BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3588987.2.1
(487 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CK318323.1|CK318323 B9P08a06 Populus stem seasonal libra... 38 0.30
gb|CV130438.1|CV130438 B9P01a09 Populus stem seasonal libra... 38 0.30
gb|CV225340.1|CV225340 WS0161.B21_B15 PT-DX-A-7 Populus tri... 38 0.30
gb|CV234148.1|CV234148 WS01213.B21_M23 PT-GT-FL-A-3 Populus... 38 0.30
gb|CV234277.1|CV234277 WS01214.B21_F10 PT-GT-FL-A-3 Populus... 38 0.30
gb|CV253076.1|CV253076 PX0019.B21_D13 PT-X-FL-A-1 Populus t... 38 0.30
gb|DT469683.1|DT469683 WS01918.C21_J03 PT-DX-N-A-10 Populus... 38 0.30
gb|DT477045.1|DT477045 WS01231.B21_M11 PT-GT-FL-A-3 Populus... 38 0.30
gb|DT500630.1|DT500630 PX0019.BR.1_D13 PT-X-FL-A-1 Populus ... 38 0.30
gb|DT514749.1|DT514749 WS02425.B21_K20 PTxD-ICC-N-A-14 Popu... 38 0.30
gb|DT518027.1|DT518027 WS02435.B21_P21 PTxD-ICC-N-A-14 Popu... 38 0.30
gb|DT521656.1|DT521656 WS02034.B21_O01 PTxN-IB-N-A-11 Popul... 38 0.30
gb|DT524020.1|DT524020 WS02041.C21.1_E23 PTxN-IB-N-A-11 Pop... 38 0.30
>gb|CK318323.1|CK318323 B9P08a06 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 546
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Minus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 264 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 206
>gb|CV130438.1|CV130438 B9P01a09 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 622
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Minus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 475 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 417
>gb|CV225340.1|CV225340 WS0161.B21_B15 PT-DX-A-7 Populus trichocarpa cDNA clone WS0161_B15
3', mRNA sequence
Length = 548
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 299 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 357
>gb|CV234148.1|CV234148 WS01213.B21_M23 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01213_M23 3', mRNA sequence
Length = 736
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 295 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 353
>gb|CV234277.1|CV234277 WS01214.B21_F10 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01214_F10 3', mRNA sequence
Length = 711
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 296 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 354
>gb|CV253076.1|CV253076 PX0019.B21_D13 PT-X-FL-A-1 Populus trichocarpa cDNA clone
PX0019_D13 3', mRNA sequence
Length = 518
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 295 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 353
>gb|DT469683.1|DT469683 WS01918.C21_J03 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01918_J03 3', mRNA sequence
Length = 423
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 284 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 342
>gb|DT477045.1|DT477045 WS01231.B21_M11 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01231_M11 3', mRNA sequence
Length = 831
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 294 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 352
>gb|DT500630.1|DT500630 PX0019.BR.1_D13 PT-X-FL-A-1 Populus trichocarpa cDNA clone
PX0019_D13 5', mRNA sequence
Length = 472
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Minus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 223 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 165
>gb|DT514749.1|DT514749 WS02425.B21_K20 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02425_K20 3', mRNA sequence
Length = 908
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 314 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 372
>gb|DT518027.1|DT518027 WS02435.B21_P21 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02435_P21 3', mRNA sequence
Length = 484
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 318 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 376
>gb|DT521656.1|DT521656 WS02034.B21_O01 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02034_O01 3', mRNA sequence
Length = 510
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Plus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 312 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 370
>gb|DT524020.1|DT524020 WS02041.C21.1_E23 PTxN-IB-N-A-11 Populus trichocarpa x Populus
nigra cDNA clone WS02041_E23 3', mRNA sequence
Length = 607
Score = 38.2 bits (19), Expect = 0.30
Identities = 49/59 (83%)
Strand = Plus / Minus
Query: 315 aggatgttctggatctcagggtcttgcatggctttgttctgtctctctttcagttcctc 373
|||||||| || || || ||||| ||||| || ||| ||||||||| |||||||||||
Sbjct: 323 aggatgttttgaatttctgggtcctgcattgccttggcctgtctctccttcagttcctc 265
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 53,747
Number of Sequences: 369679
Number of extensions: 53747
Number of successful extensions: 14335
Number of sequences better than 0.5: 13
Number of HSP's better than 0.5 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14312
Number of HSP's gapped (non-prelim): 23
length of query: 487
length of database: 203,408,664
effective HSP length: 19
effective length of query: 468
effective length of database: 196,384,763
effective search space: 91908069084
effective search space used: 91908069084
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)