BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAF11h01.xg.2.1
         (328 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CF119260.1|CF119260  MTU10CS.P15.E09 Aspen stem cDNA Libr...    48   2e-004
gb|BI127787.1|BI127787  G066P03Y Populus cambium cDNA librar...    42   0.013
gb|BU868361.1|BU868361  M115A04 Populus flower cDNA library ...    42   0.013
gb|CK088858.1|CK088858  A076P21.3pR Hybrid aspen plasmid lib...    42   0.013
gb|CK097179.1|CK097179  UB42BPD03.3pR Populus active cambium...    42   0.013
gb|AJ772174.1|AJ772174  AJ772174 Populus euphratica shoot in...    42   0.013
gb|CV240226.1|CV240226  WS0234.B21_M19 PT-MB-A-13 Populus tr...    42   0.013
gb|CV257505.1|CV257505  WS0246.B21_N16 PTxD-ICC-N-A-14 Popul...    42   0.013
gb|CV267435.1|CV267435  WS02031.B21_L19 PTxN-IB-N-A-11 Popul...    42   0.013
gb|CX170763.1|CX170763  G07_69-32_13.ab1 leaf inoculated wit...    42   0.013
gb|CX654661.1|CX654661  PO02057G05 Poplar SC cDNA library Po...    42   0.013
gb|CX660230.1|CX660230  PO01019F01 Poplar SC cDNA library Po...    42   0.013
gb|DT507435.1|DT507435  WS02418.BR_E03 PTxD-ICC-N-A-14 Popul...    42   0.013
gb|DT507569.1|DT507569  WS02418.BR_J21 PTxD-ICC-N-A-14 Popul...    42   0.013
gb|DT512063.1|DT512063  WS02418.B21_E03 PTxD-ICC-N-A-14 Popu...    42   0.013
gb|DT512195.1|DT512195  WS02418.B21_J21 PTxD-ICC-N-A-14 Popu...    42   0.013
gb|DT515203.1|DT515203  WS02426.B21_O22 PTxD-ICC-N-A-14 Popu...    42   0.013
gb|AJ770035.1|AJ770035  AJ770035 Populus euphratica leaf 3-6...    40   0.050
>gb|CF119260.1|CF119260 MTU10CS.P15.E09 Aspen stem cDNA Library Populus tremuloides cDNA,
           mRNA sequence
          Length = 189

 Score = 48.1 bits (24), Expect = 2e-004
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 304 ctgtacctcggccgcgaccacgct 327
           ||||||||||||||||||||||||
Sbjct: 166 ctgtacctcggccgcgaccacgct 189
>gb|BI127787.1|BI127787 G066P03Y Populus cambium cDNA library Populus tremula x Populus
           tremuloides cDNA, mRNA sequence
          Length = 497

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 133 atgctaggattatacccaagtcccaggacatgccatgactt 93
>gb|BU868361.1|BU868361 M115A04 Populus flower cDNA library Populus trichocarpa cDNA 5
           prime, mRNA sequence
          Length = 490

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 117 atgctaggattatacccaagtcccaggacatgccatgactt 77
>gb|CK088858.1|CK088858 A076P21.3pR Hybrid aspen plasmid library Populus tremula x Populus
           tremuloides cDNA clone A076P21 3', mRNA sequence
          Length = 708

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 448 atgctaggattatacccaagtcccaggacatgccatgactt 488
>gb|CK097179.1|CK097179 UB42BPD03.3pR Populus active cambium cDNA library Populus tremula
           cDNA clone UB42BPD03 3', mRNA sequence
          Length = 740

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 363 atgctaggattatacccaagtcccaggacatgccatgactt 403
>gb|AJ772174.1|AJ772174 AJ772174 Populus euphratica shoot in vitro plantlet Israel Populus
           euphratica cDNA clone P0001700002E01F1, mRNA sequence
          Length = 386

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 304 ctgtacctcggccgcgaccacgcta 328
           |||||||||||||| ||||||||||
Sbjct: 362 ctgtacctcggccgggaccacgcta 386
>gb|CV240226.1|CV240226 WS0234.B21_M19 PT-MB-A-13 Populus trichocarpa cDNA clone WS0234_M19
           3', mRNA sequence
          Length = 733

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 422 atgctaggattatacccaagtcccaggacatgccatgactt 462
>gb|CV257505.1|CV257505 WS0246.B21_N16 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
           deltoides cDNA clone WS0246_N16 3', mRNA sequence
          Length = 691

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 433 atgctaggattatacccaagtcccaggacatgccatgactt 473
>gb|CV267435.1|CV267435 WS02031.B21_L19 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
           cDNA clone WS02031_L19 3', mRNA sequence
          Length = 510

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 436 atgctaggattatacccaagtcccaggacatgccatgactt 476
>gb|CX170763.1|CX170763 G07_69-32_13.ab1 leaf inoculated with Marssonia pathogen of Populus
           deltoides Populus deltoides cDNA, mRNA sequence
          Length = 488

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 314 atgctaggattatacccaagtcccaggacatgccatgactt 354
>gb|CX654661.1|CX654661 PO02057G05 Poplar SC cDNA library Populus alba x Populus tremula
           var. glandulosa cDNA clone PO02057G05 5', mRNA sequence
          Length = 368

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           |||||||| ||||| ||||| ||||  ||||||||||||||
Sbjct: 185 atgcttgggttatacccaagtcccaggacatgccatgactt 145
>gb|CX660230.1|CX660230 PO01019F01 Poplar SC cDNA library Populus alba x Populus tremula
           var. glandulosa cDNA clone PO01019F01 5', mRNA sequence
          Length = 636

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           |||||||| ||||| ||||| ||||  ||||||||||||||
Sbjct: 208 atgcttgggttatacccaagtcccaggacatgccatgactt 168
>gb|DT507435.1|DT507435 WS02418.BR_E03 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
           deltoides cDNA clone WS02418_E03 5', mRNA sequence
          Length = 735

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 317 atgctaggattatacccaagtcccaggacatgccatgactt 277
>gb|DT507569.1|DT507569 WS02418.BR_J21 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
           deltoides cDNA clone WS02418_J21 5', mRNA sequence
          Length = 665

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 234 atgctaggattatacccaagtcccaggacatgccatgactt 194
>gb|DT512063.1|DT512063 WS02418.B21_E03 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
           deltoides cDNA clone WS02418_E03 3', mRNA sequence
          Length = 748

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 432 atgctaggattatacccaagtcccaggacatgccatgactt 472
>gb|DT512195.1|DT512195 WS02418.B21_J21 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
           deltoides cDNA clone WS02418_J21 3', mRNA sequence
          Length = 665

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 432 atgctaggattatacccaagtcccaggacatgccatgactt 472
>gb|DT515203.1|DT515203 WS02426.B21_O22 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
           deltoides cDNA clone WS02426_O22 3', mRNA sequence
          Length = 918

 Score = 42.1 bits (21), Expect = 0.013
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 34  atgcttggattatagccaagacccattacatgccatgactt 74
           ||||| |||||||| ||||| ||||  ||||||||||||||
Sbjct: 432 atgctaggattatacccaagtcccaggacatgccatgactt 472
>gb|AJ770035.1|AJ770035 AJ770035 Populus euphratica leaf 3-6 months, adult Populus
           euphratica cDNA clone P0001100006A08F1, mRNA sequence
          Length = 179

 Score = 40.1 bits (20), Expect = 0.050
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 305 tgtacctcggccgcgaccacgcta 328
           ||||||||||||| ||||||||||
Sbjct: 156 tgtacctcggccgggaccacgcta 179
  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 27,625
Number of Sequences: 369679
Number of extensions: 27625
Number of successful extensions: 7706
Number of sequences better than  0.5: 18
Number of HSP's better than  0.5 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 7688
Number of HSP's gapped (non-prelim): 18
length of query: 328
length of database: 203,408,664
effective HSP length: 18
effective length of query: 310
effective length of database: 196,754,442
effective search space: 60993877020
effective search space used: 60993877020
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)