gb|CW319865.1|CW319865 104_812_11474709_116_35886_085 Sorgh... 36 8.1
gb|CW337426.1|CW337426 104_837_11484157_116_36114_059 Sorgh... 36 8.1
gb|CW338310.1|CW338310 104_838_11484677_116_36122_021 Sorgh... 36 8.1
gb|CW338311.1|CW338311 104_838_11484677_148_36123_021 Sorgh... 36 8.1
gb|CW345628.1|CW345628 104_848_11488596_116_36212_036 Sorgh... 36 8.1
gb|CW345629.1|CW345629 104_848_11488596_148_36211_036 Sorgh... 36 8.1
gb|CW352865.1|CW352865 fsbb001f015f16k0 Sorghum methylation... 36 8.1
gb|CW355554.1|CW355554 fsbb001f020d20f0 Sorghum methylation... 36 8.1
gb|CW355555.1|CW355555 fsbb001f020d20k0 Sorghum methylation... 36 8.1
gb|CW361397.1|CW361397 fsbb001f029p06f0 Sorghum methylation... 36 8.1
gb|CW368648.1|CW368648 fsbb001f042l07k0 Sorghum methylation... 36 8.1
gb|CW377026.1|CW377026 fsbb001f055c18k0 Sorghum methylation... 36 8.1
gb|CW377760.1|CW377760 fsbb001f056d14k0 Sorghum methylation... 36 8.1
gb|CW379648.1|CW379648 fsbb001f059a10f0 Sorghum methylation... 36 8.1
gb|CW385392.1|CW385392 fsbb001f068n16f0 Sorghum methylation... 36 8.1
gb|CW389482.1|CW389482 fsbb001f074l05k0 Sorghum methylation... 36 8.1
gb|CW395800.1|CW395800 fsbb001f083p17f0 Sorghum methylation... 36 8.1
gb|CW397336.1|CW397336 fsbb001f086d08f0 Sorghum methylation... 36 8.1
gb|CW397337.1|CW397337 fsbb001f086d08k0 Sorghum methylation... 36 8.1
gb|CW397641.1|CW397641 fsbb001f086l10f0 Sorghum methylation... 36 8.1
gb|CW397642.1|CW397642 fsbb001f086l10k0 Sorghum methylation... 36 8.1
gb|CW400582.1|CW400582 fsbb001f090p15k0 Sorghum methylation... 36 8.1
gb|CW403684.1|CW403684 fsbb001f095i10f0 Sorghum methylation... 36 8.1
gb|CW411276.1|CW411276 fsbb001f106g05f0 Sorghum methylation... 36 8.1
gb|CW411277.1|CW411277 fsbb001f106g05k0 Sorghum methylation... 36 8.1
gb|CW416798.1|CW416798 fsbb001f117i04f0 Sorghum methylation... 36 8.1
gb|CW418255.1|CW418255 fsbb001f121k04k0 Sorghum methylation... 36 8.1
gb|CW420050.1|CW420050 fsbb001f126c24k0 Sorghum methylation... 36 8.1
gb|CW422099.1|CW422099 fsbb001f131d14f0 Sorghum methylation... 36 8.1
gb|CW428242.1|CW428242 fsbb001f140l12k0 Sorghum methylation... 36 8.1
gb|CW432598.1|CW432598 fsbb001f147g09f0 Sorghum methylation... 36 8.1
gb|CW438663.1|CW438663 fsbb001f156g14k0 Sorghum methylation... 36 8.1
gb|CW440010.1|CW440010 fsbb001f158h03f0 Sorghum methylation... 36 8.1
gb|CW442555.1|CW442555 fsbb001f162e12f0 Sorghum methylation... 36 8.1
gb|CW442556.1|CW442556 fsbb001f162e12k0 Sorghum methylation... 36 8.1
gb|CW445793.1|CW445793 fsbb001f171c06k0 Sorghum methylation... 36 8.1
gb|CW446891.1|CW446891 fsbb001f179m04f0 Sorghum methylation... 36 8.1
gb|CW447056.1|CW447056 fsbb001f179p14k0 Sorghum methylation... 36 8.1
gb|CW448237.1|CW448237 fsbb001f181m02f0 Sorghum methylation... 36 8.1
gb|CW452209.1|CW452209 fsbb001f192k05f0 Sorghum methylation... 36 8.1
gb|CW452210.1|CW452210 fsbb001f192k05k0 Sorghum methylation... 36 8.1
gb|CW454522.1|CW454522 fsbb001f199a01k0 Sorghum methylation... 36 8.1
gb|CW455093.1|CW455093 fsbb001f199n07f0 Sorghum methylation... 36 8.1
gb|CW467552.1|CW467552 fsbb001f219e19k0 Sorghum methylation... 36 8.1
gb|CW474569.1|CW474569 fsbb001f230h24f0 Sorghum methylation... 36 8.1
gb|CW476241.1|CW476241 fsbb001f233a05k0 Sorghum methylation... 36 8.1
gb|CW488432.1|CW488432 fsbb001f254n09f0 Sorghum methylation... 36 8.1
gb|CW489631.1|CW489631 fsbb001f274k16k0 Sorghum methylation... 36 8.1
gb|CW494930.1|CW494930 fsbb001f286h10k0 Sorghum methylation... 36 8.1
gb|CW500167.1|CW500167 fsbb001f295f10k0 Sorghum methylation... 36 8.1
gb|CW501710.1|CW501710 fsbb001f297k17k0 Sorghum methylation... 36 8.1
gb|CL697780.2|CL697780 SP__Ba0016O06.f SP__Ba Sorghum propi... 36 8.1
gb|AW564759.1|AW564759 LG1_301_C03.b1_A002 Light Grown 1 (L... 36 8.1
gb|AW671905.1|AW671905 LG1_352_D03.b1_A002 Light Grown 1 (L... 36 8.1
gb|BG159395.1|BG159395 OV2_7_C11.g1_A002 Ovary 2 (OV2) Sorg... 36 8.1
gb|BI075079.1|BI075079 IP1_20_C11.g1_A002 Immature pannicle... 36 8.1
gb|CF433909.1|CF433909 NIT1_31_G12.b1_A002 Nitrogen-deficie... 36 8.1
gb|CF488797.1|CF488797 POL1_52_F08.b1_A002 Pollen Sorghum b... 36 8.1
gb|CF756747.1|CF756747 DSAF1_8_G02.g1_A011 Drought-stressed... 36 8.1
gb|CN129241.1|CN129241 RHOH1_34_G03.b3_A002 Acid- and alkal... 36 8.1
gb|CN136558.1|CN136558 OX1_44_A05.b1_A002 Oxidatively-stres... 36 8.1
gb|AC120496.2| Genomic sequence for Sorghum bicolor, clone ... 36 8.1
gb|AC169373.1| Sorghum bicolor clone SB_BBc0188M08, WORKING... 36 8.1
gb|AC169376.1| Sorghum bicolor clone SB_BBc0046M17, WORKING... 36 8.1
>gb|CW094630.1|CW094630 104_459_11000809_148_34271_011 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11000809, DNA
sequence
Length = 648
Score = 93.7 bits (47), Expect = 4e-017
Identities = 77/87 (88%)
Strand = Plus / Plus
Query: 545 gtccatggagacatcaagccttccaacatcctccttgacgatgacctcaatccaaaagtc 604
|||||||| || ||||||| |||||||||||||||| |||||||||||||| || ||
Sbjct: 239 gtccatggcgatgtcaagcccgccaacatcctccttgatgatgacctcaatccgaaggtg 298
Query: 605 tctgactttggttcctccaagctcctg 631
|||||||||||||| ||||||||||||
Sbjct: 299 tctgactttggttcgtccaagctcctg 325
Score = 67.9 bits (34), Expect = 2e-009
Identities = 73/86 (84%)
Strand = Plus / Plus
Query: 677 tacatggacccattatatatgaagaccgagcacttcacattggagtgcgatgtctacagc 736
||||| |||||| ||||||||||||| | |||||| || || ||||||| ||||||
Sbjct: 368 tacatagacccagtatatatgaagacacgccgtttcacagtgaagagcgatgtttacagc 427
Query: 737 ttcggcgtggtgcttctggagctcat 762
||||| ||||||||||||||||||||
Sbjct: 428 ttcggtgtggtgcttctggagctcat 453
Score = 42.1 bits (21), Expect = 0.13
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 827 ttcgtcaagtgcttcaaggaccacggtagcggatgtgcgatgtatgata 875
|||| |||||||||||||||| | ||||||||| | |||||||||||
Sbjct: 503 ttcggcaagtgcttcaaggacgagggtagcggaaggaagatgtatgata 551
>gb|CW350282.1|CW350282 fsbb001f011i03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f011i03, DNA
sequence
Length = 613
Score = 93.7 bits (47), Expect = 4e-017
Identities = 77/87 (88%)
Strand = Plus / Plus
Query: 545 gtccatggagacatcaagccttccaacatcctccttgacgatgacctcaatccaaaagtc 604
|||||||| || ||||||| |||||||||||||||| |||||||||||||| || ||
Sbjct: 161 gtccatggcgatgtcaagcccgccaacatcctccttgatgatgacctcaatccgaaggtg 220
Query: 605 tctgactttggttcctccaagctcctg 631
|||||||||||||| ||||||||||||
Sbjct: 221 tctgactttggttcgtccaagctcctg 247
Score = 67.9 bits (34), Expect = 2e-009
Identities = 73/86 (84%)
Strand = Plus / Plus
Query: 677 tacatggacccattatatatgaagaccgagcacttcacattggagtgcgatgtctacagc 736
||||| |||||| ||||||||||||| | |||||| || || ||||||| ||||||
Sbjct: 290 tacatagacccagtatatatgaagacacgccgtttcacagtgaagagcgatgtttacagc 349
Query: 737 ttcggcgtggtgcttctggagctcat 762
||||| ||||||||||||||||||||
Sbjct: 350 ttcggtgtggtgcttctggagctcat 375
Score = 46.1 bits (23), Expect = 0.008
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 980 gagaggccaaccatggcagaggttgtcgaggagct 1014
||||| |||||||||||||||| ||| ||||||||
Sbjct: 579 gagagaccaaccatggcagagggtgttgaggagct 613
Score = 42.1 bits (21), Expect = 0.13
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 827 ttcgtcaagtgcttcaaggaccacggtagcggatgtgcgatgtatgata 875
|||| |||||||||||||||| | ||||||||| | |||||||||||
Sbjct: 425 ttcggcaagtgcttcaaggacgagggtagcggaaggaagatgtatgata 473
>gb|CW415630.1|CW415630 fsbb001f115n04f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f115n04, DNA
sequence
Length = 604
Score = 67.9 bits (34), Expect = 2e-009
Identities = 73/86 (84%)
Strand = Plus / Minus
Query: 677 tacatggacccattatatatgaagaccgagcacttcacattggagtgcgatgtctacagc 736
||||| |||||| ||||||||||||| | |||||| || || ||||||| ||||||
Sbjct: 563 tacatagacccagtatatatgaagacacgccgtttcacagtgaagagcgatgtttacagc 504
Query: 737 ttcggcgtggtgcttctggagctcat 762
||||| ||||||||||||||||||||
Sbjct: 503 ttcggtgtggtgcttctggagctcat 478
Score = 63.9 bits (32), Expect = 4e-008
Identities = 38/40 (95%)
Strand = Plus / Minus
Query: 980 gagaggccaaccatggcagaggttgtcgaggagcttaagc 1019
||||| |||||||||||||||||||| |||||||||||||
Sbjct: 274 gagagaccaaccatggcagaggttgttgaggagcttaagc 235
Score = 42.1 bits (21), Expect = 0.13
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 827 ttcgtcaagtgcttcaaggaccacggtagcggatgtgcgatgtatgata 875
|||| |||||||||||||||| | ||||||||| | |||||||||||
Sbjct: 428 ttcggcaagtgcttcaaggacgagggtagcggaaggaagatgtatgata 380
>gb|CW350281.1|CW350281 fsbb001f011i03f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f011i03, DNA
sequence
Length = 707
Score = 65.9 bits (33), Expect = 9e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 710 ttcacattggagtgcgatgtctacagcttcggcgtggtgcttctggagctcat 762
|||||| || || ||||||| ||||||||||| ||||||||||||||||||||
Sbjct: 670 ttcacagtgaagagcgatgtttacagcttcggtgtggtgcttctggagctcat 618
Score = 63.9 bits (32), Expect = 4e-008
Identities = 38/40 (95%)
Strand = Plus / Minus
Query: 980 gagaggccaaccatggcagaggttgtcgaggagcttaagc 1019
||||| |||||||||||||||||||| |||||||||||||
Sbjct: 414 gagagaccaaccatggcagaggttgttgaggagcttaagc 375
Score = 42.1 bits (21), Expect = 0.13
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 827 ttcgtcaagtgcttcaaggaccacggtagcggatgtgcgatgtatgata 875
|||| |||||||||||||||| | ||||||||| | |||||||||||
Sbjct: 568 ttcggcaagtgcttcaaggacgagggtagcggaaggaagatgtatgata 520
>gb|CW033793.1|CW033793 104_263_10502159_114_30359 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10502159, DNA
sequence
Length = 636
Score = 63.9 bits (32), Expect = 4e-008
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||||||||| ||||||||||||||||||||
Sbjct: 102 tacagcttcggcgtgatgcttctggagctcatcacg 137
>gb|CW084303.1|CW084303 104_427_10945702_114_32506_095 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10945702, DNA
sequence
Length = 604
Score = 63.9 bits (32), Expect = 4e-008
Identities = 35/36 (97%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||||||||| ||||||||||||||||||||
Sbjct: 377 tacagcttcggcgtgatgcttctggagctcatcacg 342
>gb|CW126527.1|CW126527 104_507_11112946_116_34735_043 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11112946, DNA
sequence
Length = 628
Score = 63.9 bits (32), Expect = 4e-008
Identities = 35/36 (97%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||||||||| ||||||||||||||||||||
Sbjct: 412 tacagcttcggcgtgatgcttctggagctcatcacg 377
>gb|CW148333.1|CW148333 104_542_11140364_148_35007_066 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11140364, DNA
sequence
Length = 571
Score = 63.9 bits (32), Expect = 4e-008
Identities = 35/36 (97%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||||||||| ||||||||||||||||||||
Sbjct: 372 tacagcttcggcgtgatgcttctggagctcatcacg 337
>gb|CW404087.1|CW404087 fsbb001f096b12k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f096b12, DNA
sequence
Length = 381
Score = 63.9 bits (32), Expect = 4e-008
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||||||||| ||||||||||||||||||||
Sbjct: 287 tacagcttcggcgtgatgcttctggagctcatcacg 322
>gb|CW407745.1|CW407745 fsbb001f101f16f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f101f16, DNA
sequence
Length = 749
Score = 63.9 bits (32), Expect = 4e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatcacg 766
|||| ||||||||||||||||| ||||| |||||||||||||||
Sbjct: 174 gcgacgtctacagcttcggcgtcgtgctgctggagctcatcacg 217
>gb|CW463488.1|CW463488 fsbb001f212c08f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f212c08, DNA
sequence
Length = 542
Score = 63.9 bits (32), Expect = 4e-008
Identities = 41/44 (93%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatcacg 766
|||| ||||||||||||||||| ||||| |||||||||||||||
Sbjct: 380 gcgacgtctacagcttcggcgtcgtgctgctggagctcatcacg 337
>gb|BE363874.1|BE363874 PI1_10_D09.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 530
Score = 63.9 bits (32), Expect = 4e-008
Identities = 41/44 (93%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatcacg 766
|||| ||||||||||||||||| ||||| |||||||||||||||
Sbjct: 473 gcgacgtctacagcttcggcgtcgtgctgctggagctcatcacg 516
>gb|CW052383.1|CW052383 104_292_10515531_114_30286 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10515531, DNA
sequence
Length = 763
Score = 61.9 bits (31), Expect = 1e-007
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcac 765
|||||||||||||||||||| ||||||||||||||
Sbjct: 657 tacagcttcggcgtggtgctgctggagctcatcac 691
>gb|CW094629.1|CW094629 104_459_11000809_116_34275_011 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11000809, DNA
sequence
Length = 645
Score = 61.9 bits (31), Expect = 1e-007
Identities = 37/39 (94%)
Strand = Plus / Minus
Query: 981 agaggccaaccatggcagaggttgtcgaggagcttaagc 1019
|||| |||||||||||||||||||| |||||||||||||
Sbjct: 645 agagaccaaccatggcagaggttgttgaggagcttaagc 607
>gb|CW132498.1|CW132498 104_515_11116244_148_34793_066 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11116244, DNA
sequence
Length = 399
Score = 61.9 bits (31), Expect = 1e-007
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcac 765
|||||||||||||||||||| ||||||||||||||
Sbjct: 182 tacagcttcggcgtggtgctgctggagctcatcac 216
>gb|CW342248.1|CW342248 104_844_11486771_116_36177_048 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11486771, DNA
sequence
Length = 642
Score = 56.0 bits (28), Expect = 9e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatcacg 766
|||| |||||||||||||||||| |||| ||||||||| |||||
Sbjct: 426 gcgacgtctacagcttcggcgtgctgctgctggagctcctcacg 469
>gb|CW357527.1|CW357527 fsbb001f024d13f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f024d13, DNA
sequence
Length = 757
Score = 56.0 bits (28), Expect = 9e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatcacg 766
|||| |||||||||||||||||| |||| ||||||||| |||||
Sbjct: 112 gcgacgtctacagcttcggcgtgctgctgctggagctcctcacg 155
>gb|CW243915.1|CW243915 104_704_11220309_116_37577_085 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11220309, DNA
sequence
Length = 722
Score = 54.0 bits (27), Expect = 3e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || ||||||||||||||
Sbjct: 249 gatgtctacagcttcggagttgtgcttctggagct 215
>gb|CW255366.1|CW255366 104_720_11226196_148_35135_016 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226196, DNA
sequence
Length = 671
Score = 54.0 bits (27), Expect = 3e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || ||||||||||||||
Sbjct: 123 gatgtctacagcttcggagttgtgcttctggagct 89
>gb|CW269445.1|CW269445 104_740_11401847_148_35314_086 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11401847, DNA
sequence
Length = 550
Score = 54.0 bits (27), Expect = 3e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || ||||||||||||||
Sbjct: 206 gatgtctacagcttcggagttgtgcttctggagct 172
>gb|CW279473.1|CW279473 104_754_11407096_116_35436_060 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11407096, DNA
sequence
Length = 713
Score = 54.0 bits (27), Expect = 3e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || ||||||||||||||
Sbjct: 149 gatgtctacagcttcggagttgtgcttctggagct 115
>gb|CW500296.1|CW500296 fsbb001f295i21f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f295i21, DNA
sequence
Length = 707
Score = 54.0 bits (27), Expect = 3e-005
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
||||||||||||||||| || ||||||||||||||
Sbjct: 453 gatgtctacagcttcggagttgtgcttctggagct 487
>gb|BZ412858.1|BZ412858 122c5_59 Subclones from BAC clones mapped to Sorghum bicolor
chromosome 3 Sorghum bicolor genomic clone 122c5, DNA
sequence
Length = 761
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| ||||| ||||||||||
Sbjct: 108 gtctacagcttcggcgtcgtgctcctggagctca 75
>gb|BZ412953.1|BZ412953 48c11_59 Subclones from BAC clones mapped to Sorghum bicolor
chromosome 3 Sorghum bicolor genomic clone 48c11, DNA
sequence
Length = 763
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| ||||| ||||||||||
Sbjct: 108 gtctacagcttcggcgtcgtgctcctggagctca 75
>gb|CL162934.1|CL162934 104_355_10806773_114_31832_293 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10806773, DNA
sequence
Length = 779
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 722 tgcgatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||||||||||||| |||| |||||
Sbjct: 103 tgcgacgtctacagcttcggcgtggtggttcttgagct 66
>gb|CW032509.1|CW032509 104_261_10501416_114_30363 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10501416, DNA
sequence
Length = 628
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| ||||| ||||||||||
Sbjct: 62 gtctacagcttcggcgtcgtgctcctggagctca 95
>gb|CW090626.1|CW090626 104_436_10949386_116_32609_037 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10949386, DNA
sequence
Length = 700
Score = 52.0 bits (26), Expect = 1e-004
Identities = 29/30 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctc 760
|||||||||||||||||||| |||||||||
Sbjct: 622 tacagcttcggcgtggtgctcctggagctc 593
>gb|CW092912.1|CW092912 104_455_10999455_114_33045_052 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10999455, DNA
sequence
Length = 489
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||| |||||||||||| ||||||||||||||
Sbjct: 70 tctacagctacggcgtggtgctgatggagctcatcacg 107
>gb|CW096655.1|CW096655 104_462_11002018_116_34351_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11002018, DNA
sequence
Length = 683
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||| |||||||||||| ||||||||||||||
Sbjct: 391 tctacagctacggcgtggtgctgatggagctcatcacg 428
>gb|CW096656.1|CW096656 104_462_11002018_148_34355_041 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11002018, DNA
sequence
Length = 666
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||| |||||||||||| ||||||||||||||
Sbjct: 546 tctacagctacggcgtggtgctgatggagctcatcacg 509
>gb|CW110021.1|CW110021 104_482_11103456_116_34512_088 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11103456, DNA
sequence
Length = 582
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| ||||| ||||||||||
Sbjct: 182 gtctacagcttcggcgtcgtgctcctggagctca 149
>gb|CW169339.1|CW169339 104_579_11154622_116_36506_091 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11154622, DNA
sequence
Length = 710
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| ||||| ||||||||||
Sbjct: 655 gtctacagcttcggcgtcgtgctcctggagctca 622
>gb|CW169340.1|CW169340 104_579_11154622_148_36505_091 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11154622, DNA
sequence
Length = 694
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| ||||| ||||||||||
Sbjct: 491 gtctacagcttcggcgtcgtgctcctggagctca 524
>gb|CW177622.1|CW177622 104_591_11159125_148_36612_063 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11159125, DNA
sequence
Length = 717
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| ||||| ||||||||||
Sbjct: 387 gtctacagcttcggcgtcgtgctcctggagctca 354
>gb|CW207823.1|CW207823 104_637_11188356_148_37047_046 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11188356, DNA
sequence
Length = 722
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| ||||| ||||||||||
Sbjct: 183 gtctacagcttcggcgtcgtgctcctggagctca 216
>gb|CW233146.1|CW233146 104_686_11213214_116_37376_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11213214, DNA
sequence
Length = 659
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 722 tgcgatgtctacagcttcggcgtggtgcttctggagct 759
||||| ||||||||||||||||||||| |||| |||||
Sbjct: 483 tgcgacgtctacagcttcggcgtggtggttcttgagct 446
>gb|CW337876.1|CW337876 104_838_11484447_116_36122_064 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11484447, DNA
sequence
Length = 501
Score = 52.0 bits (26), Expect = 1e-004
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||| |||||||||||| ||||||||||||||
Sbjct: 53 tctacagctacggcgtggtgctgatggagctcatcacg 90
>gb|CF756177.1|CF756177 DSAF1_4_B11.b1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_4_B11_A011 5', mRNA sequence
Length = 468
Score = 52.0 bits (26), Expect = 1e-004
Identities = 32/34 (94%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| ||||| ||||||||||
Sbjct: 33 gtctacagcttcggcgtcgtgctcctggagctca 66
>gb|CC059212.1|CC059212 ii20g12.b1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ii20g12, DNA sequence
Length = 459
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 7 tacagcttcggcgtggtgctgctggagct 35
>gb|CL190420.1|CL190420 104_408_10906072_114_32486_056 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10906072, DNA
sequence
Length = 686
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 35 tacagcttcggcgtggtgctgctggagct 63
>gb|CW020813.1|CW020813 104_109_10409182_116_30500 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10409182, DNA
sequence
Length = 283
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 85 tacagcttcggcgtggtgctgctggagct 57
>gb|CW045992.1|CW045992 104_282_10509894_114_30231 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10509894, DNA
sequence
Length = 543
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 316 tacagcttcggcgtggtgctgctggagct 288
>gb|CW063654.1|CW063654 104_309_10522127_114_30134 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10522127, DNA
sequence
Length = 682
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctc 760
|||||||||||||| |||||||| |||||||||
Sbjct: 141 gtctacagcttcggagtggtgctactggagctc 173
>gb|CW063930.1|CW063930 104_309_10522281_115_30140 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10522281, DNA
sequence
Length = 619
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 447 tacagcttcggcgtggtgctgctggagct 419
>gb|CW125365.1|CW125365 104_505_11112290_148_34710_005 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11112290, DNA
sequence
Length = 561
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 127 tacagcttcggcgtggtgctgctggagct 99
>gb|CW167320.1|CW167320 104_576_11153539_148_36490_072 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11153539, DNA
sequence
Length = 748
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatc 763
|||| |||||||||||||||||||| | ||||||||||||
Sbjct: 707 gcgacgtctacagcttcggcgtggtcatgctggagctcatc 667
>gb|CW172499.1|CW172499 104_583_11156324_116_36536_068 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11156324, DNA
sequence
Length = 655
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatc 763
|||| |||||||||||||||||||| | ||||||||||||
Sbjct: 430 gcgacgtctacagcttcggcgtggtcatgctggagctcatc 390
>gb|CW177728.1|CW177728 104_591_11159182_116_36614_093 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11159182, DNA
sequence
Length = 700
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctc 760
|||||||||||||| |||||||| |||||||||
Sbjct: 640 gtctacagcttcggagtggtgctactggagctc 608
>gb|CW181665.1|CW181665 104_596_11163633_116_36651_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11163633, DNA
sequence
Length = 674
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 455 tacagcttcggcgtggtgctgctggagct 483
>gb|CW181666.1|CW181666 104_596_11163633_148_36652_035 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11163633, DNA
sequence
Length = 730
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 519 tacagcttcggcgtggtgctgctggagct 491
>gb|CW220785.1|CW220785 104_655_11197546_148_37155_037 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11197546, DNA
sequence
Length = 643
Score = 50.1 bits (25), Expect = 5e-004
Identities = 34/37 (91%)
Strand = Plus / Minus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatcac 765
|||||||||||||||| ||||| || |||||||||||
Sbjct: 185 tctacagcttcggcgtcgtgctgctcgagctcatcac 149
>gb|CW228912.1|CW228912 104_670_11207026_148_37261_047 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11207026, DNA
sequence
Length = 628
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctc 760
|||||||||||||| |||||||| |||||||||
Sbjct: 364 gtctacagcttcggagtggtgctactggagctc 396
>gb|CW233326.1|CW233326 104_686_11213341_148_37370_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11213341, DNA
sequence
Length = 751
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctc 760
|||||||||||||| |||||||| |||||||||
Sbjct: 330 gtctacagcttcggagtggtgctactggagctc 362
>gb|CW235889.1|CW235889 104_691_11215272_116_37493_088 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11215272, DNA
sequence
Length = 678
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatc 763
|||| |||||||||||||||||||| | ||||||||||||
Sbjct: 590 gcgacgtctacagcttcggcgtggtcatgctggagctcatc 550
>gb|CW299007.1|CW299007 104_781_11462878_148_35657_083 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11462878, DNA
sequence
Length = 544
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 201 tacagcttcggcgtggtgctgctggagct 229
>gb|CW312700.1|CW312700 104_802_11470900_148_35777_004 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11470900, DNA
sequence
Length = 623
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 102 tacagcttcggcgtggtgctgctggagct 130
>gb|CW339578.1|CW339578 104_840_11485344_116_36145_092 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11485344, DNA
sequence
Length = 664
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 266 tacagcttcggcgtggtgctgctggagct 294
>gb|CW342215.1|CW342215 104_844_11486753_116_36173_079 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11486753, DNA
sequence
Length = 614
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 268 tacagcttcggcgtggtgctcctggagct 296
>gb|CW350609.1|CW350609 fsbb001f012a05f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f012a05, DNA
sequence
Length = 688
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 197 tacagcttcggcgtggtgctgctggagct 225
>gb|CW355093.1|CW355093 fsbb001f019j09k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f019j09, DNA
sequence
Length = 710
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctc 760
|||||||||||||| |||||||| |||||||||
Sbjct: 64 gtctacagcttcggggtggtgctgctggagctc 32
>gb|CW358418.1|CW358418 fsbb001f025i22k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f025i22, DNA
sequence
Length = 583
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 332 tacagcttcggcgtggtgctgctggagct 360
>gb|CW364232.1|CW364232 fsbb001f036c22k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f036c22, DNA
sequence
Length = 540
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 59 tacagcttcggcgtggtgctgctggagct 31
>gb|CW377497.1|CW377497 fsbb001f055n11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f055n11, DNA
sequence
Length = 698
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctc 760
|||||||||||||| ||||||||||| ||||||
Sbjct: 623 gtctacagcttcggggtggtgcttctagagctc 591
>gb|CW412562.1|CW412562 fsbb001f108e03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f108e03, DNA
sequence
Length = 522
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 306 tacagcttcggcgtggtgctgctggagct 278
>gb|CW438914.1|CW438914 fsbb001f156m16k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f156m16, DNA
sequence
Length = 529
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 267 tacagcttcggcgtggtgctgctggagct 239
>gb|CW441372.1|CW441372 fsbb001f160h21k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f160h21, DNA
sequence
Length = 793
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctc 760
|||||||||||||| ||||||||||| ||||||
Sbjct: 649 gtctacagcttcggggtggtgcttctagagctc 681
>gb|CW442671.1|CW442671 fsbb001f162h03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f162h03, DNA
sequence
Length = 691
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctc 760
|||||||||||||| |||||||| |||||||||
Sbjct: 178 gtctacagcttcggagtggtgctactggagctc 146
>gb|CW447676.1|CW447676 fsbb001f180o15k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f180o15, DNA
sequence
Length = 71
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 13 tacagcttcggcgtggtgctgctggagct 41
>gb|CW450007.1|CW450007 fsbb001f188g21f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f188g21, DNA
sequence
Length = 545
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 233 tacagcttcggcgtggtgctgctggagct 261
>gb|CW450335.1|CW450335 fsbb001f188o18f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f188o18, DNA
sequence
Length = 664
Score = 50.1 bits (25), Expect = 5e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctc 760
|||||||||||||| ||||||||||| ||||||
Sbjct: 171 gtctacagcttcggggtggtgcttctagagctc 203
>gb|CW483773.1|CW483773 fsbb001f245j03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f245j03, DNA
sequence
Length = 658
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 84 tacagcttcggcgtggtgctgctggagct 56
>gb|CW485477.1|CW485477 fsbb001f248e02f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f248e02, DNA
sequence
Length = 683
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 132 tacagcttcggcgtggtgctgctggagct 104
>gb|AW565183.1|AW565183 LG1_328_A06.b1_A002 Light Grown 1 (LG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 623
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 17 tacagcttcggcgtggtgctgctggagct 45
>gb|BE355165.1|BE355165 DG1_10_E04.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 425
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 56 tacagcttcggcgtggtgctgctggagct 84
>gb|BE355167.1|BE355167 DG1_10_E02.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 683
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 133 tacagcttcggcgtggtgctgctggagct 161
>gb|BE600418.1|BE600418 PI1_96_A09.g1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 574
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 24 tacagcttcggcgtggtgctgctggagct 52
>gb|BM318083.1|BM318083 PI1_78_C11.g9_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 615
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 57 tacagcttcggcgtggtgctgctggagct 85
>gb|CB927244.1|CB927244 ABA1_14_A11.b1_A012 Abscisic acid-treated seedlings Sorghum bicolor
cDNA clone ABA1_14_A11_A012 3', mRNA sequence
Length = 636
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 56 tacagcttcggcgtggtgctgctggagct 84
>gb|CD204014.1|CD204014 HS1_3_A08.b1_A012 Heat-shocked seedlings Sorghum bicolor cDNA clone
HS1_3_A08_A012 3', mRNA sequence
Length = 656
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 76 tacagcttcggcgtggtgctgctggagct 104
>gb|CF755727.1|CF755727 DSAF1_1_B09.b1_A011 Drought-stressed after flowering Sorghum
bicolor cDNA clone DSAF1_1_B09_A011 5', mRNA sequence
Length = 555
Score = 50.1 bits (25), Expect = 5e-004
Identities = 37/41 (90%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagctcatcac 765
||||||||||| ||||| |||||||| ||||||||| ||||
Sbjct: 314 gatgtctacagtttcggtgtggtgctgctggagctcgtcac 354
>gb|CN142795.1|CN142795 WOUND1_12_F08.b1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_12_F08_A002 3', mRNA sequence
Length = 647
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 162 tacagcttcggcgtggtgctgctggagct 190
>gb|CX611168.1|CX611168 ANR1_23_B11.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_23_B11_A002 3', mRNA sequence
Length = 731
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 162 tacagcttcggcgtggtgctgctggagct 190
>gb|CX613758.1|CX613758 GABR1_10_B11.b1_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_10_B11_A002 3', mRNA sequence
Length = 787
Score = 50.1 bits (25), Expect = 5e-004
Identities = 28/29 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||||| ||||||||
Sbjct: 243 tacagcttcggcgtggtgctgctggagct 271
>gb|CL171866.1|CL171866 104_374_10889738_116_31775_026 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10889738, DNA
sequence
Length = 612
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 720 agtgcgatgtctacagcttcggcgtggtgcttctggagct 759
||||||| || |||||||||||||||||||| |||||||
Sbjct: 296 agtgcgacgtgtacagcttcggcgtggtgctcatggagct 335
Score = 38.2 bits (19), Expect = 2.1
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 554 gacatcaagccttccaacatcctccttgacg 584
||||||||| | |||||||||||||| ||||
Sbjct: 22 gacatcaagtcctccaacatcctcctcgacg 52
>gb|CL171867.1|CL171867 104_374_10889738_148_31774_026 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10889738, DNA
sequence
Length = 727
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 720 agtgcgatgtctacagcttcggcgtggtgcttctggagct 759
||||||| || |||||||||||||||||||| |||||||
Sbjct: 493 agtgcgacgtgtacagcttcggcgtggtgctcatggagct 454
>gb|CW031904.1|CW031904 104_260_10501071_114_30365 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10501071, DNA
sequence
Length = 659
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
|||||||||||||| ||||| ||||||||| |||||
Sbjct: 425 tacagcttcggcgtcgtgctcctggagctcctcacg 460
>gb|CW059389.1|CW059389 104_302_10519289_115_30168 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10519289, DNA
sequence
Length = 573
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
|||||||||||||| ||||| ||||||||| |||||
Sbjct: 394 tacagcttcggcgtcgtgctcctggagctcctcacg 429
>gb|CW164285.1|CW164285 104_572_11151907_148_36462_076 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11151907, DNA
sequence
Length = 591
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcat 762
|||||||||||||| ||||| |||||||||||
Sbjct: 441 tacagcttcggcgtcgtgctgctggagctcat 410
>gb|CW166151.1|CW166151 104_574_11152897_116_36484_001 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11152897, DNA
sequence
Length = 679
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||||||||| || ||||| ||||| |||||
Sbjct: 47 gcgatgtctacagcttcggggtagtgctgctggaactcat 86
>gb|CW183829.1|CW183829 104_599_11164825_116_36675_001 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11164825, DNA
sequence
Length = 664
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||||||||| || ||||| ||||| |||||
Sbjct: 608 gcgatgtctacagcttcggggtagtgctgctggaactcat 569
>gb|CW208558.1|CW208558 104_638_11188735_116_36981_030 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11188735, DNA
sequence
Length = 701
Score = 48.1 bits (24), Expect = 0.002
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 720 agtgcgatgtctacagcttcggcgtggt 747
|||||||||| |||||||||||||||||
Sbjct: 485 agtgcgatgtttacagcttcggcgtggt 458
>gb|CW208559.1|CW208559 104_638_11188735_148_36982_030 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11188735, DNA
sequence
Length = 690
Score = 48.1 bits (24), Expect = 0.002
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 720 agtgcgatgtctacagcttcggcgtggt 747
|||||||||| |||||||||||||||||
Sbjct: 436 agtgcgatgtttacagcttcggcgtggt 463
>gb|CW277960.1|CW277960 104_752_11406303_148_35680_060 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11406303, DNA
sequence
Length = 434
Score = 48.1 bits (24), Expect = 0.002
Identities = 27/28 (96%)
Strand = Plus / Minus
Query: 733 cagcttcggcgtggtgcttctggagctc 760
|||||||||||||||||| |||||||||
Sbjct: 310 cagcttcggcgtggtgctcctggagctc 283
>gb|CW346528.1|CW346528 fsbb001f006b10k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f006b10, DNA
sequence
Length = 258
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 720 agtgcgatgtctacagcttcggcgtggtgcttctggagct 759
||||||| || |||||||||||||||||||| |||||||
Sbjct: 182 agtgcgacgtgtacagcttcggcgtggtgctcatggagct 221
>gb|CW387840.1|CW387840 fsbb001f072f17k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f072f17, DNA
sequence
Length = 773
Score = 48.1 bits (24), Expect = 0.002
Identities = 27/28 (96%)
Strand = Plus / Plus
Query: 720 agtgcgatgtctacagcttcggcgtggt 747
|||||||||| |||||||||||||||||
Sbjct: 92 agtgcgatgtttacagcttcggcgtggt 119
>gb|CW406146.1|CW406146 fsbb001f099a13f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f099a13, DNA
sequence
Length = 410
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
||||||| ||| |||||||| |||||||||||||||
Sbjct: 126 tacagctacggggtggtgctgctggagctcatcacg 161
>gb|CW459813.1|CW459813 fsbb001f206l22f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f206l22, DNA
sequence
Length = 694
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 720 agtgcgatgtctacagcttcggcgtggtgcttctggagct 759
||||||| || |||||||||||||||||||| |||||||
Sbjct: 557 agtgcgacgtgtacagcttcggcgtggtgctcatggagct 518
>gb|CW474821.1|CW474821 fsbb001f230o07f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f230o07, DNA
sequence
Length = 457
Score = 48.1 bits (24), Expect = 0.002
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcat 762
|||||||||||||| ||||| |||||||||||
Sbjct: 304 tacagcttcggcgtcgtgctgctggagctcat 273
>gb|CD461990.1|CD461990 SA1_36_H04.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_36_H04_A002 3', mRNA sequence
Length = 720
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||||||||| || ||||| ||||| |||||
Sbjct: 110 gcgatgtctacagcttcggggtagtgctgctggaactcat 149
>gb|CF073150.1|CF073150 FE1_28_G06.b1_A002 Iron-deficient seedlings Sorghum bicolor cDNA
clone FE1_28_G06_A002 3', mRNA sequence
Length = 698
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagctc 760
||||| |||||||||||||| || ||||||||||||
Sbjct: 129 gatgtttacagcttcggcgttgttcttctggagctc 164
>gb|CX611331.1|CX611331 ANR1_24_B11.b1_A002 Anaerobic roots Sorghum bicolor cDNA clone
ANR1_24_B11_A002 3', mRNA sequence
Length = 703
Score = 48.1 bits (24), Expect = 0.002
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagctc 760
||||| |||||||||||||| || ||||||||||||
Sbjct: 143 gatgtttacagcttcggcgttgttcttctggagctc 178
>gb|CL153924.1|CL153924 104_338_10781043_116_31370_291 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10781043, DNA
sequence
Length = 695
Score = 46.1 bits (23), Expect = 0.008
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtg 745
|||||||||||||||||||||||
Sbjct: 23 gcgatgtctacagcttcggcgtg 1
>gb|CL178917.1|CL178917 104_387_10894930_116_31906_226 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894930, DNA
sequence
Length = 769
Score = 46.1 bits (23), Expect = 0.008
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 717 tggagtgcgatgtctacagcttcggcgtggtgcttctggagct 759
|||||| ||| || ||||||| |||||||||||| ||||||||
Sbjct: 649 tggagtccgacgtatacagctacggcgtggtgctactggagct 607
>gb|CL178918.1|CL178918 104_387_10894930_148_31905_226 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894930, DNA
sequence
Length = 687
Score = 46.1 bits (23), Expect = 0.008
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 717 tggagtgcgatgtctacagcttcggcgtggtgcttctggagct 759
|||||| ||| || ||||||| |||||||||||| ||||||||
Sbjct: 456 tggagtccgacgtatacagctacggcgtggtgctactggagct 498
>gb|CW032924.1|CW032924 104_262_10501666_114_30361 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10501666, DNA
sequence
Length = 499
Score = 46.1 bits (23), Expect = 0.008
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
|||||||||||||||||||| ||||||
Sbjct: 440 tacagcttcggcgtggtgctgctggag 414
>gb|CW068017.1|CW068017 104_316_10524767_115_30145 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10524767, DNA
sequence
Length = 524
Score = 46.1 bits (23), Expect = 0.008
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatc 763
||||||||||||||||| |||| |||||||||||
Sbjct: 209 tctacagcttcggcgtgctgctgatggagctcatc 175
>gb|CW081545.1|CW081545 104_420_10942122_116_32307_077 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10942122, DNA
sequence
Length = 433
Score = 46.1 bits (23), Expect = 0.008
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
|||||||||||||||||||| ||||||
Sbjct: 53 tacagcttcggcgtggtgctgctggag 27
>gb|CW112723.1|CW112723 104_486_11105045_148_34541_019 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11105045, DNA
sequence
Length = 739
Score = 46.1 bits (23), Expect = 0.008
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtg 745
|||||||||||||||||||||||
Sbjct: 161 gcgatgtctacagcttcggcgtg 139
>gb|CW188083.1|CW188083 104_607_11172832_148_36723_052 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11172832, DNA
sequence
Length = 708
Score = 46.1 bits (23), Expect = 0.008
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 717 tggagtgcgatgtctacagcttcggcgtggtgcttctggagct 759
|||||| ||| || ||||||| |||||||||||| ||||||||
Sbjct: 622 tggagtccgacgtatacagctacggcgtggtgctactggagct 664
>gb|CW233147.1|CW233147 104_686_11213214_148_37375_029 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11213214, DNA
sequence
Length = 679
Score = 46.1 bits (23), Expect = 0.008
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 722 tgcgatgtctacagcttcggcgtggtg 748
||||| |||||||||||||||||||||
Sbjct: 614 tgcgacgtctacagcttcggcgtggtg 640
>gb|CW262007.1|CW262007 104_729_11229818_148_35206_009 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11229818, DNA
sequence
Length = 702
Score = 46.1 bits (23), Expect = 0.008
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatcac 765
|||| ||||||||||||||||| ||||| ||||| |||||||
Sbjct: 199 gcgacgtctacagcttcggcgtcgtgctcgtggagatcatcac 157
>gb|CW303145.1|CW303145 104_787_11465086_148_35673_087 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11465086, DNA
sequence
Length = 748
Score = 46.1 bits (23), Expect = 0.008
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtg 745
|||||||||||||||||||||||
Sbjct: 79 gcgatgtctacagcttcggcgtg 101
>gb|CW386358.1|CW386358 fsbb001f070d14f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f070d14, DNA
sequence
Length = 655
Score = 46.1 bits (23), Expect = 0.008
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
|||||||||||||||||||| ||||||
Sbjct: 533 tacagcttcggcgtggtgctgctggag 507
>gb|CW397254.1|CW397254 fsbb001f086b11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f086b11, DNA
sequence
Length = 708
Score = 46.1 bits (23), Expect = 0.008
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtg 745
|||||||||||||||||||||||
Sbjct: 16 gcgatgtctacagcttcggcgtg 38
>gb|CW433928.1|CW433928 fsbb001f149g02f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f149g02, DNA
sequence
Length = 579
Score = 46.1 bits (23), Expect = 0.008
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatc 763
||||||||||||||||| |||| |||||||||||
Sbjct: 370 tctacagcttcggcgtgctgctgatggagctcatc 336
>gb|CW450135.1|CW450135 fsbb001f188k02k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f188k02, DNA
sequence
Length = 717
Score = 46.1 bits (23), Expect = 0.008
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtg 745
|||||||||||||||||||||||
Sbjct: 537 gcgatgtctacagcttcggcgtg 559
>gb|CW454497.1|CW454497 fsbb001f198p13f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f198p13, DNA
sequence
Length = 513
Score = 46.1 bits (23), Expect = 0.008
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
|||||||||||||||||||| ||||||
Sbjct: 338 tacagcttcggcgtggtgctgctggag 312
>gb|CW790650.1|CW790650 SP__Ba0071C14.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0071C14 3', DNA sequence
Length = 821
Score = 46.1 bits (23), Expect = 0.008
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 560 aagccttccaacatcctccttga 582
|||||||||||||||||||||||
Sbjct: 37 aagccttccaacatcctccttga 15
>gb|CW792563.1|CW792563 SP__Ba0095F01.r SP__Ba Sorghum propinquum genomic clone
SP__Ba0095F01 3', DNA sequence
Length = 747
Score = 46.1 bits (23), Expect = 0.008
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 560 aagccttccaacatcctccttga 582
|||||||||||||||||||||||
Sbjct: 37 aagccttccaacatcctccttga 15
>gb|CN124403.1|CN124403 RHOH1_4_C02.g1_A002 Acid- and alkaline-treated roots Sorghum
bicolor cDNA clone RHOH1_4_C02_A002 5', mRNA sequence
Length = 635
Score = 46.1 bits (23), Expect = 0.008
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 560 aagccttccaacatcctccttga 582
|||||||||||||||||||||||
Sbjct: 330 aagccttccaacatcctccttga 352
>gb|CN135620.1|CN135620 OX1_38_A11.b1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_38_A11_A002 3', mRNA sequence
Length = 816
Score = 46.1 bits (23), Expect = 0.008
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatc 763
||||||||||||||||| | || ||||||||||||
Sbjct: 102 tctacagcttcggcgtgattctgctggagctcatc 136
>gb|CN135699.1|CN135699 OX1_38_A11.g1_A002 Oxidatively-stressed leaves and roots Sorghum
bicolor cDNA clone OX1_38_A11_A002 5', mRNA sequence
Length = 791
Score = 46.1 bits (23), Expect = 0.008
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatc 763
||||||||||||||||| | || ||||||||||||
Sbjct: 644 tctacagcttcggcgtgattctgctggagctcatc 678
>gb|CN146780.1|CN146780 WOUND1_43_E01.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_43_E01_A002 5', mRNA sequence
Length = 734
Score = 46.1 bits (23), Expect = 0.008
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatc 763
||||||||||||||||| | || ||||||||||||
Sbjct: 354 tctacagcttcggcgtgattctgctggagctcatc 388
>gb|CL162355.1|CL162355 104_354_10806351_114_31830_255 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10806351, DNA
sequence
Length = 601
Score = 44.1 bits (22), Expect = 0.033
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctc 760
|||| |||||||||||||| || ||||| |||||||||
Sbjct: 81 gcgacgtctacagcttcggggtagtgctcctggagctc 118
>gb|CW084773.1|CW084773 104_427_10945998_114_32508_019 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10945998, DNA
sequence
Length = 511
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 736 cttcggcgtggtgcttctggagctcatcac 765
|||||| |||||||| ||||||||||||||
Sbjct: 306 cttcggggtggtgctcctggagctcatcac 335
>gb|CW174363.1|CW174363 104_586_11157363_148_36559_008 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11157363, DNA
sequence
Length = 440
Score = 44.1 bits (22), Expect = 0.033
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| || || ||||||||||
Sbjct: 126 gtctacagcttcggcgtcgttctcctggagctca 93
>gb|CW196282.1|CW196282 104_620_11181088_116_36812_060 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11181088, DNA
sequence
Length = 668
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 736 cttcggcgtggtgcttctggagctcatcac 765
|||||| |||||||| ||||||||||||||
Sbjct: 280 cttcggggtggtgctcctggagctcatcac 251
>gb|CW212892.1|CW212892 104_644_11191263_116_37026_060 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11191263, DNA
sequence
Length = 684
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 736 cttcggcgtggtgcttctggagctcatcac 765
|||||| |||||||| ||||||||||||||
Sbjct: 42 cttcggggtggtgctcctggagctcatcac 71
>gb|CW216985.1|CW216985 104_650_11195414_148_37135_063 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11195414, DNA
sequence
Length = 706
Score = 44.1 bits (22), Expect = 0.033
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| || || ||||||||||
Sbjct: 117 gtctacagcttcggcgtcgttctcctggagctca 150
>gb|CW243463.1|CW243463 104_704_11220059_148_37578_048 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11220059, DNA
sequence
Length = 673
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 736 cttcggcgtggtgcttctggagctcatcac 765
|||||| |||||||| ||||||||||||||
Sbjct: 186 cttcggggtggtgctcctggagctcatcac 215
>gb|CW261533.1|CW261533 104_728_11229564_116_35175_036 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11229564, DNA
sequence
Length = 496
Score = 44.1 bits (22), Expect = 0.033
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctgga 756
||||||||||||||| ||||||||||
Sbjct: 26 tacagcttcggcgtgatgcttctgga 1
>gb|CW261761.1|CW261761 104_729_11229688_148_35206_064 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11229688, DNA
sequence
Length = 716
Score = 44.1 bits (22), Expect = 0.033
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctc 760
|||| |||||||||||||| || ||||| |||||||||
Sbjct: 395 gcgacgtctacagcttcggggtagtgctcctggagctc 358
>gb|CW277847.1|CW277847 104_752_11406242_148_35418_013 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11406242, DNA
sequence
Length = 526
Score = 44.1 bits (22), Expect = 0.033
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctc 760
|||| |||||||||||||| || ||||| |||||||||
Sbjct: 231 gcgacgtctacagcttcggggtagtgctcctggagctc 268
>gb|CW309573.1|CW309573 104_798_11469264_148_35742_090 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11469264, DNA
sequence
Length = 662
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggag 757
||||||||||||||||||||| | ||||||
Sbjct: 244 gtctacagcttcggcgtggtggtgctggag 215
>gb|CW357266.1|CW357266 fsbb001f023n06k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f023n06, DNA
sequence
Length = 659
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggag 757
||||||||||||||||| ||||| ||||||
Sbjct: 5 gtctacagcttcggcgttgtgctgctggag 34
>gb|CW358834.1|CW358834 fsbb001f026d07f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f026d07, DNA
sequence
Length = 552
Score = 44.1 bits (22), Expect = 0.033
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| || || ||||||||||
Sbjct: 509 gtctacagcttcggcgtcgttctcctggagctca 542
>gb|CW383124.1|CW383124 fsbb001f065h13f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f065h13, DNA
sequence
Length = 315
Score = 44.1 bits (22), Expect = 0.033
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 737 ttcggcgtggtgcttctggagctcat 762
|||||||||||||| |||||||||||
Sbjct: 1 ttcggcgtggtgctcctggagctcat 26
>gb|CW384884.1|CW384884 fsbb001f068b21f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f068b21, DNA
sequence
Length = 641
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggag 757
||||||||||||||||||||| | ||||||
Sbjct: 224 gtctacagcttcggcgtggtggtgctggag 195
>gb|CW410104.1|CW410104 fsbb001f104l07f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f104l07, DNA
sequence
Length = 677
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 736 cttcggcgtggtgcttctggagctcatcac 765
|||||| |||||||| ||||||||||||||
Sbjct: 213 cttcggggtggtgctcctggagctcatcac 242
>gb|CW425305.1|CW425305 fsbb001f136c04k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f136c04, DNA
sequence
Length = 601
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggag 757
||||||||||||||||||||| | ||||||
Sbjct: 106 gtctacagcttcggcgtggtggtgctggag 77
>gb|CW456245.1|CW456245 fsbb001f201i03k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f201i03, DNA
sequence
Length = 660
Score = 44.1 bits (22), Expect = 0.033
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctca 761
||||||||||||||||| || || ||||||||||
Sbjct: 238 gtctacagcttcggcgtcgttctcctggagctca 205
>gb|CW500396.1|CW500396 fsbb001f295l08k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f295l08, DNA
sequence
Length = 602
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggag 757
||||||||||||||||| ||||| ||||||
Sbjct: 534 gtctacagcttcggcgttgtgctgctggag 505
>gb|CW501341.1|CW501341 fsbb001f297b17k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f297b17, DNA
sequence
Length = 549
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 736 cttcggcgtggtgcttctggagctcatcac 765
|||||| |||||||| ||||||||||||||
Sbjct: 192 cttcggggtggtgctcctggagctcatcac 221
>gb|CW501343.1|CW501343 fsbb001f297b18k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f297b18, DNA
sequence
Length = 655
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 736 cttcggcgtggtgcttctggagctcatcac 765
|||||| |||||||| ||||||||||||||
Sbjct: 202 cttcggggtggtgctcctggagctcatcac 231
>gb|BE362047.1|BE362047 DG1_83_A06.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 588
Score = 44.1 bits (22), Expect = 0.033
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggag 757
||||||||||||||||||||| | ||||||
Sbjct: 175 gtctacagcttcggcgtggtggtgctggag 204
>gb|CL148241.1|CL148241 104_328_10592954_148_31782_078 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10592954, DNA
sequence
Length = 701
Score = 42.1 bits (21), Expect = 0.13
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagctcatcac 765
||||||||||| || || |||||||| ||||||||| ||||
Sbjct: 75 gatgtctacagttttggtgtggtgctgctggagctcgtcac 35
>gb|CL168136.1|CL168136 104_365_10810586_114_31804_266 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10810586, DNA
sequence
Length = 778
Score = 42.1 bits (21), Expect = 0.13
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatc 763
|||| |||||||| ||||| |||||||| |||||||||||
Sbjct: 25 gcgacgtctacagtttcggggtggtgctggtggagctcatc 65
>gb|CL171423.1|CL171423 104_373_10889416_148_31776_088 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10889416, DNA
sequence
Length = 604
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcatc 763
|||||||||||||| ||||| |||||||||||
Sbjct: 222 tacagcttcggcgtcgtgctcgtggagctcatc 190
>gb|CL178303.1|CL178303 104_386_10894485_116_31912_165 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894485, DNA
sequence
Length = 720
Score = 42.1 bits (21), Expect = 0.13
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||| | ||||||||
Sbjct: 442 tacagcttcggcgtggtgatgctggagct 414
>gb|CW026861.1|CW026861 104_253_10498187_114_30532 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10498187, DNA
sequence
Length = 454
Score = 42.1 bits (21), Expect = 0.13
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||| ||||| ||||||||
Sbjct: 320 tacagcttcggcgtcgtgctcctggagct 292
>gb|CW040454.1|CW040454 104_273_10506161_114_30265 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10506161, DNA
sequence
Length = 599
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatc 763
|||||||||||||| ||||| |||||||||||
Sbjct: 475 tacagcttcggcgtcgtgctggtggagctcatc 507
>gb|CW043738.1|CW043738 104_279_10508552_114_30276 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10508552, DNA
sequence
Length = 486
Score = 42.1 bits (21), Expect = 0.13
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
||||||||||| |||||||| ||||||||
Sbjct: 467 tacagcttcggggtggtgctgctggagct 439
>gb|CW063749.1|CW063749 104_309_10522182_115_30140 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10522182, DNA
sequence
Length = 442
Score = 42.1 bits (21), Expect = 0.13
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
||||||||||| |||||||| ||||||||
Sbjct: 112 tacagcttcggggtggtgctgctggagct 84
>gb|CW076696.1|CW076696 104_373_10889416_116_31777_088 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10889416, DNA
sequence
Length = 738
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatc 763
|||||||||||||| ||||| |||||||||||
Sbjct: 691 tacagcttcggcgtcgtgctcgtggagctcatc 723
>gb|CW107324.1|CW107324 104_477_11096522_116_34477_007 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11096522, DNA
sequence
Length = 620
Score = 42.1 bits (21), Expect = 0.13
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatc 763
|||| |||||||| ||||| |||||||| |||||||||||
Sbjct: 533 gcgacgtctacagtttcggggtggtgctggtggagctcatc 493
>gb|CW107325.1|CW107325 104_477_11096522_148_34473_007 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11096522, DNA
sequence
Length = 669
Score = 42.1 bits (21), Expect = 0.13
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcatc 763
|||| |||||||| ||||| |||||||| |||||||||||
Sbjct: 622 gcgacgtctacagtttcggggtggtgctggtggagctcatc 662
>gb|CW177387.1|CW177387 104_590_11158997_116_36590_019 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11158997, DNA
sequence
Length = 548
Score = 42.1 bits (21), Expect = 0.13
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||| ||||| ||||||||
Sbjct: 333 tacagcttcggcgtcgtgctcctggagct 305
>gb|CW187259.1|CW187259 104_605_11166997_148_36718_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11166997, DNA
sequence
Length = 614
Score = 42.1 bits (21), Expect = 0.13
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagctcatcac 765
||||||||||| || || |||||||| ||||||||| ||||
Sbjct: 406 gatgtctacagttttggtgtggtgctgctggagctcgtcac 446
>gb|CW217295.1|CW217295 104_650_11195581_116_37129_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11195581, DNA
sequence
Length = 596
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcatc 763
|||||||||||||| ||||| |||||||||||
Sbjct: 520 tacagcttcggcgtcgtgctggtggagctcatc 488
>gb|CW217296.1|CW217296 104_650_11195581_148_37130_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11195581, DNA
sequence
Length = 656
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatc 763
|||||||||||||| ||||| |||||||||||
Sbjct: 379 tacagcttcggcgtcgtgctggtggagctcatc 411
>gb|CW269736.1|CW269736 104_740_11401968_148_35317_082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11401968, DNA
sequence
Length = 662
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagct 759
|||| ||||||||||||||||| ||||| || |||||
Sbjct: 530 gcgacgtctacagcttcggcgtcgtgctgctcgagct 494
>gb|CW269737.1|CW269737 104_740_11401968_148_36232_082 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11401968, DNA
sequence
Length = 662
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagct 759
|||| ||||||||||||||||| ||||| || |||||
Sbjct: 530 gcgacgtctacagcttcggcgtcgtgctgctcgagct 494
>gb|CW273184.1|CW273184 104_745_11403761_148_35358_069 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11403761, DNA
sequence
Length = 701
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcatcac 765
||||||||||||||||| || |||| ||| |||||||
Sbjct: 382 tctacagcttcggcgtgctggttctcgagatcatcac 418
>gb|CW291056.1|CW291056 104_770_11413348_116_35566_006 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11413348, DNA
sequence
Length = 361
Score = 42.1 bits (21), Expect = 0.13
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
||||||||||||| |||||| ||||||||
Sbjct: 314 tacagcttcggcgcggtgctgctggagct 342
>gb|CW299893.1|CW299893 104_783_11463359_116_36249_096 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11463359, DNA
sequence
Length = 565
Score = 42.1 bits (21), Expect = 0.13
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 735 gcttcggcgtggtgcttctggagct 759
|||||||||||||||| ||||||||
Sbjct: 290 gcttcggcgtggtgctgctggagct 266
>gb|CW301911.1|CW301911 104_785_11464447_148_36266_018 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11464447, DNA
sequence
Length = 611
Score = 42.1 bits (21), Expect = 0.13
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
||||||||||| |||||||| ||||||||
Sbjct: 192 tacagcttcggggtggtgctgctggagct 164
>gb|CW303765.1|CW303765 104_788_11465414_148_35698_057 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11465414, DNA
sequence
Length = 645
Score = 42.1 bits (21), Expect = 0.13
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 735 gcttcggcgtggtgcttctggagct 759
|||||||||||||||| ||||||||
Sbjct: 577 gcttcggcgtggtgctgctggagct 601
>gb|CW309446.1|CW309446 104_798_11469200_116_35734_028 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11469200, DNA
sequence
Length = 710
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagct 759
|||| ||||||||||||||||| ||||| || |||||
Sbjct: 345 gcgacgtctacagcttcggcgtcgtgctgctcgagct 309
>gb|CW309447.1|CW309447 104_798_11469200_148_35742_028 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11469200, DNA
sequence
Length = 642
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagct 759
|||| ||||||||||||||||| ||||| || |||||
Sbjct: 596 gcgacgtctacagcttcggcgtcgtgctgctcgagct 632
>gb|CW321367.1|CW321367 104_814_11475512_148_35937_020 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11475512, DNA
sequence
Length = 722
Score = 42.1 bits (21), Expect = 0.13
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 735 gcttcggcgtggtgcttctggagct 759
|||||||||||||||| ||||||||
Sbjct: 183 gcttcggcgtggtgctgctggagct 207
>gb|CW324354.1|CW324354 104_818_11477117_116_35904_017 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11477117, DNA
sequence
Length = 621
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcatc 763
|||||||||||||| ||||| |||||||||||
Sbjct: 324 tacagcttcggcgtcgtgctggtggagctcatc 292
>gb|CW399997.1|CW399997 fsbb001f090b14f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f090b14, DNA
sequence
Length = 490
Score = 42.1 bits (21), Expect = 0.13
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
||||||| |||||||||||| ||||||||
Sbjct: 197 tacagctacggcgtggtgctactggagct 225
>gb|CW409709.1|CW409709 fsbb001f104c04k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f104c04, DNA
sequence
Length = 569
Score = 42.1 bits (21), Expect = 0.13
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagctcatcac 765
||||||||||| || || |||||||| ||||||||| ||||
Sbjct: 245 gatgtctacagttttggtgtggtgctgctggagctcgtcac 205
>gb|CW428265.1|CW428265 fsbb001f140m05k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f140m05, DNA
sequence
Length = 597
Score = 42.1 bits (21), Expect = 0.13
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 735 gcttcggcgtggtgcttctggagct 759
|||||||||||||||| ||||||||
Sbjct: 425 gcttcggcgtggtgctgctggagct 401
>gb|CW431016.1|CW431016 fsbb001f145a05k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f145a05, DNA
sequence
Length = 522
Score = 42.1 bits (21), Expect = 0.13
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagct 759
|||||||||||||||||| | ||||||||
Sbjct: 201 tacagcttcggcgtggtgatgctggagct 173
>gb|AW745956.1|AW745956 WS1_38_B07.g1_A002 Water-stressed 1 (WS1) Sorghum bicolor cDNA,
mRNA sequence
Length = 627
Score = 42.1 bits (21), Expect = 0.13
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatc 763
|||||||||||||| ||||| |||||||||||
Sbjct: 86 tacagcttcggcgtcgtgctcgtggagctcatc 118
>gb|BE597509.1|BE597509 PI1_70_D09.b1_A002 Pathogen induced 1 (PI1) Sorghum bicolor cDNA,
mRNA sequence
Length = 548
Score = 42.1 bits (21), Expect = 0.13
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagctcatcac 765
||||||||||| || || |||||||| ||||||||| ||||
Sbjct: 262 gatgtctacagttttggtgtggtgctgctggagctcgtcac 302
>gb|BE918309.1|BE918309 OV1_1_G12.g1_A002 Ovary 1 (OV1) Sorghum bicolor cDNA, mRNA sequence
Length = 578
Score = 42.1 bits (21), Expect = 0.13
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 735 gcttcggcgtggtgcttctggagct 759
|||||||||||||||| ||||||||
Sbjct: 105 gcttcggcgtggtgctgctggagct 129
>gb|BG051190.1|BG051190 FM1_57_D07.b1_A003 Floral-Induced Meristem 1 (FM1) Sorghum
propinquum cDNA, mRNA sequence
Length = 489
Score = 42.1 bits (21), Expect = 0.13
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagct 759
|||||||||||||||| || || |||||||| |||||
Sbjct: 272 gcgatgtctacagctttggtgtcgtgcttcttgagct 308
>gb|CD426959.1|CD426959 SA1_26_C02.b1_A002 Salicylic acid-treated seedlings Sorghum bicolor
cDNA clone SA1_26_C02_A002 3', mRNA sequence
Length = 605
Score = 42.1 bits (21), Expect = 0.13
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctgg 755
|||||||||||||||||||| ||||
Sbjct: 29 tacagcttcggcgtggtgctgctgg 53
>gb|BZ628384.1|BZ628384 ih59h03.b1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ih59h03 5', DNA sequence
Length = 602
Score = 40.1 bits (20), Expect = 0.52
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 728 gtctacagcttcggcgtggtgcttctggagctcatc 763
|||||||||||||| |||||||| || ||||||||
Sbjct: 539 gtctacagcttcggggtggtgctggtgcagctcatc 574
>gb|BZ628385.1|BZ628385 ih59h03.g1 WGS-SbicolorF (DH5a methyl filtered) Sorghum bicolor
genomic clone ih59h03 5', DNA sequence
Length = 537
Score = 40.1 bits (20), Expect = 0.52
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 728 gtctacagcttcggcgtggtgcttctggagctcatc 763
|||||||||||||| |||||||| || ||||||||
Sbjct: 238 gtctacagcttcggggtggtgctggtgcagctcatc 203
>gb|CL178163.1|CL178163 104_386_10894366_148_31911_046 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10894366, DNA
sequence
Length = 739
Score = 40.1 bits (20), Expect = 0.52
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||||| |||||||| |||||| |||||||
Sbjct: 209 tacagcttcggtgtggtgctgctggaggccatcacg 244
>gb|CL195599.1|CL195599 104_421_10942489_114_32310_013 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10942489, DNA
sequence
Length = 677
Score = 40.1 bits (20), Expect = 0.52
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 722 tgcgatgtctacagcttcgg 741
||||||||||||||||||||
Sbjct: 432 tgcgatgtctacagcttcgg 451
>gb|CW037365.1|CW037365 104_269_10504298_114_30383 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10504298, DNA
sequence
Length = 731
Score = 40.1 bits (20), Expect = 0.52
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
||||||| |||||||||||| |||||| || |||||
Sbjct: 341 tacagctacggcgtggtgctgctggagatcgtcacg 376
>gb|CW072603.1|CW072603 104_325_10592362_114_30536 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10592362, DNA
sequence
Length = 603
Score = 40.1 bits (20), Expect = 0.52
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
||||||||||| |||||||| |||||| |||||||
Sbjct: 236 tacagcttcggtgtggtgctgctggaggccatcacg 201
>gb|CW097525.1|CW097525 104_463_11002503_148_34358_054 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11002503, DNA
sequence
Length = 627
Score = 40.1 bits (20), Expect = 0.52
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctgga 756
|||||||||||||| || |||||||| |||||
Sbjct: 415 gatgtctacagctttggagtggtgctactgga 446
>gb|CW109709.1|CW109709 104_482_11103275_148_34513_046 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11103275, DNA
sequence
Length = 641
Score = 40.1 bits (20), Expect = 0.52
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 546 tccatggagacatcaagccttccaacat 573
||||||| |||||||||||||| |||||
Sbjct: 512 tccatggtgacatcaagccttctaacat 539
>gb|CW125720.1|CW125720 104_506_11112492_116_34721_046 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11112492, DNA
sequence
Length = 605
Score = 40.1 bits (20), Expect = 0.52
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcggcgtggtgct 750
|||| |||||||||||||||||| ||||
Sbjct: 410 gcgacgtctacagcttcggcgtgctgct 383
>gb|CW184253.1|CW184253 104_600_11165054_148_36683_055 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11165054, DNA
sequence
Length = 649
Score = 40.1 bits (20), Expect = 0.52
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctgga 756
|||||||||||||| || |||||||| |||||
Sbjct: 397 gatgtctacagctttggagtggtgctactgga 428
>gb|CW194074.1|CW194074 104_617_11179908_116_36788_046 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11179908, DNA
sequence
Length = 727
Score = 40.1 bits (20), Expect = 0.52
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 722 tgcgatgtctacagcttcgg 741
||||||||||||||||||||
Sbjct: 67 tgcgatgtctacagcttcgg 48
>gb|CW256501.1|CW256501 104_721_11226825_148_35142_037 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226825, DNA
sequence
Length = 561
Score = 40.1 bits (20), Expect = 0.52
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcat 762
|||||||| || |||||||| |||||||||||
Sbjct: 321 tacagctttggggtggtgctgctggagctcat 352
>gb|CW321545.1|CW321545 104_815_11475611_148_35940_048 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11475611, DNA
sequence
Length = 666
Score = 40.1 bits (20), Expect = 0.52
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctgga 756
|||||||||||||| || |||||||| |||||
Sbjct: 231 gatgtctacagctttggagtggtgctactgga 200
>gb|CW380964.1|CW380964 fsbb001f062b11k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f062b11, DNA
sequence
Length = 709
Score = 40.1 bits (20), Expect = 0.52
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 546 tccatggagacatcaagccttccaacat 573
||||||| |||||||||||||| |||||
Sbjct: 147 tccatggtgacatcaagccttctaacat 120
>gb|CW448789.1|CW448789 fsbb001f182j09k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f182j09, DNA
sequence
Length = 440
Score = 40.1 bits (20), Expect = 0.52
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
|||||||||||||| |||| ||||||||| |||||
Sbjct: 440 tacagcttcggcgtcctgctcctggagctcctcacg 405
>gb|CW464177.1|CW464177 fsbb001f213e18f0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f213e18, DNA
sequence
Length = 659
Score = 40.1 bits (20), Expect = 0.52
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 546 tccatggagacatcaagccttccaacat 573
||||||| |||||||||||||| |||||
Sbjct: 47 tccatggtgacatcaagccttctaacat 74
>gb|CW485776.1|CW485776 fsbb001f248k23k0 Sorghum methylation filtered library (LibID: 104)
Sorghum bicolor genomic clone fsbb001f248k23, DNA
sequence
Length = 505
Score = 40.1 bits (20), Expect = 0.52
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctgga 756
|||||||||||||| || |||||||| |||||
Sbjct: 363 gatgtctacagctttggagtggtgctactgga 332
>gb|BE356408.1|BE356408 DG1_125_A04.b1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 503
Score = 40.1 bits (20), Expect = 0.52
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgct 750
|||| ||||||||||||||||| |||||
Sbjct: 475 gcgacgtctacagcttcggcgtcgtgct 502
>gb|BE360293.1|BE360293 DG1_62_G03.g1_A002 Dark Grown 1 (DG1) Sorghum bicolor cDNA, mRNA
sequence
Length = 617
Score = 40.1 bits (20), Expect = 0.52
Identities = 35/40 (87%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctcat 762
|||| ||||| ||||||||||| ||||| || ||||||||
Sbjct: 39 gcgacgtctatagcttcggcgtcgtgctgctagagctcat 78
>gb|CD221220.1|CD221220 CCC1_74_H07.b1_A007 Callus culture/cell suspension Sorghum bicolor
cDNA clone CCC1_74_H07_A007 3', mRNA sequence
Length = 526
Score = 40.1 bits (20), Expect = 0.52
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggagctcatcacg 766
|||||||||||||| |||| ||||||||| |||||
Sbjct: 50 tacagcttcggcgtcctgctcctggagctcctcacg 85
>gb|CN142994.1|CN142994 WOUND1_13_B11.g1_A002 Wounded leaves Sorghum bicolor cDNA clone
WOUND1_13_B11_A002 5', mRNA sequence
Length = 748
Score = 40.1 bits (20), Expect = 0.52
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 564 cttccaacatcctccttgac 583
||||||||||||||||||||
Sbjct: 696 cttccaacatcctccttgac 715
>gb|CX622337.1|CX622337 GABR1_63_H09.b2_A002 GA- or brassinolide-treated seedlings Sorghum
bicolor cDNA clone GABR1_63_H09_A002 3', mRNA sequence
Length = 707
Score = 40.1 bits (20), Expect = 0.52
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgt 744
||||||||||||||||||||
Sbjct: 52 gatgtctacagcttcggcgt 71
>gb|BZ343887.1|BZ343887 hp57f04.b1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone hp57f04 5', DNA sequence
Length = 351
Score = 38.2 bits (19), Expect = 2.1
Identities = 28/31 (90%)
Strand = Plus / Minus
Query: 554 gacatcaagccttccaacatcctccttgacg 584
||||||||||| ||||||||||||| ||||
Sbjct: 155 gacatcaagccggccaacatcctcctcgacg 125
>gb|BZ343888.1|BZ343888 hp57f04.b2 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone hp57f04 5', DNA sequence
Length = 343
Score = 38.2 bits (19), Expect = 2.1
Identities = 28/31 (90%)
Strand = Plus / Minus
Query: 554 gacatcaagccttccaacatcctccttgacg 584
||||||||||| ||||||||||||| ||||
Sbjct: 175 gacatcaagccggccaacatcctcctcgacg 145
>gb|BZ351532.1|BZ351532 hw02e09.g1 WGS-SbicolorF (JM107 adapted methyl filtered) Sorghum
bicolor genomic clone hw02e09 5', DNA sequence
Length = 549
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 498 gcgatgtctacagcttcgg 480
>gb|CL148058.1|CL148058 104_327_10592826_116_31781_334 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10592826, DNA
sequence
Length = 595
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggag 757
|||||||||||||||||| | ||||||
Sbjct: 163 tacagcttcggcgtggtggtgctggag 189
>gb|CL151895.1|CL151895 104_334_10779565_116_31362_349 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10779565, DNA
sequence
Length = 436
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 720 agtgcgatgtctacagcttcggc 742
||||||| |||||||||||||||
Sbjct: 80 agtgcgacgtctacagcttcggc 102
>gb|CL162433.1|CL162433 104_354_10806404_114_31830_308 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10806404, DNA
sequence
Length = 615
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||||| || ||||||
Sbjct: 304 tacagcttcggcgtggtcctgctggag 330
>gb|CL162434.1|CL162434 104_354_10806404_116_31831_308 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10806404, DNA
sequence
Length = 600
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||||| || ||||||
Sbjct: 537 tacagcttcggcgtggtcctgctggag 511
>gb|CL164990.1|CL164990 104_359_10808286_114_31816_270 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10808286, DNA
sequence
Length = 767
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
|||||||||||||| ||||| ||||||
Sbjct: 753 tacagcttcggcgtcgtgctgctggag 727
>gb|CL169291.1|CL169291 104_367_10812514_148_31786_370 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10812514, DNA
sequence
Length = 626
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
|||||||||||||||||| | ||||||
Sbjct: 476 tacagcttcggcgtggtggtgctggag 450
>gb|CL173751.1|CL173751 104_377_10891091_116_31793_227 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10891091, DNA
sequence
Length = 667
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 735 gcttcggcgtggtgcttctggag 757
|||||||||||||||| ||||||
Sbjct: 455 gcttcggcgtggtgctgctggag 477
>gb|CL173752.1|CL173752 104_377_10891091_148_31792_227 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10891091, DNA
sequence
Length = 496
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 735 gcttcggcgtggtgcttctggag 757
|||||||||||||||| ||||||
Sbjct: 422 gcttcggcgtggtgctgctggag 400
>gb|CL191189.1|CL191189 104_410_10906618_114_32533_047 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10906618, DNA
sequence
Length = 597
Score = 38.2 bits (19), Expect = 2.1
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 554 gacatcaagccttccaacatcctccttgacg 584
||||||||||| ||||||||||||| ||||
Sbjct: 76 gacatcaagccggccaacatcctcctcgacg 106
>gb|CL191190.1|CL191190 104_410_10906618_116_32537_047 Sorghum methylation-filtered library
(LibID: 104) Sorghum bicolor genomic clone 10906618, DNA
sequence
Length = 720
Score = 38.2 bits (19), Expect = 2.1
Identities = 28/31 (90%)
Strand = Plus / Minus
Query: 554 gacatcaagccttccaacatcctccttgacg 584
||||||||||| ||||||||||||| ||||
Sbjct: 659 gacatcaagccggccaacatcctcctcgacg 629
>gb|CW028826.1|CW028826 104_256_10499325_114_30399 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10499325, DNA
sequence
Length = 775
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||||| || ||||||
Sbjct: 496 tacagcttcggcgtggtcctgctggag 470
>gb|CW028827.1|CW028827 104_256_10499325_116_30400 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10499325, DNA
sequence
Length = 772
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||||| || ||||||
Sbjct: 661 tacagcttcggcgtggtcctgctggag 687
>gb|CW034801.1|CW034801 104_265_10502776_114_30378 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10502776, DNA
sequence
Length = 669
Score = 38.2 bits (19), Expect = 2.1
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||||||||| ||| | || |||||||||||
Sbjct: 97 gatgtctacagctttggcatcgtccttctggagct 131
>gb|CW036528.1|CW036528 104_267_10503811_114_30374 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10503811, DNA
sequence
Length = 730
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggag 757
|||||||||||||| ||||| ||||||
Sbjct: 374 tacagcttcggcgtcgtgctgctggag 400
>gb|CW044079.1|CW044079 104_279_10508749_114_30275 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10508749, DNA
sequence
Length = 662
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||| |||| ||||||
Sbjct: 68 tacagcttcggcgtgctgctgctggag 42
>gb|CW063340.1|CW063340 104_309_10521947_114_30136 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10521947, DNA
sequence
Length = 613
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 737 ttcggcgtggtgcttctggagct 759
|||||||||||||| ||||||||
Sbjct: 423 ttcggcgtggtgctgctggagct 401
>gb|CW065242.1|CW065242 104_311_10523031_115_30121 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10523031, DNA
sequence
Length = 594
Score = 38.2 bits (19), Expect = 2.1
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 554 gacatcaagccttccaacatcctccttgacg 584
||||||||||| ||||||||||||| ||||
Sbjct: 427 gacatcaagccggccaacatcctcctcgacg 457
>gb|CW074359.1|CW074359 104_346_10803333_116_31376_309 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10803333, DNA
sequence
Length = 715
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||| |||| ||||||
Sbjct: 144 tacagcttcggcgtgctgctgctggag 118
>gb|CW080240.1|CW080240 104_408_10906067_114_32485_040 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10906067, DNA
sequence
Length = 707
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||||| || ||||||
Sbjct: 60 tacagcttcggcgtggtcctgctggag 34
>gb|CW083172.1|CW083172 104_425_10944142_114_32353_089 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10944142, DNA
sequence
Length = 618
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 737 ttcggcgtggtgcttctggagct 759
|||||||||||||| ||||||||
Sbjct: 251 ttcggcgtggtgctgctggagct 229
>gb|CW083173.1|CW083173 104_425_10944142_114_32389_089 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10944142, DNA
sequence
Length = 541
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 737 ttcggcgtggtgcttctggagct 759
|||||||||||||| ||||||||
Sbjct: 251 ttcggcgtggtgctgctggagct 229
>gb|CW083174.1|CW083174 104_425_10944142_116_32357_089 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10944142, DNA
sequence
Length = 601
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 737 ttcggcgtggtgcttctggagct 759
|||||||||||||| ||||||||
Sbjct: 548 ttcggcgtggtgctgctggagct 570
>gb|CW091585.1|CW091585 104_453_10998640_114_33029_054 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10998640, DNA
sequence
Length = 749
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 360 tgggatgctgcctagagac 378
|||||||||||||||||||
Sbjct: 667 tgggatgctgcctagagac 685
>gb|CW091586.1|CW091586 104_453_10998640_116_33033_054 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 10998640, DNA
sequence
Length = 706
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 360 tgggatgctgcctagagac 378
|||||||||||||||||||
Sbjct: 554 tgggatgctgcctagagac 536
>gb|CW112600.1|CW112600 104_486_11104977_148_34543_039 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11104977, DNA
sequence
Length = 682
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 581 gcgatgtctacagcttcgg 563
>gb|CW146077.1|CW146077 104_538_11138798_148_34981_049 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11138798, DNA
sequence
Length = 697
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 207 gcgatgtctacagcttcgg 225
>gb|CW157140.1|CW157140 104_560_11147067_148_36384_010 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11147067, DNA
sequence
Length = 721
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 735 gcttcggcgtggtgcttctggag 757
|||||||||||||||| ||||||
Sbjct: 28 gcttcggcgtggtgctgctggag 6
>gb|CW163425.1|CW163425 104_571_11151453_148_36458_095 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11151453, DNA
sequence
Length = 680
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||| |||| ||||||
Sbjct: 268 tacagcttcggcgtgctgctgctggag 294
>gb|CW165072.1|CW165072 104_573_11152312_148_36476_060 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11152312, DNA
sequence
Length = 591
Score = 38.2 bits (19), Expect = 2.1
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 554 gacatcaagccttccaacatcctccttgacg 584
||||||||||| ||||||||||||| ||||
Sbjct: 367 gacatcaagccggccaacatcctcctcgacg 397
>gb|CW165973.1|CW165973 104_574_11152796_116_36481_072 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11152796, DNA
sequence
Length = 688
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||| |||| ||||||
Sbjct: 112 tacagcttcggcgtgctgctgctggag 86
>gb|CW174796.1|CW174796 104_587_11157597_148_36839_095 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11157597, DNA
sequence
Length = 482
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||||| || ||||||
Sbjct: 319 tacagcttcggcgtggtcctgctggag 345
>gb|CW179664.1|CW179664 104_593_11160220_116_36626_002 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11160220, DNA
sequence
Length = 692
Score = 38.2 bits (19), Expect = 2.1
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 725 gatgtctacagcttcggcgtggtgcttctggagct 759
|||||||||||||| ||| | || |||||||||||
Sbjct: 361 gatgtctacagctttggcatcgtccttctggagct 327
>gb|CW210597.1|CW210597 104_641_11189876_116_37004_078 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11189876, DNA
sequence
Length = 722
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 156 agggcaccatcgtcgacgg 174
|||||||||||||||||||
Sbjct: 519 agggcaccatcgtcgacgg 501
>gb|CW210598.1|CW210598 104_641_11189876_148_37003_078 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11189876, DNA
sequence
Length = 678
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 156 agggcaccatcgtcgacgg 174
|||||||||||||||||||
Sbjct: 214 agggcaccatcgtcgacgg 232
>gb|CW227207.1|CW227207 104_665_11205292_116_37230_008 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11205292, DNA
sequence
Length = 668
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 720 agtgcgatgtctacagcttcggc 742
||||||| |||||||||||||||
Sbjct: 435 agtgcgacgtctacagcttcggc 413
>gb|CW227376.1|CW227376 104_665_11205382_148_37225_083 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11205382, DNA
sequence
Length = 686
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 64 gcgatgtctacagcttcgg 46
>gb|CW233833.1|CW233833 104_687_11213656_116_37384_060 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11213656, DNA
sequence
Length = 685
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 735 gcttcggcgtggtgcttctggag 757
|||||||||||||||| ||||||
Sbjct: 583 gcttcggcgtggtgctgctggag 605
>gb|CW233834.1|CW233834 104_687_11213656_148_37383_060 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11213656, DNA
sequence
Length = 710
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 735 gcttcggcgtggtgcttctggag 757
|||||||||||||||| ||||||
Sbjct: 151 gcttcggcgtggtgctgctggag 129
>gb|CW241237.1|CW241237 104_700_11218657_116_37547_009 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11218657, DNA
sequence
Length = 704
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 124 ccttggaggagggcacttt 142
|||||||||||||||||||
Sbjct: 83 ccttggaggagggcacttt 65
>gb|CW243462.1|CW243462 104_704_11220059_116_37577_048 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11220059, DNA
sequence
Length = 685
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 743 gtggtgcttctggagctcatcac 765
|||||||| ||||||||||||||
Sbjct: 615 gtggtgctcctggagctcatcac 593
>gb|CW248654.1|CW248654 104_710_11222416_148_35034_062 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11222416, DNA
sequence
Length = 667
Score = 38.2 bits (19), Expect = 2.1
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcgg 741
|||||||||||||||||||
Sbjct: 163 gcgatgtctacagcttcgg 181
>gb|CW251743.1|CW251743 104_714_11224101_148_35070_087 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11224101, DNA
sequence
Length = 650
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||| |||||||||||| ||||||
Sbjct: 321 tacagctacggcgtggtgctgctggag 295
>gb|CW256097.1|CW256097 104_721_11226597_148_35142_095 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11226597, DNA
sequence
Length = 600
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||||| || ||||||
Sbjct: 172 tacagcttcggcgtggtcctgctggag 198
>gb|CW277751.1|CW277751 104_752_11406193_148_35680_015 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11406193, DNA
sequence
Length = 559
Score = 38.2 bits (19), Expect = 2.1
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 720 agtgcgatgtctacagcttcggc 742
||||||| |||||||||||||||
Sbjct: 83 agtgcgacgtctacagcttcggc 105
>gb|CW314127.1|CW314127 104_804_11471657_116_35794_069 Sorghum methylation filtered library
(LibID: 104) Sorghum bicolor genomic clone 11471657, DNA
sequence
Length = 650
Score = 38.2 bits (19), Expect = 2.1
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 731 tacagcttcggcgtggtgcttctggag 757
||||||||||||||||| || ||||||
Sbjct: 368 tacagcttcggcgtggtcctgctggag 342
Database: Sorghum_nucl_with_EST.fasta
Posted date: May 2, 2006 3:37 PM
Number of letters in database: 491,359,669
Number of sequences in database: 832,831
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 363,736
Number of Sequences: 832831
Number of extensions: 363736
Number of successful extensions: 101311
Number of sequences better than 10.0: 416
Number of HSP's better than 10.0 without gapping: 416
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100714
Number of HSP's gapped (non-prelim): 595
length of query: 1348
length of database: 491,359,669
effective HSP length: 20
effective length of query: 1328
effective length of database: 474,703,049
effective search space: 630405649072
effective search space used: 630405649072
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)