BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF11h01.xg.2.1
(328 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF119260.1|CF119260 MTU10CS.P15.E09 Aspen stem cDNA Libr... 48 2e-004
gb|BI127787.1|BI127787 G066P03Y Populus cambium cDNA librar... 42 0.013
gb|BU868361.1|BU868361 M115A04 Populus flower cDNA library ... 42 0.013
gb|CK088858.1|CK088858 A076P21.3pR Hybrid aspen plasmid lib... 42 0.013
gb|CK097179.1|CK097179 UB42BPD03.3pR Populus active cambium... 42 0.013
gb|AJ772174.1|AJ772174 AJ772174 Populus euphratica shoot in... 42 0.013
gb|CV240226.1|CV240226 WS0234.B21_M19 PT-MB-A-13 Populus tr... 42 0.013
gb|CV257505.1|CV257505 WS0246.B21_N16 PTxD-ICC-N-A-14 Popul... 42 0.013
gb|CV267435.1|CV267435 WS02031.B21_L19 PTxN-IB-N-A-11 Popul... 42 0.013
gb|CX170763.1|CX170763 G07_69-32_13.ab1 leaf inoculated wit... 42 0.013
gb|CX654661.1|CX654661 PO02057G05 Poplar SC cDNA library Po... 42 0.013
gb|CX660230.1|CX660230 PO01019F01 Poplar SC cDNA library Po... 42 0.013
gb|DT507435.1|DT507435 WS02418.BR_E03 PTxD-ICC-N-A-14 Popul... 42 0.013
gb|DT507569.1|DT507569 WS02418.BR_J21 PTxD-ICC-N-A-14 Popul... 42 0.013
gb|DT512063.1|DT512063 WS02418.B21_E03 PTxD-ICC-N-A-14 Popu... 42 0.013
gb|DT512195.1|DT512195 WS02418.B21_J21 PTxD-ICC-N-A-14 Popu... 42 0.013
gb|DT515203.1|DT515203 WS02426.B21_O22 PTxD-ICC-N-A-14 Popu... 42 0.013
gb|AJ770035.1|AJ770035 AJ770035 Populus euphratica leaf 3-6... 40 0.050
>gb|CF119260.1|CF119260 MTU10CS.P15.E09 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 189
Score = 48.1 bits (24), Expect = 2e-004
Identities = 24/24 (100%)
Strand = Plus / Plus
Query: 304 ctgtacctcggccgcgaccacgct 327
||||||||||||||||||||||||
Sbjct: 166 ctgtacctcggccgcgaccacgct 189
>gb|BI127787.1|BI127787 G066P03Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 497
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 133 atgctaggattatacccaagtcccaggacatgccatgactt 93
>gb|BU868361.1|BU868361 M115A04 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 490
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 117 atgctaggattatacccaagtcccaggacatgccatgactt 77
>gb|CK088858.1|CK088858 A076P21.3pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A076P21 3', mRNA sequence
Length = 708
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 448 atgctaggattatacccaagtcccaggacatgccatgactt 488
>gb|CK097179.1|CK097179 UB42BPD03.3pR Populus active cambium cDNA library Populus tremula
cDNA clone UB42BPD03 3', mRNA sequence
Length = 740
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 363 atgctaggattatacccaagtcccaggacatgccatgactt 403
>gb|AJ772174.1|AJ772174 AJ772174 Populus euphratica shoot in vitro plantlet Israel Populus
euphratica cDNA clone P0001700002E01F1, mRNA sequence
Length = 386
Score = 42.1 bits (21), Expect = 0.013
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 304 ctgtacctcggccgcgaccacgcta 328
|||||||||||||| ||||||||||
Sbjct: 362 ctgtacctcggccgggaccacgcta 386
>gb|CV240226.1|CV240226 WS0234.B21_M19 PT-MB-A-13 Populus trichocarpa cDNA clone WS0234_M19
3', mRNA sequence
Length = 733
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 422 atgctaggattatacccaagtcccaggacatgccatgactt 462
>gb|CV257505.1|CV257505 WS0246.B21_N16 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0246_N16 3', mRNA sequence
Length = 691
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 433 atgctaggattatacccaagtcccaggacatgccatgactt 473
>gb|CV267435.1|CV267435 WS02031.B21_L19 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02031_L19 3', mRNA sequence
Length = 510
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 436 atgctaggattatacccaagtcccaggacatgccatgactt 476
>gb|CX170763.1|CX170763 G07_69-32_13.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 488
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 314 atgctaggattatacccaagtcccaggacatgccatgactt 354
>gb|CX654661.1|CX654661 PO02057G05 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO02057G05 5', mRNA sequence
Length = 368
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
|||||||| ||||| ||||| |||| ||||||||||||||
Sbjct: 185 atgcttgggttatacccaagtcccaggacatgccatgactt 145
>gb|CX660230.1|CX660230 PO01019F01 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01019F01 5', mRNA sequence
Length = 636
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
|||||||| ||||| ||||| |||| ||||||||||||||
Sbjct: 208 atgcttgggttatacccaagtcccaggacatgccatgactt 168
>gb|DT507435.1|DT507435 WS02418.BR_E03 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02418_E03 5', mRNA sequence
Length = 735
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 317 atgctaggattatacccaagtcccaggacatgccatgactt 277
>gb|DT507569.1|DT507569 WS02418.BR_J21 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02418_J21 5', mRNA sequence
Length = 665
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 234 atgctaggattatacccaagtcccaggacatgccatgactt 194
>gb|DT512063.1|DT512063 WS02418.B21_E03 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02418_E03 3', mRNA sequence
Length = 748
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 432 atgctaggattatacccaagtcccaggacatgccatgactt 472
>gb|DT512195.1|DT512195 WS02418.B21_J21 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02418_J21 3', mRNA sequence
Length = 665
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 432 atgctaggattatacccaagtcccaggacatgccatgactt 472
>gb|DT515203.1|DT515203 WS02426.B21_O22 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02426_O22 3', mRNA sequence
Length = 918
Score = 42.1 bits (21), Expect = 0.013
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 34 atgcttggattatagccaagacccattacatgccatgactt 74
||||| |||||||| ||||| |||| ||||||||||||||
Sbjct: 432 atgctaggattatacccaagtcccaggacatgccatgactt 472
>gb|AJ770035.1|AJ770035 AJ770035 Populus euphratica leaf 3-6 months, adult Populus
euphratica cDNA clone P0001100006A08F1, mRNA sequence
Length = 179
Score = 40.1 bits (20), Expect = 0.050
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 305 tgtacctcggccgcgaccacgcta 328
||||||||||||| ||||||||||
Sbjct: 156 tgtacctcggccgggaccacgcta 179
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 27,625
Number of Sequences: 369679
Number of extensions: 27625
Number of successful extensions: 7706
Number of sequences better than 0.5: 18
Number of HSP's better than 0.5 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 7688
Number of HSP's gapped (non-prelim): 18
length of query: 328
length of database: 203,408,664
effective HSP length: 18
effective length of query: 310
effective length of database: 196,754,442
effective search space: 60993877020
effective search space used: 60993877020
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)