BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3115190.2.2
         (1172 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|DV463759.1|DV463759  MTUNUL1.P2.B01 NUL Populus fremontii...    44   0.012
gb|BI136192.1|BI136192  F064P75Y Populus flower cDNA library...    42   0.047

>gb|DV463759.1|DV463759 MTUNUL1.P2.B01 NUL Populus fremontii x Populus angustifolia cDNA,
           mRNA sequence
          Length = 702

 Score = 44.1 bits (22), Expect = 0.012
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 496 ttccacgttgtcaacaacgactacacgcactggctcatgtacgccattgg 545
           ||||| || ||||||||||||||||| || |||   ||||||||||||||
Sbjct: 379 ttccatgtggtcaacaacgactacacccattgggaaatgtacgccattgg 428



>gb|BI136192.1|BI136192 F064P75Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
            sequence
          Length = 424

 Score = 42.1 bits (21), Expect = 0.047
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1047 tagggattgatttaatcccac 1067
            |||||||||||||||||||||
Sbjct: 120  tagggattgatttaatcccac 100



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 102,014
Number of Sequences: 369679
Number of extensions: 102014
Number of successful extensions: 27435
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27433
Number of HSP's gapped (non-prelim): 2
length of query: 1172
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1153
effective length of database: 196,384,763
effective search space: 226431631739
effective search space used: 226431631739
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)