BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBN10e11.xg.2.2
(581 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CX173575.1|CX173575 F02_69-47_12.ab1 leaf inoculated wit... 82 3e-014
gb|CX179995.1|CX179995 E03_45-30_09.ab1 leaf inoculated wit... 82 3e-014
gb|CN518640.1|CN518640 GQ0103.B3_B21 GQ010 Populus trichoca... 74 7e-012
gb|CV268173.1|CV268173 WS0204.B21_M02 PTxN-IB-N-A-11 Populu... 74 7e-012
gb|CF936952.1|CF936952 PO3012D09 Populus tomentiglandulosa ... 74 7e-012
gb|CX178726.1|CX178726 F03_45-1_11.ab1 leaf inoculated with... 74 7e-012
gb|CX184516.1|CX184516 A02_45-70_02.ab1 leaf inoculated wit... 74 7e-012
gb|CX185263.1|CX185263 C10_45-118_06.ab1 leaf inoculated wi... 74 7e-012
gb|CX186437.1|CX186437 E12_45-118_10.ab1 leaf inoculated wi... 74 7e-012
gb|CA927208.1|CA927208 MTU6CR.P6.C08 Aspen root cDNA Librar... 68 4e-010
gb|DT506827.1|DT506827 WS02416.BR_J23 PTxD-ICC-N-A-14 Popul... 68 4e-010
gb|DT517729.1|DT517729 WS02435.B21_C07 PTxD-ICC-N-A-14 Popu... 42 0.023
gb|DT523499.1|DT523499 WS02039.B21_N19 PTxN-IB-N-A-11 Popul... 42 0.023
gb|DT511495.1|DT511495 WS02416.B21_J23 PTxD-ICC-N-A-14 Popu... 40 0.091
>gb|CX173575.1|CX173575 F02_69-47_12.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 695
Score = 81.8 bits (41), Expect = 3e-014
Identities = 68/77 (88%)
Strand = Plus / Plus
Query: 315 ggatgtggaattgggggacctttaatagaaattgccagattcagctcaacttcaataact 374
|||||||||||||| |||||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 485 ggatgtggaattggcggacctttaagagaaattgctcgattcagctcaacatcagtaaca 544
Query: 375 ggattgaccaacaatga 391
|| |||| |||||||||
Sbjct: 545 gggttgaacaacaatga 561
>gb|CX179995.1|CX179995 E03_45-30_09.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 622
Score = 81.8 bits (41), Expect = 3e-014
Identities = 68/77 (88%)
Strand = Plus / Plus
Query: 315 ggatgtggaattgggggacctttaatagaaattgccagattcagctcaacttcaataact 374
|||||||||||||| |||||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 478 ggatgtggaattggcggacctttaagagaaattgctcgattcagctcaacatcagtaaca 537
Query: 375 ggattgaccaacaatga 391
|| |||| |||||||||
Sbjct: 538 gggttgaacaacaatga 554
>gb|CN518640.1|CN518640 GQ0103.B3_B21 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0103_B21 5', mRNA sequence
Length = 280
Score = 73.8 bits (37), Expect = 7e-012
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 315 ggatgtggaattgggggacctttaatagaaattgccagattcagctcaacttcaataact 374
|||||||||||||| || ||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 117 ggatgtggaattggcgggcctttaagagaaattgctcgattcagctcaacatcagtaaca 176
Query: 375 ggattgaccaacaatga 391
|| |||| |||||||||
Sbjct: 177 gggttgaacaacaatga 193
>gb|CV268173.1|CV268173 WS0204.B21_M02 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS0204_M02 3', mRNA sequence
Length = 911
Score = 73.8 bits (37), Expect = 7e-012
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 315 ggatgtggaattgggggacctttaatagaaattgccagattcagctcaacttcaataact 374
|||||||||||||| || ||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 715 ggatgtggaattggcgggcctttaagagaaattgctcgattcagctcaacatcagtaaca 774
Query: 375 ggattgaccaacaatga 391
|| |||| |||||||||
Sbjct: 775 gggttgaacaacaatga 791
>gb|CF936952.1|CF936952 PO3012D09 Populus tomentiglandulosa T. Lee cDNA library Populus
tomentiglandulosa cDNA, mRNA sequence
Length = 1079
Score = 73.8 bits (37), Expect = 7e-012
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 315 ggatgtggaattgggggacctttaatagaaattgccagattcagctcaacttcaataact 374
|||||||||||||| || ||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 421 ggatgtggaattggcgggcctttaagagaaattgctcgattcagctcaacatcagtaaca 480
Query: 375 ggattgaccaacaatga 391
|| |||| |||||||||
Sbjct: 481 gggttgaacaacaatga 497
>gb|CX178726.1|CX178726 F03_45-1_11.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 619
Score = 73.8 bits (37), Expect = 7e-012
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 315 ggatgtggaattgggggacctttaatagaaattgccagattcagctcaacttcaataact 374
|||||||||||||| || ||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 487 ggatgtggaattggcgggcctttaagagaaattgctcgattcagctcaacatcagtaaca 546
Query: 375 ggattgaccaacaatga 391
|| |||| |||||||||
Sbjct: 547 gggttgaacaacaatga 563
>gb|CX184516.1|CX184516 A02_45-70_02.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 746
Score = 73.8 bits (37), Expect = 7e-012
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 315 ggatgtggaattgggggacctttaatagaaattgccagattcagctcaacttcaataact 374
|||||||||||||| || ||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 506 ggatgtggaattggcgggcctttaagagaaattgctcgattcagctcaacatcagtaaca 565
Query: 375 ggattgaccaacaatga 391
|| |||| |||||||||
Sbjct: 566 gggttgaacaacaatga 582
>gb|CX185263.1|CX185263 C10_45-118_06.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 660
Score = 73.8 bits (37), Expect = 7e-012
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 315 ggatgtggaattgggggacctttaatagaaattgccagattcagctcaacttcaataact 374
|||||||||||||| || ||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 494 ggatgtggaattggcgggcctttaagagaaattgctcgattcagctcaacatcagtaaca 553
Query: 375 ggattgaccaacaatga 391
|| |||| |||||||||
Sbjct: 554 gggttgaacaacaatga 570
>gb|CX186437.1|CX186437 E12_45-118_10.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 669
Score = 73.8 bits (37), Expect = 7e-012
Identities = 67/77 (87%)
Strand = Plus / Plus
Query: 315 ggatgtggaattgggggacctttaatagaaattgccagattcagctcaacttcaataact 374
|||||||||||||| || ||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 494 ggatgtggaattggcgggcctttaagagaaattgctcgattcagctcaacatcagtaaca 553
Query: 375 ggattgaccaacaatga 391
|| |||| |||||||||
Sbjct: 554 gggttgaacaacaatga 570
>gb|CA927208.1|CA927208 MTU6CR.P6.C08 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 684
Score = 67.9 bits (34), Expect = 4e-010
Identities = 76/90 (84%)
Strand = Plus / Minus
Query: 299 gaaggttctggacgtgggatgtggaattgggggacctttaatagaaattgccagattcag 358
||||||| |||| || |||||||||||||| |||||| | | ||||||||| |||||||
Sbjct: 493 gaaggttttggatgtaggatgtggaattggtggacctcttagagaaattgcgcgattcag 434
Query: 359 ctcaacttcaataactggattgaccaacaa 388
|||||| ||| |||| || |||| ||||||
Sbjct: 433 ctcaacatcagtaacagggttgaacaacaa 404
>gb|DT506827.1|DT506827 WS02416.BR_J23 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02416_J23 5', mRNA sequence
Length = 861
Score = 67.9 bits (34), Expect = 4e-010
Identities = 76/90 (84%)
Strand = Plus / Plus
Query: 299 gaaggttctggacgtgggatgtggaattgggggacctttaatagaaattgccagattcag 358
||||||| |||| || |||||||||||||| |||||| | | ||||||||| |||||||
Sbjct: 533 gaaggttttggatgtaggatgtggaattggtggacctcttagagaaattgcgcgattcag 592
Query: 359 ctcaacttcaataactggattgaccaacaa 388
|||||| ||| |||| || |||| ||||||
Sbjct: 593 ctcaacatcagtaacagggttgaacaacaa 622
>gb|DT517729.1|DT517729 WS02435.B21_C07 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02435_C07 3', mRNA sequence
Length = 919
Score = 42.1 bits (21), Expect = 0.023
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 333 cctttaatagaaattgccagattcagctcaacttcaataac 373
||||||| ||||||||| ||||||||||||| ||| ||||
Sbjct: 917 cctttaagagaaattgctcgattcagctcaacatcagtaac 877
>gb|DT523499.1|DT523499 WS02039.B21_N19 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02039_N19 3', mRNA sequence
Length = 973
Score = 42.1 bits (21), Expect = 0.023
Identities = 49/57 (85%), Gaps = 1/57 (1%)
Strand = Plus / Minus
Query: 335 tttaatagaaattgccagattcagctcaacttcaataactggattgaccaacaatga 391
||||| ||||||||| ||||||||||||| ||| |||| || |||| |||||||||
Sbjct: 968 tttaagagaaattgctcgattcagctcaacatcagtaacagg-ttgaacaacaatga 913
>gb|DT511495.1|DT511495 WS02416.B21_J23 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02416_J23 3', mRNA sequence
Length = 910
Score = 40.1 bits (20), Expect = 0.091
Identities = 41/48 (85%)
Strand = Plus / Minus
Query: 341 agaaattgccagattcagctcaacttcaataactggattgaccaacaa 388
||||||||| ||||||||||||| ||| |||| || |||| ||||||
Sbjct: 907 agaaattgcgcgattcagctcaacatcagtaacagggttgaacaacaa 860
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 53,563
Number of Sequences: 369679
Number of extensions: 53563
Number of successful extensions: 13203
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 13182
Number of HSP's gapped (non-prelim): 21
length of query: 581
length of database: 203,408,664
effective HSP length: 19
effective length of query: 562
effective length of database: 196,384,763
effective search space: 110368236806
effective search space used: 110368236806
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)