BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3064721.2.1
         (689 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CV231822.1|CV231822  WS0195.B21_K18 PT-DX-N-A-10 Populus ...    46   0.002
gb|CF232874.1|CF232874  PtaJXO0016G8G0814 Poplar cDNA librar...    42   0.027
gb|CK318930.1|CK318930  X9P04h10 Populus stem seasonal libra...    42   0.027
gb|AJ778757.1|AJ778757  AJ778757 Populus euphratica cambium ...    42   0.027
gb|CV242604.1|CV242604  WS02515.B21_I09 PT-MB-N-A-15 Populus...    40   0.11 
gb|BU837261.1|BU837261  T096G03 Populus apical shoot cDNA li...    38   0.43 

>gb|CV231822.1|CV231822 WS0195.B21_K18 PT-DX-N-A-10 Populus trichocarpa cDNA clone
           WS0195_K18 3', mRNA sequence
          Length = 740

 Score = 46.1 bits (23), Expect = 0.002
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 14  tgggcatatggcatgaacatgtttgatttgtctgggtggagaaagcaaaacatcaccgag 73
           ||||||||||| |||||||| |||||||||   |  ||||  | |||||||||||| || 
Sbjct: 738 tgggcatatggaatgaacatctttgatttgaaggaatggaagaggcaaaacatcactgat 679

                                      
Query: 74  gtctaccatacctggcagaagttgaat 100
           || || ||||| ||||||||| |||||
Sbjct: 678 gtatatcatacatggcagaagctgaat 652



>gb|CF232874.1|CF232874 PtaJXO0016G8G0814 Poplar cDNA library from young opposite xylem
           Populus alba x Populus tremula cDNA 5', mRNA sequence
          Length = 758

 Score = 42.1 bits (21), Expect = 0.027
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 3   atgcttgtggttgggcatatggcatgaacatgtttga 39
           ||||||| || ||||||| || |||||||||||||||
Sbjct: 347 atgcttgcggatgggcatttgacatgaacatgtttga 383



>gb|CK318930.1|CK318930 X9P04h10 Populus stem seasonal library Populus deltoides cDNA, mRNA
           sequence
          Length = 628

 Score = 42.1 bits (21), Expect = 0.027
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 14  tgggcatatggcatgaacatgtttgattt 42
           ||||| |||||||||||||| ||||||||
Sbjct: 273 tgggcttatggcatgaacatatttgattt 301



>gb|AJ778757.1|AJ778757 AJ778757 Populus euphratica cambium 3-6 months Populus euphratica
           cDNA clone P0000600005G03F1, mRNA sequence
          Length = 435

 Score = 42.1 bits (21), Expect = 0.027
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 14  tgggcatatggcatgaacatgtttgattt 42
           ||||| |||||||||||||| ||||||||
Sbjct: 362 tgggcttatggcatgaacatatttgattt 390



>gb|CV242604.1|CV242604 WS02515.B21_I09 PT-MB-N-A-15 Populus trichocarpa cDNA clone
           WS02515_I09 3', mRNA sequence
          Length = 904

 Score = 40.1 bits (20), Expect = 0.11
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 8   tgtggttgggcatatggcatgaacatgtttgatttg 43
           ||||||||||||| ||| |||||| | |||||||||
Sbjct: 736 tgtggttgggcatttggaatgaacgtttttgatttg 701



>gb|BU837261.1|BU837261 T096G03 Populus apical shoot cDNA library Populus tremula x Populus
           tremuloides cDNA 5 prime, mRNA sequence
          Length = 632

 Score = 38.2 bits (19), Expect = 0.43
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 14  tgggcatatggcatgaacatgtttgat 40
           ||||||||||| |||||||| ||||||
Sbjct: 449 tgggcatatggaatgaacatatttgat 475



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 74,875
Number of Sequences: 369679
Number of extensions: 74875
Number of successful extensions: 18021
Number of sequences better than  0.5: 6
Number of HSP's better than  0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18013
Number of HSP's gapped (non-prelim): 8
length of query: 689
length of database: 203,408,664
effective HSP length: 19
effective length of query: 670
effective length of database: 196,384,763
effective search space: 131577791210
effective search space used: 131577791210
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)