BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAN11a10.yg.3.1
(1341 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CV253543.1|CV253543 WS0222.B21_E07 PTxD-ICC-A-12 Populus... 52 6e-005
gb|CV256735.1|CV256735 WS0244.B21_K16 PTxD-ICC-N-A-14 Popul... 52 6e-005
gb|CX658862.1|CX658862 PO01023C06 Poplar SC cDNA library Po... 52 6e-005
gb|DT493146.1|DT493146 WS02553.C21_I15 PT-MB-N-A-15 Populus... 52 6e-005
gb|BU869112.1|BU869112 M126B11 Populus flower cDNA library ... 50 2e-004
gb|BU884229.1|BU884229 R007H01 Populus root cDNA library Po... 50 2e-004
gb|CA927613.1|CA927613 MTU6TR.P11.A06 Aspen root cDNA Libra... 50 2e-004
gb|CA927736.1|CA927736 MTU6TR.P12.D05 Aspen root cDNA Libra... 50 2e-004
gb|CA928048.1|CA928048 MTU6TR.P16.B09 Aspen root cDNA Libra... 50 2e-004
gb|CA928237.1|CA928237 MTU6TR.P18.C08 Aspen root cDNA Libra... 50 2e-004
gb|CA928263.1|CA928263 MTU6TR.P18.E12 Aspen root cDNA Libra... 50 2e-004
gb|CA928328.1|CA928328 MTU6TR.P1.C12 Aspen root cDNA Librar... 50 2e-004
gb|CA928331.1|CA928331 MTU6TR.P1.D03 Aspen root cDNA Librar... 50 2e-004
gb|CA928553.1|CA928553 MTU6TR.P4.A05 Aspen root cDNA Librar... 50 2e-004
gb|CA928681.1|CA928681 MTU6TR.P5.E11 Aspen root cDNA Librar... 50 2e-004
gb|CA928789.1|CA928789 MTU6TR.P6.H02 Aspen root cDNA Librar... 50 2e-004
gb|CK096495.1|CK096495 UB16CPE05.3pR Populus active cambium... 50 2e-004
gb|CK113278.1|CK113278 UR105TC07 Populus root cDNA library ... 50 2e-004
gb|CN520303.1|CN520303 GQ0106.B3_M06 GQ010 Populus trichoca... 50 2e-004
gb|AJ776703.1|AJ776703 AJ776703 Populus euphratica root 3-6... 50 2e-004
gb|BP925479.1|BP925479 BP925479 full-length enriched poplar... 50 2e-004
gb|DN494775.1|DN494775 M126B11.5pR Populus female catkins c... 50 2e-004
gb|DV463152.1|DV463152 MTUNUL1.P12.D06 NUL Populus fremonti... 50 2e-004
gb|DV463553.1|DV463553 MTUNUL1.P17.D09 NUL Populus fremonti... 50 2e-004
gb|DV463929.1|DV463929 MTUNUL1.P21.B06 NUL Populus fremonti... 50 2e-004
gb|DV466360.1|DV466360 MTUNUL1.P5.F04 NUL Populus fremontii... 50 2e-004
gb|BU872596.1|BU872596 Q044G05 Populus flower cDNA library ... 44 0.014
gb|CV242034.1|CV242034 WS02513.B21_P03 PT-MB-N-A-15 Populus... 44 0.014
>gb|CV253543.1|CV253543 WS0222.B21_E07 PTxD-ICC-A-12 Populus trichocarpa x Populus
deltoides cDNA clone WS0222_E07 3', mRNA sequence
Length = 711
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 587 cctggcgggtggaacgatcctgacatgcttgaggtggg 624
||||| || ||||| |||||||||||||||||||||||
Sbjct: 659 cctggtggttggaatgatcctgacatgcttgaggtggg 622
>gb|CV256735.1|CV256735 WS0244.B21_K16 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0244_K16 3', mRNA sequence
Length = 934
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 587 cctggcgggtggaacgatcctgacatgcttgaggtggg 624
||||| || ||||| |||||||||||||||||||||||
Sbjct: 665 cctggtggttggaatgatcctgacatgcttgaggtggg 628
>gb|CX658862.1|CX658862 PO01023C06 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01023C06 5', mRNA sequence
Length = 652
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 587 cctggcgggtggaacgatcctgacatgcttgaggtggg 624
||||| || ||||| |||||||||||||||||||||||
Sbjct: 386 cctggtggttggaatgatcctgacatgcttgaggtggg 423
>gb|DT493146.1|DT493146 WS02553.C21_I15 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02553_I15 3', mRNA sequence
Length = 776
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 587 cctggcgggtggaacgatcctgacatgcttgaggtggg 624
||||| || ||||| |||||||||||||||||||||||
Sbjct: 660 cctggtggttggaatgatcctgacatgcttgaggtggg 623
>gb|BU869112.1|BU869112 M126B11 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 688
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 363 gtatgtcaacatagatgattgctgg 387
>gb|BU884229.1|BU884229 R007H01 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 583
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 437 gtatgtcaacatagatgattgctgg 461
>gb|CA927613.1|CA927613 MTU6TR.P11.A06 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 642
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 401 gtatgtcaacatagatgattgctgg 377
>gb|CA927736.1|CA927736 MTU6TR.P12.D05 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 656
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 400 gtatgtcaacatagatgattgctgg 376
>gb|CA928048.1|CA928048 MTU6TR.P16.B09 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 630
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 401 gtatgtcaacatagatgattgctgg 377
>gb|CA928237.1|CA928237 MTU6TR.P18.C08 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 648
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 401 gtatgtcaacatagatgattgctgg 377
>gb|CA928263.1|CA928263 MTU6TR.P18.E12 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 654
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 401 gtatgtcaacatagatgattgctgg 377
>gb|CA928328.1|CA928328 MTU6TR.P1.C12 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 658
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 258 gtatgtcaacatagatgattgctgg 282
>gb|CA928331.1|CA928331 MTU6TR.P1.D03 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 657
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 258 gtatgtcaacatagatgattgctgg 282
>gb|CA928553.1|CA928553 MTU6TR.P4.A05 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 587
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 258 gtatgtcaacatagatgattgctgg 282
>gb|CA928681.1|CA928681 MTU6TR.P5.E11 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 657
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 401 gtatgtcaacatagatgattgctgg 377
>gb|CA928789.1|CA928789 MTU6TR.P6.H02 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 656
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 257 gtatgtcaacatagatgattgctgg 281
>gb|CK096495.1|CK096495 UB16CPE05.3pR Populus active cambium cDNA library Populus tremula
cDNA clone UB16CPE05 3', mRNA sequence
Length = 642
Score = 50.1 bits (25), Expect = 2e-004
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 596 tggaacgatcctgacatgcttgaggtggg 624
||||| |||||||||||||||||||||||
Sbjct: 444 tggaatgatcctgacatgcttgaggtggg 416
>gb|CK113278.1|CK113278 UR105TC07 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA clone UR105TC07 5', mRNA sequence
Length = 551
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 470 gtatgtcaacatagatgattgctgg 494
>gb|CN520303.1|CN520303 GQ0106.B3_M06 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0106_M06 5', mRNA sequence
Length = 751
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 521 gtatgtcaacatagatgattgctgg 545
>gb|AJ776703.1|AJ776703 AJ776703 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400017D03F1, mRNA sequence
Length = 450
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 68 gtatgtcaacatagatgattgctgg 92
>gb|BP925479.1|BP925479 BP925479 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-047_A04.f 5', mRNA sequence
Length = 501
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 454 gtatgtcaacatagatgattgctgg 478
>gb|DN494775.1|DN494775 M126B11.5pR Populus female catkins cDNA library Populus trichocarpa
cDNA clone M126B11 5', mRNA sequence
Length = 667
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 384 gtatgtcaacatagatgattgctgg 408
>gb|DV463152.1|DV463152 MTUNUL1.P12.D06 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 593
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 551 gtatgtcaacatagatgattgctgg 575
>gb|DV463553.1|DV463553 MTUNUL1.P17.D09 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 934
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 452 gtatgtcaacatagatgattgctgg 476
>gb|DV463929.1|DV463929 MTUNUL1.P21.B06 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 784
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 477 gtatgtcaacatagatgattgctgg 501
>gb|DV466360.1|DV466360 MTUNUL1.P5.F04 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 731
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 100 gtatgtcaacatagatgattgctgg 124
|||||||||||||||||||||||||
Sbjct: 105 gtatgtcaacatagatgattgctgg 129
>gb|BU872596.1|BU872596 Q044G05 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 766
Score = 44.1 bits (22), Expect = 0.014
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 587 cctggcgggtggaacgatcctgacatgcttgaggtggg 624
||||| || ||||| ||||||||| |||||||||||||
Sbjct: 133 cctggtggttggaatgatcctgacgtgcttgaggtggg 170
>gb|CV242034.1|CV242034 WS02513.B21_P03 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02513_P03 3', mRNA sequence
Length = 781
Score = 44.1 bits (22), Expect = 0.014
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 581 gccggacctggcgggtggaacgatcctgacatgcttgaggtgggcaacgg 630
|||||||||||| | ||||| |||||||||||| | || || ||||||||
Sbjct: 742 gccggacctggcagatggaatgatcctgacatgttagaagtaggcaacgg 693
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 118,878
Number of Sequences: 369679
Number of extensions: 118878
Number of successful extensions: 32608
Number of sequences better than 0.5: 28
Number of HSP's better than 0.5 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32547
Number of HSP's gapped (non-prelim): 61
length of query: 1341
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1322
effective length of database: 196,384,763
effective search space: 259620656686
effective search space used: 259620656686
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)