BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3071483.2.1
(531 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA824940.1|CA824940 R50F12 two-month-old roots from clon... 50 9e-005
gb|CK318714.1|CK318714 X9P02e10 Populus stem seasonal libra... 50 9e-005
gb|AJ772086.1|AJ772086 AJ772086 Populus euphratica shoot in... 50 9e-005
gb|CV227983.1|CV227983 WS0168.B21_M05 PT-DX-A-7 Populus tri... 50 9e-005
gb|CV232450.1|CV232450 WS0197.B21_J24 PT-DX-N-A-10 Populus ... 50 9e-005
gb|CV273365.1|CV273365 WS01710.B21_L07 PTxD-NR-A-8 Populus ... 50 9e-005
gb|CF234857.1|CF234857 PtaJXT0016A11A1101 Poplar cDNA libra... 46 0.001
gb|AJ779760.1|AJ779760 AJ779760 Populus euphratica root 3-6... 46 0.001
gb|BU894885.1|BU894885 X016E01 Populus wood cDNA library Po... 44 0.005
gb|CF227708.1|CF227708 PtaXM0003E9E0909 Poplar cDNA library... 44 0.005
gb|BU894080.1|BU894080 X001H12 Populus wood cDNA library Po... 42 0.021
gb|BU894322.1|BU894322 X007D04 Populus wood cDNA library Po... 42 0.021
gb|BU894351.1|BU894351 X007H03 Populus wood cDNA library Po... 42 0.021
gb|BU894604.1|BU894604 X012A07 Populus wood cDNA library Po... 42 0.021
gb|BU894627.1|BU894627 X012C12 Populus wood cDNA library Po... 42 0.021
gb|BU894718.1|BU894718 X013G08 Populus wood cDNA library Po... 42 0.021
gb|BU894873.1|BU894873 X016C05 Populus wood cDNA library Po... 42 0.021
gb|BU895138.1|BU895138 X019G06 Populus wood cDNA library Po... 42 0.021
gb|BU895302.1|BU895302 X022B05 Populus wood cDNA library Po... 42 0.021
gb|BU895579.1|BU895579 X026D03 Populus wood cDNA library Po... 42 0.021
gb|BU895619.1|BU895619 X028D12 Populus wood cDNA library Po... 42 0.021
gb|BU896165.1|BU896165 X036E12 Populus wood cDNA library Po... 42 0.021
gb|BU896197.1|BU896197 X037A06 Populus wood cDNA library Po... 42 0.021
gb|BU896219.1|BU896219 X037D08 Populus wood cDNA library Po... 42 0.021
gb|BU896365.1|BU896365 X039F03 Populus wood cDNA library Po... 42 0.021
gb|BU896834.1|BU896834 X046E09 Populus wood cDNA library Po... 42 0.021
gb|BU897005.1|BU897005 X049D08 Populus wood cDNA library Po... 42 0.021
gb|BU897023.1|BU897023 X049G05 Populus wood cDNA library Po... 42 0.021
gb|BU897310.1|BU897310 X054H09 Populus wood cDNA library Po... 42 0.021
gb|BU897726.1|BU897726 X067D01 Populus wood cDNA library Po... 42 0.021
gb|BU897757.1|BU897757 X067H12 Populus wood cDNA library Po... 42 0.021
gb|BU897958.1|BU897958 X072F01 Populus wood cDNA library Po... 42 0.021
gb|CF227317.1|CF227317 PtaD2B6B0604 Poplar cDNA library fro... 42 0.021
gb|CF227513.1|CF227513 PtaD6H1H0115 Poplar cDNA library fro... 42 0.021
gb|CF227825.1|CF227825 PtaXM0005B1B0103 Poplar cDNA library... 42 0.021
gb|CF228030.1|CF228030 PtaXM0007H12H1216 Poplar cDNA librar... 42 0.021
gb|CF228622.1|CF228622 PtaXM0015D4D0408 Poplar cDNA library... 42 0.021
gb|CF228685.1|CF228685 PtaXM0016B2B0204 Poplar cDNA library... 42 0.021
gb|CF228747.1|CF228747 PtaXM0016H7H0715 Poplar cDNA library... 42 0.021
gb|CF229033.1|CF229033 PtaXM0020D12D1208 Poplar cDNA librar... 42 0.021
gb|CF229099.1|CF229099 PtaXM0021C12C1206 Poplar cDNA librar... 42 0.021
gb|CF229381.1|CF229381 PtaXM0024G1G0113 Poplar cDNA library... 42 0.021
gb|CF229619.1|CF229619 PtaXM0027F1F0111 Poplar cDNA library... 42 0.021
gb|CF232973.1|CF232973 PtaJXO0017H5H0515 Poplar cDNA librar... 42 0.021
gb|CF233286.1|CF233286 PtaJXO0021E4E0410 Poplar cDNA librar... 42 0.021
gb|CF235816.1|CF235816 PtaJXT0027D3D0307 Poplar cDNA librar... 42 0.021
gb|BU898049.1|BU898049 X073H09 Populus wood cDNA library Po... 40 0.083
gb|BU870837.1|BU870837 Q019A05 Populus flower cDNA library ... 38 0.33
gb|BU873321.1|BU873321 Q053H06 Populus flower cDNA library ... 38 0.33
gb|BU873865.1|BU873865 Q060G08 Populus flower cDNA library ... 38 0.33
gb|BU874551.1|BU874551 Q069C10 Populus flower cDNA library ... 38 0.33
gb|BU885384.1|BU885384 R030E01 Populus root cDNA library Po... 38 0.33
gb|BU893423.1|BU893423 P077E12 Populus petioles cDNA librar... 38 0.33
gb|BU894410.1|BU894410 X008H06 Populus wood cDNA library Po... 38 0.33
gb|BU894438.1|BU894438 X009C10 Populus wood cDNA library Po... 38 0.33
gb|BU894821.1|BU894821 X015E06 Populus wood cDNA library Po... 38 0.33
gb|BU894868.1|BU894868 X016B10 Populus wood cDNA library Po... 38 0.33
gb|BU894989.1|BU894989 X017G07 Populus wood cDNA library Po... 38 0.33
gb|BU895158.1|BU895158 X020A11 Populus wood cDNA library Po... 38 0.33
gb|BU895240.1|BU895240 X021B10 Populus wood cDNA library Po... 38 0.33
gb|BU895869.1|BU895869 X032C04 Populus wood cDNA library Po... 38 0.33
gb|BU895951.1|BU895951 X033D11 Populus wood cDNA library Po... 38 0.33
gb|BU895990.1|BU895990 X034A01 Populus wood cDNA library Po... 38 0.33
gb|BU896013.1|BU896013 X034C05 Populus wood cDNA library Po... 38 0.33
gb|BU896492.1|BU896492 X041C01 Populus wood cDNA library Po... 38 0.33
gb|BU896467.1|BU896467 X041C12 Populus wood cDNA library Po... 38 0.33
gb|BU897013.1|BU897013 X049E10 Populus wood cDNA library Po... 38 0.33
gb|BU897196.1|BU897196 X052H09 Populus wood cDNA library Po... 38 0.33
gb|BU897259.1|BU897259 X054B09 Populus wood cDNA library Po... 38 0.33
gb|BU897756.1|BU897756 X067H10 Populus wood cDNA library Po... 38 0.33
gb|BU898193.1|BU898193 X076C11 Populus wood cDNA library Po... 38 0.33
gb|BU898219.1|BU898219 X076F11 Populus wood cDNA library Po... 38 0.33
gb|CF227729.1|CF227729 PtaXM0003H11H1115 Poplar cDNA librar... 38 0.33
gb|CF228256.1|CF228256 PtaXM0010G6G0614 Poplar cDNA library... 38 0.33
gb|CF228382.1|CF228382 PtaXM0012C8C0806 Poplar cDNA library... 38 0.33
gb|CF228899.1|CF228899 PtaXM0018F8F0812 Poplar cDNA library... 38 0.33
gb|CF229036.1|CF229036 PtaXM0020D3D0307 Poplar cDNA library... 38 0.33
gb|CF229311.1|CF229311 PtaXM0023H6H0616 Poplar cDNA library... 38 0.33
gb|CF232216.1|CF232216 PtaJXO0007G3G0313 Poplar cDNA librar... 38 0.33
gb|CF232560.1|CF232560 PtaJXO0011H6H0616 Poplar cDNA librar... 38 0.33
gb|CF232900.1|CF232900 PtaJXO0017B12B1204 Poplar cDNA libra... 38 0.33
gb|CF234858.1|CF234858 PtaJXT0016A12A1202 Poplar cDNA libra... 38 0.33
gb|CF235376.1|CF235376 PtaJXT0022B11B1103 Poplar cDNA libra... 38 0.33
gb|CF236475.1|CF236475 PtaJXT3C5C0505 Poplar cDNA library f... 38 0.33
gb|CF236653.1|CF236653 PtaJXT5E12E1210 Poplar cDNA library ... 38 0.33
gb|CF236687.1|CF236687 PtaJXT6A10A1002 Poplar cDNA library ... 38 0.33
gb|CK116259.1|CK116259 Y022F04 Populus infected leaf substr... 38 0.33
gb|CK318729.1|CK318729 X9P02g01 Populus stem seasonal libra... 38 0.33
gb|CK319648.1|CK319648 B9SP07a01 Populus stem seasonal libr... 38 0.33
gb|CK320263.1|CK320263 L2P10e07 Populus stem seasonal libra... 38 0.33
gb|AJ776086.1|AJ776086 AJ776086 Populus euphratica root 3-6... 38 0.33
gb|AJ776739.1|AJ776739 AJ776739 Populus euphratica root 3-6... 38 0.33
gb|AJ777587.1|AJ777587 AJ777587 Populus euphratica root 3-6... 38 0.33
gb|AJ778050.1|AJ778050 AJ778050 Populus euphratica root 3-6... 38 0.33
gb|AJ778511.1|AJ778511 AJ778511 Populus euphratica cambium ... 38 0.33
gb|AJ779446.1|AJ779446 AJ779446 Populus euphratica root 3-6... 38 0.33
gb|AJ779467.1|AJ779467 AJ779467 Populus euphratica root 3-6... 38 0.33
gb|AJ779641.1|AJ779641 AJ779641 Populus euphratica root 3-6... 38 0.33
gb|AJ779956.1|AJ779956 AJ779956 Populus euphratica root 3-6... 38 0.33
gb|AJ780258.1|AJ780258 AJ780258 Populus euphratica root 3-6... 38 0.33
gb|CV228318.1|CV228318 WS0191.B21_L12 PT-DX-N-A-10 Populus ... 38 0.33
gb|CV274563.1|CV274563 WS0173.B21_K23 PTxD-NR-A-8 Populus t... 38 0.33
gb|CV274925.1|CV274925 WS0174.B21.1_N04 PTxD-NR-A-8 Populus... 38 0.33
gb|CV276320.1|CV276320 WS0179.B21_G04 PTxD-NR-A-8 Populus t... 38 0.33
>gb|CA824940.1|CA824940 R50F12 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 553
Score = 50.1 bits (25), Expect = 9e-005
Identities = 52/61 (85%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| |||||||| || ||||||||||||||||
Sbjct: 400 ctccacacttgtatcccactggacggttggcaatgttgcaacgtttggggatggtaatgg 341
Query: 305 c 305
|
Sbjct: 340 c 340
>gb|CK318714.1|CK318714 X9P02e10 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 646
Score = 50.1 bits (25), Expect = 9e-005
Identities = 52/61 (85%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| |||||||| || ||||||||||||||||
Sbjct: 395 ctccacacttgtatcccactggacggttggcaatgttgcaacgtttggggatggtaatgg 336
Query: 305 c 305
|
Sbjct: 335 c 335
>gb|AJ772086.1|AJ772086 AJ772086 Populus euphratica shoot in vitro plantlet Israel Populus
euphratica cDNA clone P0001700001C08F1, mRNA sequence
Length = 439
Score = 50.1 bits (25), Expect = 9e-005
Identities = 52/61 (85%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| |||||||| || ||||||||||||||||
Sbjct: 72 ctccacacttgtaacccactggacggttggcaatgttgcaacgtttggggatggtaatgg 131
Query: 305 c 305
|
Sbjct: 132 c 132
>gb|CV227983.1|CV227983 WS0168.B21_M05 PT-DX-A-7 Populus trichocarpa cDNA clone WS0168_M05
3', mRNA sequence
Length = 558
Score = 50.1 bits (25), Expect = 9e-005
Identities = 52/61 (85%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| |||||||| || ||||||||||||||||
Sbjct: 357 ctccacacttgtatcccactggacggttggcaatgttgcaacgtttggggatggtaatgg 298
Query: 305 c 305
|
Sbjct: 297 c 297
>gb|CV232450.1|CV232450 WS0197.B21_J24 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS0197_J24 3', mRNA sequence
Length = 337
Score = 50.1 bits (25), Expect = 9e-005
Identities = 52/61 (85%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| |||||||| || ||||||||||||||||
Sbjct: 210 ctccacacttgtatcccactggacggttggcaatgttgcaacgtttggggatggtaatgg 269
Query: 305 c 305
|
Sbjct: 270 c 270
>gb|CV273365.1|CV273365 WS01710.B21_L07 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS01710_L07 3', mRNA sequence
Length = 589
Score = 50.1 bits (25), Expect = 9e-005
Identities = 52/61 (85%)
Strand = Plus / Plus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| |||||||| || ||||||||||||||||
Sbjct: 226 ctccacacttgtatcccactggacggttggcaatgttgcaacgtttggggatggtaatgg 285
Query: 305 c 305
|
Sbjct: 286 c 286
>gb|CF234857.1|CF234857 PtaJXT0016A11A1101 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 620
Score = 46.1 bits (23), Expect = 0.001
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 235 agcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttgggg 294
||||| ||| |||| |||||||| || || || |||| ||| | |||||| || ||||||
Sbjct: 406 agcgtataacctccacacttgtatcccaccggacggttggcaaggttgcaacgtttgggg 347
Query: 295 atggtaatggc 305
|||||||||||
Sbjct: 346 atggtaatggc 336
>gb|AJ779760.1|AJ779760 AJ779760 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000800006G02F1, mRNA sequence
Length = 461
Score = 46.1 bits (23), Expect = 0.001
Identities = 47/55 (85%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggt 299
|||| ||||||||||| ||||| || || || |||||||| || |||||||||||
Sbjct: 356 ctccacacttgtagcccacgggacgatcagcaatgttgcatcgtttggggatggt 302
>gb|BU894885.1|BU894885 X016E01 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 612
Score = 44.1 bits (22), Expect = 0.005
Identities = 52/62 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 400 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 341
Query: 305 cg 306
||
Sbjct: 340 cg 339
>gb|CF227708.1|CF227708 PtaXM0003E9E0909 Poplar cDNA library from mature xylem Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 636
Score = 44.1 bits (22), Expect = 0.005
Identities = 52/62 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 394 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 335
Query: 305 cg 306
||
Sbjct: 334 cg 333
>gb|BU894080.1|BU894080 X001H12 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 548
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 367 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 308
Query: 305 c 305
|
Sbjct: 307 c 307
>gb|BU894322.1|BU894322 X007D04 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 551
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 350 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 291
Query: 305 c 305
|
Sbjct: 290 c 290
>gb|BU894351.1|BU894351 X007H03 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 567
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 355 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 296
Query: 305 c 305
|
Sbjct: 295 c 295
>gb|BU894604.1|BU894604 X012A07 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 563
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 388 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 329
Query: 305 c 305
|
Sbjct: 328 c 328
>gb|BU894627.1|BU894627 X012C12 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 329
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 116 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 57
Query: 305 c 305
|
Sbjct: 56 c 56
>gb|BU894718.1|BU894718 X013G08 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 607
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 394 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 335
Query: 305 c 305
|
Sbjct: 334 c 334
>gb|BU894873.1|BU894873 X016C05 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 532
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 355 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 296
Query: 305 c 305
|
Sbjct: 295 c 295
>gb|BU895138.1|BU895138 X019G06 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 602
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 390 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 331
Query: 305 c 305
|
Sbjct: 330 c 330
>gb|BU895302.1|BU895302 X022B05 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 597
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 396 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 337
Query: 305 c 305
|
Sbjct: 336 c 336
>gb|BU895579.1|BU895579 X026D03 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 487
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 393 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 334
Query: 305 c 305
|
Sbjct: 333 c 333
>gb|BU895619.1|BU895619 X028D12 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 602
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 390 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 331
Query: 305 c 305
|
Sbjct: 330 c 330
>gb|BU896165.1|BU896165 X036E12 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 550
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 379 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 320
Query: 305 c 305
|
Sbjct: 319 c 319
>gb|BU896197.1|BU896197 X037A06 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 554
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 353 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 294
Query: 305 c 305
|
Sbjct: 293 c 293
>gb|BU896219.1|BU896219 X037D08 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 579
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 378 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 319
Query: 305 c 305
|
Sbjct: 318 c 318
>gb|BU896365.1|BU896365 X039F03 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 399
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 185 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 126
Query: 305 c 305
|
Sbjct: 125 c 125
>gb|BU896834.1|BU896834 X046E09 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 538
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 351 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 292
Query: 305 c 305
|
Sbjct: 291 c 291
>gb|BU897005.1|BU897005 X049D08 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 458
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 241 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 182
Query: 305 c 305
|
Sbjct: 181 c 181
>gb|BU897023.1|BU897023 X049G05 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 514
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 391 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 332
Query: 305 c 305
|
Sbjct: 331 c 331
>gb|BU897310.1|BU897310 X054H09 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 677
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 394 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 335
Query: 305 c 305
|
Sbjct: 334 c 334
>gb|BU897726.1|BU897726 X067D01 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 388
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 166 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 107
Query: 305 c 305
|
Sbjct: 106 c 106
>gb|BU897757.1|BU897757 X067H12 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 538
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 374 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 315
Query: 305 c 305
|
Sbjct: 314 c 314
>gb|BU897958.1|BU897958 X072F01 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 562
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 352 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 293
Query: 305 c 305
|
Sbjct: 292 c 292
>gb|CF227317.1|CF227317 PtaD2B6B0604 Poplar cDNA library from wood tissues Populus alba x
Populus tremula cDNA 5', mRNA sequence
Length = 622
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 399 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 340
Query: 305 c 305
|
Sbjct: 339 c 339
>gb|CF227513.1|CF227513 PtaD6H1H0115 Poplar cDNA library from wood tissues Populus alba x
Populus tremula cDNA 5', mRNA sequence
Length = 621
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 390 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 331
Query: 305 c 305
|
Sbjct: 330 c 330
>gb|CF227825.1|CF227825 PtaXM0005B1B0103 Poplar cDNA library from mature xylem Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 605
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 390 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 331
Query: 305 c 305
|
Sbjct: 330 c 330
>gb|CF228030.1|CF228030 PtaXM0007H12H1216 Poplar cDNA library from mature xylem Populus
alba x Populus tremula cDNA 5', mRNA sequence
Length = 433
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 202 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 143
Query: 305 c 305
|
Sbjct: 142 c 142
>gb|CF228622.1|CF228622 PtaXM0015D4D0408 Poplar cDNA library from mature xylem Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 619
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 391 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 332
Query: 305 c 305
|
Sbjct: 331 c 331
>gb|CF228685.1|CF228685 PtaXM0016B2B0204 Poplar cDNA library from mature xylem Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 635
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 390 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 331
Query: 305 c 305
|
Sbjct: 330 c 330
>gb|CF228747.1|CF228747 PtaXM0016H7H0715 Poplar cDNA library from mature xylem Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 637
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 389 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 330
Query: 305 c 305
|
Sbjct: 329 c 329
>gb|CF229033.1|CF229033 PtaXM0020D12D1208 Poplar cDNA library from mature xylem Populus
alba x Populus tremula cDNA 5', mRNA sequence
Length = 607
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 395 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 336
Query: 305 c 305
|
Sbjct: 335 c 335
>gb|CF229099.1|CF229099 PtaXM0021C12C1206 Poplar cDNA library from mature xylem Populus
alba x Populus tremula cDNA 5', mRNA sequence
Length = 633
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 393 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 334
Query: 305 c 305
|
Sbjct: 333 c 333
>gb|CF229381.1|CF229381 PtaXM0024G1G0113 Poplar cDNA library from mature xylem Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 610
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 392 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 333
Query: 305 c 305
|
Sbjct: 332 c 332
>gb|CF229619.1|CF229619 PtaXM0027F1F0111 Poplar cDNA library from mature xylem Populus alba
x Populus tremula cDNA 5', mRNA sequence
Length = 611
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 393 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 334
Query: 305 c 305
|
Sbjct: 333 c 333
>gb|CF232973.1|CF232973 PtaJXO0017H5H0515 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 629
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 390 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 331
Query: 305 c 305
|
Sbjct: 330 c 330
>gb|CF233286.1|CF233286 PtaJXO0021E4E0410 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 624
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 396 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 337
Query: 305 c 305
|
Sbjct: 336 c 336
>gb|CF235816.1|CF235816 PtaJXT0027D3D0307 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 441
Score = 42.1 bits (21), Expect = 0.021
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| |||||||| || || || |||| ||| | |||||| || ||||||||||||||||
Sbjct: 392 ctccacacttgtatcccaccggacggttggcaaggttgcaacgtttggggatggtaatgg 333
Query: 305 c 305
|
Sbjct: 332 c 332
>gb|BU898049.1|BU898049 X073H09 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 511
Score = 40.1 bits (20), Expect = 0.083
Identities = 62/76 (81%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtaatgg 304
|||| ||||||||||| ||||| || || || |||||||| || ||||| ||||| || |
Sbjct: 361 ctccacacttgtagcccacgggacgatcagcaatgttgcatcgtttgggaatggtcattg 302
Query: 305 cgacctccggcttgat 320
| | |||||||||||
Sbjct: 301 caatttccggcttgat 286
>gb|BU870837.1|BU870837 Q019A05 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 522
Score = 38.2 bits (19), Expect = 0.33
Identities = 46/55 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggt 299
|||| ||||||||||| ||||| || || || |||||||| || ||||| |||||
Sbjct: 359 ctccacacttgtagcccacgggacgatcagcaatgttgcatcgtttgggaatggt 305
>gb|BU873321.1|BU873321 Q053H06 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 422
Score = 38.2 bits (19), Expect = 0.33
Identities = 46/55 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggt 299
|||| ||||||||||| ||||| || || || |||||||| || ||||| |||||
Sbjct: 357 ctccacacttgtagcccacgggacgatcagcaatgttgcatcgtttgggaatggt 303
>gb|BU873865.1|BU873865 Q060G08 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 512
Score = 38.2 bits (19), Expect = 0.33
Identities = 46/55 (83%)
Strand = Plus / Minus
Query: 245 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggt 299
|||| ||||||||||| ||||| || || || |||||||| || ||||| |||||
Sbjct: 362 ctccacacttgtagcccacgggacgatcagcaatgttgcatcgtttgggaatggt 308
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 36,377
Number of Sequences: 369679
Number of extensions: 36377
Number of successful extensions: 9800
Number of sequences better than 0.5: 104
Number of HSP's better than 0.5 without gapping: 104
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9696
Number of HSP's gapped (non-prelim): 104
length of query: 531
length of database: 203,408,664
effective HSP length: 19
effective length of query: 512
effective length of database: 196,384,763
effective search space: 100548998656
effective search space used: 100548998656
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)