BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3183567.2.1
(681 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BP930371.1|BP930371 BP930371 full-length enriched poplar... 42 0.027
gb|BP932154.1|BP932154 BP932154 full-length enriched poplar... 42 0.027
gb|AI166345.1|AI166345 xylem.est.187 Poplar xylem Lambda ZA... 38 0.42
gb|CA926750.1|CA926750 MTU6CR.P18.G04 Aspen root cDNA Libra... 38 0.42
gb|CA927509.1|CA927509 MTU6CR.P9.H08 Aspen root cDNA Librar... 38 0.42
gb|CA933099.1|CA933099 MTU5CS.P3.E04 Aspen stem cDNA Librar... 38 0.42
gb|CB240350.1|CB240350 PopSC00329 Poplar SC cDNA library Po... 38 0.42
gb|CA821452.1|CA821452 RSH03B08 two-month-old roots from cl... 38 0.42
gb|CA825357.1|CA825357 R57E10 two-month-old roots from clon... 38 0.42
gb|CA826130.1|CA826130 R73B12 two-month-old roots from clon... 38 0.42
gb|CA826175.1|CA826175 R73H04 two-month-old roots from clon... 38 0.42
gb|CN518816.1|CN518816 GQ0103.B3_O12 GQ010 Populus trichoca... 38 0.42
gb|CN524309.1|CN524309 GQ015M14.T3_F12 GQ015 Populus tricho... 38 0.42
gb|CV130469.1|CV130469 B9P07a09 Populus stem seasonal libra... 38 0.42
gb|CV227462.1|CV227462 WS0167.B21_E05 PT-DX-A-7 Populus tri... 38 0.42
gb|CV227542.1|CV227542 WS0167.B21_H17 PT-DX-A-7 Populus tri... 38 0.42
gb|CV229005.1|CV229005 WS01911.B21_O22 PT-DX-N-A-10 Populus... 38 0.42
gb|CV238171.1|CV238171 WS0125.B21_J03 PT-GT-FL-A-3 Populus ... 38 0.42
gb|CV258855.1|CV258855 WS0201.B21_L03 PTxN-IB-N-A-11 Populu... 38 0.42
gb|CV270946.1|CV270946 WS0153.B21_F24 PTxN-IB-A-6 Populus t... 38 0.42
gb|CV271499.1|CV271499 WS0154.B21_N23 PTxN-IB-A-6 Populus t... 38 0.42
gb|CV277157.1|CV277157 WS0142.B21_N01 PTxD-IL-A-5 Populus t... 38 0.42
gb|CX657313.1|CX657313 PO02040E11 Poplar SC cDNA library Po... 38 0.42
gb|CX659166.1|CX659166 PO01027C10 Poplar SC cDNA library Po... 38 0.42
gb|CX659780.1|CX659780 PO01014A06 Poplar SC cDNA library Po... 38 0.42
gb|CX660306.1|CX660306 PO01035D03 Poplar SC cDNA library Po... 38 0.42
gb|BP929823.1|BP929823 BP929823 full-length enriched poplar... 38 0.42
gb|BP930264.1|BP930264 BP930264 full-length enriched poplar... 38 0.42
gb|BP930569.1|BP930569 BP930569 full-length enriched poplar... 38 0.42
gb|BP930797.1|BP930797 BP930797 full-length enriched poplar... 38 0.42
gb|BP931127.1|BP931127 BP931127 full-length enriched poplar... 38 0.42
gb|BP931230.1|BP931230 BP931230 full-length enriched poplar... 38 0.42
gb|BP931282.1|BP931282 BP931282 full-length enriched poplar... 38 0.42
gb|BP931398.1|BP931398 BP931398 full-length enriched poplar... 38 0.42
gb|BP932066.1|BP932066 BP932066 full-length enriched poplar... 38 0.42
gb|BP932295.1|BP932295 BP932295 full-length enriched poplar... 38 0.42
gb|BP932296.1|BP932296 BP932296 full-length enriched poplar... 38 0.42
gb|BP932438.1|BP932438 BP932438 full-length enriched poplar... 38 0.42
gb|BP932467.1|BP932467 BP932467 full-length enriched poplar... 38 0.42
gb|BP932578.1|BP932578 BP932578 full-length enriched poplar... 38 0.42
gb|BP932720.1|BP932720 BP932720 full-length enriched poplar... 38 0.42
gb|BP932846.1|BP932846 BP932846 full-length enriched poplar... 38 0.42
gb|BP932938.1|BP932938 BP932938 full-length enriched poplar... 38 0.42
gb|BP933817.1|BP933817 BP933817 full-length enriched poplar... 38 0.42
gb|BP933883.1|BP933883 BP933883 full-length enriched poplar... 38 0.42
gb|BP933947.1|BP933947 BP933947 full-length enriched poplar... 38 0.42
gb|BP934046.1|BP934046 BP934046 full-length enriched poplar... 38 0.42
gb|BP934196.1|BP934196 BP934196 full-length enriched poplar... 38 0.42
gb|BP934236.1|BP934236 BP934236 full-length enriched poplar... 38 0.42
gb|BP934292.1|BP934292 BP934292 full-length enriched poplar... 38 0.42
gb|BP934388.1|BP934388 BP934388 full-length enriched poplar... 38 0.42
gb|BP934497.1|BP934497 BP934497 full-length enriched poplar... 38 0.42
gb|BP934726.1|BP934726 BP934726 full-length enriched poplar... 38 0.42
gb|BP934834.1|BP934834 BP934834 full-length enriched poplar... 38 0.42
gb|BP934990.1|BP934990 BP934990 full-length enriched poplar... 38 0.42
gb|BP935243.1|BP935243 BP935243 full-length enriched poplar... 38 0.42
gb|BP935440.1|BP935440 BP935440 full-length enriched poplar... 38 0.42
gb|BP936121.1|BP936121 BP936121 full-length enriched poplar... 38 0.42
gb|BP936361.1|BP936361 BP936361 full-length enriched poplar... 38 0.42
gb|BP936904.1|BP936904 BP936904 full-length enriched poplar... 38 0.42
gb|DT473001.1|DT473001 WS01228.BR_E07 PT-GT-FL-A-3 Populus ... 38 0.42
gb|DT473087.1|DT473087 WS01228.BR_I15 PT-GT-FL-A-3 Populus ... 38 0.42
gb|DT476091.1|DT476091 WS01228.B21_E07 PT-GT-FL-A-3 Populus... 38 0.42
gb|DT476158.1|DT476158 WS01228.B21_I15 PT-GT-FL-A-3 Populus... 38 0.42
gb|DT508543.1|DT508543 WS02421.BR_E07 PTxD-ICC-N-A-14 Popul... 38 0.42
gb|DT513152.1|DT513152 WS02421.B21_E07 PTxD-ICC-N-A-14 Popu... 38 0.42
gb|DT519673.1|DT519673 WS02443.B21_F08 PTxD-ICC-N-A-14 Popu... 38 0.42
gb|DT521682.1|DT521682 WS02034.B21_P04 PTxN-IB-N-A-11 Popul... 38 0.42
>gb|BP930371.1|BP930371 BP930371 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-009_C11.r 3', mRNA sequence
Length = 587
Score = 42.1 bits (21), Expect = 0.027
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgccca 535
||||||||||||||||| |||||||
Sbjct: 537 ttcttggtgggcttccatttgccca 561
>gb|BP932154.1|BP932154 BP932154 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-032_H11.r 3', mRNA sequence
Length = 576
Score = 42.1 bits (21), Expect = 0.027
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgccca 535
||||||||||||||||| |||||||
Sbjct: 534 ttcttggtgggcttccatttgccca 558
>gb|AI166345.1|AI166345 xylem.est.187 Poplar xylem Lambda ZAPII library Populus trichocarpa
cDNA 5', mRNA sequence
Length = 441
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 147 ttcttggtgggcttccatttgcc 125
>gb|CA926750.1|CA926750 MTU6CR.P18.G04 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 553
Score = 38.2 bits (19), Expect = 0.42
Identities = 67/83 (80%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcccacgaaggcgtcgtgcgccgacggctggctcttcttg 570
||||||||||||||||| | ||| | ||||| || || || |||||||| |||||
Sbjct: 94 ttcttggtgggcttccattcgccaagaaaggcttcatgggctgacggctgtgatttcttt 35
Query: 571 atcggcgtcatccaccgccacat 593
||||| |||||||||| ||||||
Sbjct: 34 atcggggtcatccacctccacat 12
>gb|CA927509.1|CA927509 MTU6CR.P9.H08 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 578
Score = 38.2 bits (19), Expect = 0.42
Identities = 67/83 (80%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcccacgaaggcgtcgtgcgccgacggctggctcttcttg 570
||||||||||||||||| | ||| | ||||| || || || |||||||| |||||
Sbjct: 460 ttcttggtgggcttccattcgccaagaaaggcttcatgggctgacggctgtgatttcttt 519
Query: 571 atcggcgtcatccaccgccacat 593
||||| |||||||||| ||||||
Sbjct: 520 atcggagtcatccacctccacat 542
>gb|CA933099.1|CA933099 MTU5CS.P3.E04 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 578
Score = 38.2 bits (19), Expect = 0.42
Identities = 67/83 (80%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcccacgaaggcgtcgtgcgccgacggctggctcttcttg 570
||||||||||||||||| | ||| | ||||| || || || |||||||| |||||
Sbjct: 119 ttcttggtgggcttccattcgccaagaaaggcttcatgggctgacggctgtgatttcttt 60
Query: 571 atcggcgtcatccaccgccacat 593
||||| |||||||||| ||||||
Sbjct: 59 atcggggtcatccacctccacat 37
>gb|CB240350.1|CB240350 PopSC00329 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PopSC00329, mRNA sequence
Length = 393
Score = 38.2 bits (19), Expect = 0.42
Identities = 67/83 (80%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcccacgaaggcgtcgtgcgccgacggctggctcttcttg 570
||||||||||||||||| | ||| | ||||| || || || |||||||| |||||
Sbjct: 287 ttcttggtgggcttccattcgccaagaaaggcttcatgggctgacggctgtgatttcttt 228
Query: 571 atcggcgtcatccaccgccacat 593
||||| |||||||||| ||||||
Sbjct: 227 atcggggtcatccacctccacat 205
>gb|CA821452.1|CA821452 RSH03B08 two-month-old roots from clone 'Beaupre' grown for 19 days
under restricted irrigation Populus trichocarpa x
Populus deltoides cDNA 5', mRNA sequence
Length = 568
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 61 ttcttggtgggcttccatttgcc 39
>gb|CA825357.1|CA825357 R57E10 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 611
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 66 ttcttggtgggcttccatttgcc 44
>gb|CA826130.1|CA826130 R73B12 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 541
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 71 ttcttggtgggcttccatttgcc 49
>gb|CA826175.1|CA826175 R73H04 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 619
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 72 ttcttggtgggcttccatttgcc 50
>gb|CN518816.1|CN518816 GQ0103.B3_O12 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0103_O12 5', mRNA sequence
Length = 526
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 124 ttcttggtgggcttccatttgcc 102
>gb|CN524309.1|CN524309 GQ015M14.T3_F12 GQ015 Populus trichocarpa x Populus deltoides cDNA
clone GQ015M14_F12 5', mRNA sequence
Length = 778
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 533 ttcttggtgggcttccatttgcc 555
>gb|CV130469.1|CV130469 B9P07a09 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 710
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 184 ttcttggtgggcttccatttgcc 162
>gb|CV227462.1|CV227462 WS0167.B21_E05 PT-DX-A-7 Populus trichocarpa cDNA clone WS0167_E05
3', mRNA sequence
Length = 587
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 520 ttcttggtgggcttccatttgcc 542
>gb|CV227542.1|CV227542 WS0167.B21_H17 PT-DX-A-7 Populus trichocarpa cDNA clone WS0167_H17
3', mRNA sequence
Length = 590
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 527 ttcttggtgggcttccatttgcc 549
>gb|CV229005.1|CV229005 WS01911.B21_O22 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01911_O22 3', mRNA sequence
Length = 637
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 498 ttcttggtgggcttccatttgcc 520
>gb|CV238171.1|CV238171 WS0125.B21_J03 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0125_J03 3', mRNA sequence
Length = 663
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 556 ttcttggtgggcttccatttgcc 578
>gb|CV258855.1|CV258855 WS0201.B21_L03 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS0201_L03 3', mRNA sequence
Length = 723
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 534 ttcttggtgggcttccatttgcc 556
>gb|CV270946.1|CV270946 WS0153.B21_F24 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0153_F24 3', mRNA sequence
Length = 940
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 557 ttcttggtgggcttccatttgcc 579
>gb|CV271499.1|CV271499 WS0154.B21_N23 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0154_N23 3', mRNA sequence
Length = 890
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 523 ttcttggtgggcttccatttgcc 545
>gb|CV277157.1|CV277157 WS0142.B21_N01 PTxD-IL-A-5 Populus trichocarpa x Populus deltoides
cDNA clone WS0142_N01 3', mRNA sequence
Length = 565
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 511 ttcttggtgggcttccatttgcc 533
>gb|CX657313.1|CX657313 PO02040E11 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO02040E11 5', mRNA sequence
Length = 655
Score = 38.2 bits (19), Expect = 0.42
Identities = 67/83 (80%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcccacgaaggcgtcgtgcgccgacggctggctcttcttg 570
||||||||||||||||| | ||| | ||||| || || || |||||||| |||||
Sbjct: 524 ttcttggtgggcttccattcgccaagaaaggcttcatgggctgacggctgtgatttcttt 465
Query: 571 atcggcgtcatccaccgccacat 593
||||| |||||||||| ||||||
Sbjct: 464 atcggggtcatccacctccacat 442
>gb|CX659166.1|CX659166 PO01027C10 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01027C10 5', mRNA sequence
Length = 693
Score = 38.2 bits (19), Expect = 0.42
Identities = 67/83 (80%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcccacgaaggcgtcgtgcgccgacggctggctcttcttg 570
||||||||||||||||| | ||| | ||||| || || || |||||||| |||||
Sbjct: 302 ttcttggtgggcttccattcgccaagaaaggcttcatgggctgacggctgtgatttcttt 243
Query: 571 atcggcgtcatccaccgccacat 593
||||| |||||||||| ||||||
Sbjct: 242 atcggggtcatccacctccacat 220
>gb|CX659780.1|CX659780 PO01014A06 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01014A06 5', mRNA sequence
Length = 672
Score = 38.2 bits (19), Expect = 0.42
Identities = 67/83 (80%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcccacgaaggcgtcgtgcgccgacggctggctcttcttg 570
||||||||||||||||| | ||| | ||||| || || || |||||||| |||||
Sbjct: 132 ttcttggtgggcttccattcgccaagaaaggcttcatgggctgacggctgtgatttcttt 73
Query: 571 atcggcgtcatccaccgccacat 593
||||| |||||||||| ||||||
Sbjct: 72 atcggggtcatccacctccacat 50
>gb|CX660306.1|CX660306 PO01035D03 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO01035D03 5', mRNA sequence
Length = 721
Score = 38.2 bits (19), Expect = 0.42
Identities = 67/83 (80%)
Strand = Plus / Minus
Query: 511 ttcttggtgggcttccagttgcccacgaaggcgtcgtgcgccgacggctggctcttcttg 570
||||||||||||||||| | ||| | ||||| || || || |||||||| |||||
Sbjct: 578 ttcttggtgggcttccattcgccaagaaaggcttcatgggctgacggctgtgatttcttt 519
Query: 571 atcggcgtcatccaccgccacat 593
||||| |||||||||| ||||||
Sbjct: 518 atcggggtcatccacctccacat 496
>gb|BP929823.1|BP929823 BP929823 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-002_E06.r 3', mRNA sequence
Length = 595
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 536 ttcttggtgggcttccatttgcc 558
>gb|BP930264.1|BP930264 BP930264 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-007_N21.r 3', mRNA sequence
Length = 600
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 542 ttcttggtgggcttccatttgcc 564
>gb|BP930569.1|BP930569 BP930569 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-011_N14.r 3', mRNA sequence
Length = 653
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 528 ttcttggtgggcttccatttgcc 550
>gb|BP930797.1|BP930797 BP930797 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-015_A14.r 3', mRNA sequence
Length = 628
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 568 ttcttggtgggcttccatttgcc 590
>gb|BP931127.1|BP931127 BP931127 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-018_N10.r 3', mRNA sequence
Length = 612
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 562 ttcttggtgggcttccatttgcc 584
>gb|BP931230.1|BP931230 BP931230 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-020_H12.r 3', mRNA sequence
Length = 670
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 536 ttcttggtgggcttccatttgcc 558
>gb|BP931282.1|BP931282 BP931282 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-021_C16.r 3', mRNA sequence
Length = 675
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 543 ttcttggtgggcttccatttgcc 565
>gb|BP931398.1|BP931398 BP931398 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-022_O24.r 3', mRNA sequence
Length = 585
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 543 ttcttggtgggcttccatttgcc 565
>gb|BP932066.1|BP932066 BP932066 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-031_F21.r 3', mRNA sequence
Length = 616
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 533 ttcttggtgggcttccatttgcc 555
>gb|BP932295.1|BP932295 BP932295 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-033_P05.r 3', mRNA sequence
Length = 684
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 564 ttcttggtgggcttccatttgcc 586
>gb|BP932296.1|BP932296 BP932296 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-033_P14.r 3', mRNA sequence
Length = 608
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 539 ttcttggtgggcttccatttgcc 561
>gb|BP932438.1|BP932438 BP932438 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-036_D13.r 3', mRNA sequence
Length = 681
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 562 ttcttggtgggcttccatttgcc 584
>gb|BP932467.1|BP932467 BP932467 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-036_I09.r 3', mRNA sequence
Length = 622
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 567 ttcttggtgggcttccatttgcc 589
>gb|BP932578.1|BP932578 BP932578 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-037_L12.r 3', mRNA sequence
Length = 650
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 562 ttcttggtgggcttccatttgcc 584
>gb|BP932720.1|BP932720 BP932720 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-039_P03.r 3', mRNA sequence
Length = 696
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 566 ttcttggtgggcttccatttgcc 588
>gb|BP932846.1|BP932846 BP932846 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-041_P15.r 3', mRNA sequence
Length = 707
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 579 ttcttggtgggcttccatttgcc 601
>gb|BP932938.1|BP932938 BP932938 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-044_A21.r 3', mRNA sequence
Length = 603
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 542 ttcttggtgggcttccatttgcc 564
>gb|BP933817.1|BP933817 BP933817 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-057_A23.r 3', mRNA sequence
Length = 653
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 594 ttcttggtgggcttccatttgcc 616
>gb|BP933883.1|BP933883 BP933883 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-057_M10.r 3', mRNA sequence
Length = 612
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 551 ttcttggtgggcttccatttgcc 573
>gb|BP933947.1|BP933947 BP933947 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-058_H08.r 3', mRNA sequence
Length = 617
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 566 ttcttggtgggcttccatttgcc 588
>gb|BP934046.1|BP934046 BP934046 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-059_L08.r 3', mRNA sequence
Length = 578
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 528 ttcttggtgggcttccatttgcc 550
>gb|BP934196.1|BP934196 BP934196 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-061_I15.r 3', mRNA sequence
Length = 593
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 563 ttcttggtgggcttccatttgcc 585
>gb|BP934236.1|BP934236 BP934236 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-062_B03.r 3', mRNA sequence
Length = 636
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 596 ttcttggtgggcttccatttgcc 618
>gb|BP934292.1|BP934292 BP934292 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-062_P17.r 3', mRNA sequence
Length = 648
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 511 ttcttggtgggcttccagttgcc 533
||||||||||||||||| |||||
Sbjct: 563 ttcttggtgggcttccatttgcc 585
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 66,680
Number of Sequences: 369679
Number of extensions: 66680
Number of successful extensions: 18733
Number of sequences better than 0.5: 69
Number of HSP's better than 0.5 without gapping: 61
Number of HSP's successfully gapped in prelim test: 8
Number of HSP's that attempted gapping in prelim test: 18610
Number of HSP's gapped (non-prelim): 131
length of query: 681
length of database: 203,408,664
effective HSP length: 19
effective length of query: 662
effective length of database: 196,384,763
effective search space: 130006713106
effective search space used: 130006713106
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)