BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 4534747.2.1
         (628 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CV233282.1|CV233282  WS0121.B21_J05 PT-GT-FL-A-3 Populus ...    54   7e-006
gb|BU836496.1|BU836496  T087C12 Populus apical shoot cDNA li...    40   0.099
gb|CF228348.1|CF228348  PtaXM0011H7H0715 Poplar cDNA library...    40   0.099
gb|BP933399.1|BP933399  BP933399 full-length enriched poplar...    40   0.099
gb|DN489864.1|DN489864  T087C12.3pR Populus shoot meristem c...    40   0.099
gb|DN499789.1|DN499789  T087C12.5pR Populus shoot meristem c...    40   0.099
gb|DN489293.1|DN489293  T021A10.3pR Populus shoot meristem c...    38   0.39 
gb|DN494990.1|DN494990  N009H07.5pR Populus bark cDNA librar...    38   0.39 

>gb|CV233282.1|CV233282 WS0121.B21_J05 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
           WS0121_J05 3', mRNA sequence
          Length = 539

 Score = 54.0 bits (27), Expect = 7e-006
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 355 gaggggtgcagctgagatcaagcagcacccgttctttga 393
           |||||||||| |||||||||||||||| || ||||||||
Sbjct: 480 gaggggtgcaactgagatcaagcagcatcctttctttga 442



>gb|BU836496.1|BU836496 T087C12 Populus apical shoot cDNA library Populus tremula x Populus
           tremuloides cDNA 5 prime, mRNA sequence
          Length = 724

 Score = 40.1 bits (20), Expect = 0.099
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 366 ctgagatcaagcagcacccgttctttga 393
           ||||||||||||| ||||| ||||||||
Sbjct: 665 ctgagatcaagcaacaccctttctttga 692



>gb|CF228348.1|CF228348 PtaXM0011H7H0715 Poplar cDNA library from mature xylem Populus alba
           x Populus tremula cDNA 5', mRNA sequence
          Length = 645

 Score = 40.1 bits (20), Expect = 0.099
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 122 ggcgagggccacgggagcgcggtggactggtggaccttcggcat 165
           |||||||| ||||| | ||| ||||| ||||||||||| |||||
Sbjct: 262 ggcgagggacacggcaacgcagtggattggtggaccttaggcat 305



>gb|BP933399.1|BP933399 BP933399 full-length enriched poplar cDNA library Populus nigra
           cDNA clone PnFL1-050_O04.r 3', mRNA sequence
          Length = 652

 Score = 40.1 bits (20), Expect = 0.099
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 366 ctgagatcaagcagcacccgttctttga 393
           ||||||||||||| ||||| ||||||||
Sbjct: 507 ctgagatcaagcaacaccctttctttga 480



>gb|DN489864.1|DN489864 T087C12.3pR Populus shoot meristem cDNA library Populus tremula x
           Populus tremuloides cDNA clone T087C12 3', mRNA sequence
          Length = 517

 Score = 40.1 bits (20), Expect = 0.099
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 366 ctgagatcaagcagcacccgttctttga 393
           ||||||||||||| ||||| ||||||||
Sbjct: 404 ctgagatcaagcaacaccctttctttga 377



>gb|DN499789.1|DN499789 T087C12.5pR Populus shoot meristem cDNA library Populus tremula x
           Populus tremuloides cDNA clone T087C12 5', mRNA sequence
          Length = 852

 Score = 40.1 bits (20), Expect = 0.099
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 366 ctgagatcaagcagcacccgttctttga 393
           ||||||||||||| ||||| ||||||||
Sbjct: 666 ctgagatcaagcaacaccctttctttga 693



>gb|DN489293.1|DN489293 T021A10.3pR Populus shoot meristem cDNA library Populus tremula x
           Populus tremuloides cDNA clone T021A10 3', mRNA sequence
          Length = 695

 Score = 38.2 bits (19), Expect = 0.39
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                          
Query: 126 agggccacgggagcgcggtggactggtggac 156
           ||||||| || ||||||||||| ||||||||
Sbjct: 439 agggccatggaagcgcggtggattggtggac 409



>gb|DN494990.1|DN494990 N009H07.5pR Populus bark cDNA library Populus tremula x Populus
           tremuloides cDNA clone N009H07 5', mRNA sequence
          Length = 760

 Score = 38.2 bits (19), Expect = 0.39
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                  
Query: 355 gaggggtgcagctgagatcaagcagcacccgttctttga 393
           |||||||||  |||| ||||||||||| || ||||||||
Sbjct: 552 gaggggtgcgactgaaatcaagcagcatcctttctttga 590



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 61,110
Number of Sequences: 369679
Number of extensions: 61110
Number of successful extensions: 17255
Number of sequences better than  0.5: 8
Number of HSP's better than  0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 17247
Number of HSP's gapped (non-prelim): 8
length of query: 628
length of database: 203,408,664
effective HSP length: 19
effective length of query: 609
effective length of database: 196,384,763
effective search space: 119598320667
effective search space used: 119598320667
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)