BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2969966.2.1
(1029 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DT475076.1|DT475076 WS0125.BR_O23 PT-GT-FL-A-3 Populus t... 115 3e-024
gb|CX171881.1|CX171881 A07_69-49_01.ab1 leaf inoculated wit... 84 1e-014
gb|DT472940.1|DT472940 WS01228.BR_B04 PT-GT-FL-A-3 Populus ... 76 3e-012
gb|CA930279.1|CA930279 MTU2CA.P9.E10 Aspen apex cDNA Librar... 68 7e-010
gb|AI166599.1|AI166599 xylem.est.415 Poplar xylem Lambda ZA... 46 0.003
gb|CV232961.1|CV232961 WS0199.B21_D12 PT-DX-N-A-10 Populus ... 44 0.010
gb|CX177283.1|CX177283 B04_69-106_04.ab1 leaf inoculated wi... 44 0.010
gb|BI138876.1|BI138876 F118P18Y Populus flower cDNA library... 40 0.16
gb|BU898271.1|BU898271 X077H05 Populus wood cDNA library Po... 40 0.16
gb|CK090590.1|CK090590 F014P57.3pR Populus flower cDNA libr... 40 0.16
gb|CK090594.1|CK090594 F014P75.3pR Populus flower cDNA libr... 40 0.16
gb|CK091682.1|CK091682 F118P18.3pR Populus flower cDNA libr... 40 0.16
gb|CV271555.1|CV271555 WS0155.B21_A12 PTxN-IB-A-6 Populus t... 40 0.16
gb|CX167486.1|CX167486 E01_69-122_09.ab1 leaf inoculated wi... 40 0.16
gb|CX167501.1|CX167501 H10_69-15_16.ab1 leaf inoculated wit... 40 0.16
gb|CX167531.1|CX167531 D11_69-22_07.ab1 leaf inoculated wit... 40 0.16
gb|CX167652.1|CX167652 E02_69-57_10.ab1 leaf inoculated wit... 40 0.16
gb|CX167789.1|CX167789 G03_69-34_13.ab1 leaf inoculated wit... 40 0.16
gb|CX167801.1|CX167801 C03_69-120_05.ab1 leaf inoculated wi... 40 0.16
gb|CX168069.1|CX168069 D03_69-120_07.ab1 leaf inoculated wi... 40 0.16
gb|CX168144.1|CX168144 B07_69-121_03.ab1 leaf inoculated wi... 40 0.16
gb|CX168157.1|CX168157 D09_69-15_07.ab1 leaf inoculated wit... 40 0.16
gb|CX168247.1|CX168247 H09_69-34_15.ab1 leaf inoculated wit... 40 0.16
gb|CX168270.1|CX168270 G12_69-60_14.ab1 leaf inoculated wit... 40 0.16
gb|CX168276.1|CX168276 F07_69-15_11.ab1 leaf inoculated wit... 40 0.16
gb|CX168285.1|CX168285 F02_69-15_12.ab1 leaf inoculated wit... 40 0.16
gb|CX168386.1|CX168386 G12_69-43_14.ab1 leaf inoculated wit... 40 0.16
gb|CX168568.1|CX168568 H11_69-62_15.ab1 leaf inoculated wit... 40 0.16
gb|CX168630.1|CX168630 E08_69-81_10.ab1 leaf inoculated wit... 40 0.16
gb|CX168909.1|CX168909 H01_69-22_15.ab1 leaf inoculated wit... 40 0.16
gb|CX169024.1|CX169024 B07_69-34_03.ab1 leaf inoculated wit... 40 0.16
gb|CX169233.1|CX169233 H03_69-39_15.ab1 leaf inoculated wit... 40 0.16
gb|CX169274.1|CX169274 H09_69-42_15.ab1 leaf inoculated wit... 40 0.16
gb|CX169331.1|CX169331 D11_69-81_07.ab1 leaf inoculated wit... 40 0.16
gb|CX169543.1|CX169543 G12_69-34_14.ab1 leaf inoculated wit... 40 0.16
gb|CX169609.1|CX169609 H06_69-59_16.ab1 leaf inoculated wit... 40 0.16
gb|CX169627.1|CX169627 A12_69-34_02.ab1 leaf inoculated wit... 40 0.16
gb|CX169638.1|CX169638 E06_69-34_10.ab1 leaf inoculated wit... 40 0.16
gb|CX169742.1|CX169742 B05_69-34_03.ab1 leaf inoculated wit... 40 0.16
gb|CX169789.1|CX169789 F10_69-46_12.ab1 leaf inoculated wit... 40 0.16
gb|CX169916.1|CX169916 C10_69-58_06.ab1 leaf inoculated wit... 40 0.16
gb|CX169926.1|CX169926 H11_69-23_15.ab1 leaf inoculated wit... 40 0.16
gb|CX169937.1|CX169937 C06_69-81_06.ab1 leaf inoculated wit... 40 0.16
gb|CX170336.1|CX170336 A10_69-34_02.ab1 leaf inoculated wit... 40 0.16
gb|CX170548.1|CX170548 E10_69-36_10.ab1 leaf inoculated wit... 40 0.16
gb|CX170948.1|CX170948 C09_69-34_05.ab1 leaf inoculated wit... 40 0.16
gb|CX171048.1|CX171048 H07_69-59_15.ab1 leaf inoculated wit... 40 0.16
gb|CX171108.1|CX171108 C10_69-40_06.ab1 leaf inoculated wit... 40 0.16
gb|CX171240.1|CX171240 G04_69-23_14.ab1 leaf inoculated wit... 40 0.16
gb|CX171302.1|CX171302 E07_69-45_09.ab1 leaf inoculated wit... 40 0.16
gb|CX171358.1|CX171358 C07_69-81_05.ab1 leaf inoculated wit... 40 0.16
gb|CX171368.1|CX171368 C02_69-81_06.ab1 leaf inoculated wit... 40 0.16
gb|CX171537.1|CX171537 E10_69-57_10.ab1 leaf inoculated wit... 40 0.16
gb|CX171555.1|CX171555 F08_69-34_12.ab1 leaf inoculated wit... 40 0.16
gb|CX171609.1|CX171609 E03_69-41_09.ab1 leaf inoculated wit... 40 0.16
gb|CX171655.1|CX171655 G11_69-34_13.ab1 leaf inoculated wit... 40 0.16
gb|CX171758.1|CX171758 G12_69-33_14.ab1 leaf inoculated wit... 40 0.16
gb|CX171801.1|CX171801 H05_69-46_15.ab1 leaf inoculated wit... 40 0.16
gb|CX171865.1|CX171865 A01_69-37_01.ab1 leaf inoculated wit... 40 0.16
gb|CX172038.1|CX172038 A09_69-122_01.ab1 leaf inoculated wi... 40 0.16
gb|CX172522.1|CX172522 D06_69-81_08.ab1 leaf inoculated wit... 40 0.16
gb|CX172616.1|CX172616 G05_69-23_13.ab1 leaf inoculated wit... 40 0.16
gb|CX172797.1|CX172797 E03_69-28_09.ab1 leaf inoculated wit... 40 0.16
gb|CX172849.1|CX172849 G08_69-60_14.ab1 leaf inoculated wit... 40 0.16
gb|CX172864.1|CX172864 E03_69-15_09.ab1 leaf inoculated wit... 40 0.16
gb|CX172975.1|CX172975 H11_69-60_15.ab1 leaf inoculated wit... 40 0.16
gb|CX172977.1|CX172977 D12_69-40_08.ab1 leaf inoculated wit... 40 0.16
gb|CX173030.1|CX173030 G08_69-39_14.ab1 leaf inoculated wit... 40 0.16
gb|CX173079.1|CX173079 H11_69-116_15.ab1 leaf inoculated wi... 40 0.16
gb|CX173235.1|CX173235 D04_69-81_08.ab1 leaf inoculated wit... 40 0.16
gb|CX173397.1|CX173397 F06_69-25_12.ab1 leaf inoculated wit... 40 0.16
gb|CX173441.1|CX173441 C01_69-81_05.ab1 leaf inoculated wit... 40 0.16
gb|CX173633.1|CX173633 F07_69-34_11.ab1 leaf inoculated wit... 40 0.16
gb|CX173915.1|CX173915 B04_69-116_04.ab1 leaf inoculated wi... 40 0.16
gb|CX174048.1|CX174048 F05_69-81_11.ab1 leaf inoculated wit... 40 0.16
gb|CX174135.1|CX174135 G08_69-34_14.ab1 leaf inoculated wit... 40 0.16
gb|CX174283.1|CX174283 G09_69-60_13.ab1 leaf inoculated wit... 40 0.16
gb|CX174328.1|CX174328 F06_69-59_12.ab1 leaf inoculated wit... 40 0.16
gb|CX174395.1|CX174395 F06_69-46_12.ab1 leaf inoculated wit... 40 0.16
gb|CX174398.1|CX174398 G09_69-43_13.ab1 leaf inoculated wit... 40 0.16
gb|CX174410.1|CX174410 G04_69-43_14.ab1 leaf inoculated wit... 40 0.16
gb|CX174539.1|CX174539 H07_69-23_15.ab1 leaf inoculated wit... 40 0.16
gb|CX174558.1|CX174558 F07_69-112_11.ab1 leaf inoculated wi... 40 0.16
gb|CX174618.1|CX174618 G10_69-45_14.ab1 leaf inoculated wit... 40 0.16
gb|CX174660.1|CX174660 D05_69-81_07.ab1 leaf inoculated wit... 40 0.16
gb|CX174779.1|CX174779 F03_69-81_11.ab1 leaf inoculated wit... 40 0.16
gb|CX174863.1|CX174863 G06_69-34_14.ab1 leaf inoculated wit... 40 0.16
gb|CX175041.1|CX175041 G11_69-24_13.ab1 leaf inoculated wit... 40 0.16
gb|CX175098.1|CX175098 F03_69-34_11.ab1 leaf inoculated wit... 40 0.16
gb|CX175381.1|CX175381 E06_69-116_10.ab1 leaf inoculated wi... 40 0.16
gb|CX175553.1|CX175553 G09_69-34_13.ab1 leaf inoculated wit... 40 0.16
gb|CX175567.1|CX175567 G04_69-34_14.ab1 leaf inoculated wit... 40 0.16
gb|CX175656.1|CX175656 A09_69-34_01.ab1 leaf inoculated wit... 40 0.16
gb|CX175798.1|CX175798 G05_69-43_13.ab1 leaf inoculated wit... 40 0.16
gb|CX176029.1|CX176029 A02_69-81_02.ab1 leaf inoculated wit... 40 0.16
gb|CX176038.1|CX176038 D01_69-81_07.ab1 leaf inoculated wit... 40 0.16
gb|CX176237.1|CX176237 G07_69-34_13.ab1 leaf inoculated wit... 40 0.16
gb|CX176264.1|CX176264 G08_69-46_14.ab1 leaf inoculated wit... 40 0.16
gb|CX176275.1|CX176275 H06_69-43_16.ab1 leaf inoculated wit... 40 0.16
gb|CX176331.1|CX176331 A07_69-34_01.ab1 leaf inoculated wit... 40 0.16
gb|CX176358.1|CX176358 D07_69-46_07.ab1 leaf inoculated wit... 40 0.16
gb|CX176539.1|CX176539 B11_69-33_03.ab1 leaf inoculated wit... 40 0.16
gb|CX176624.1|CX176624 C11_69-81_05.ab1 leaf inoculated wit... 40 0.16
gb|CX176750.1|CX176750 F06_69-15_12.ab1 leaf inoculated wit... 40 0.16
gb|CX176805.1|CX176805 E04_69-57_10.ab1 leaf inoculated wit... 40 0.16
gb|CX176885.1|CX176885 G06_69-59_14.ab1 leaf inoculated wit... 40 0.16
gb|CX176903.1|CX176903 B03_69-57_03.ab1 leaf inoculated wit... 40 0.16
gb|CX176967.1|CX176967 H09_69-43_15.ab1 leaf inoculated wit... 40 0.16
gb|CX176977.1|CX176977 H04_69-43_16.ab1 leaf inoculated wit... 40 0.16
gb|CX177176.1|CX177176 H10_69-45_16.ab1 leaf inoculated wit... 40 0.16
gb|CX177289.1|CX177289 F04_69-45_12.ab1 leaf inoculated wit... 40 0.16
gb|CX177339.1|CX177339 E10_45-94_10.ab1 leaf inoculated wit... 40 0.16
gb|CX177428.1|CX177428 G12_45-96_14.ab1 leaf inoculated wit... 40 0.16
gb|CX177509.1|CX177509 A06_45-64_02.ab1 leaf inoculated wit... 40 0.16
gb|CX177743.1|CX177743 E05_45-95_09.ab1 leaf inoculated wit... 40 0.16
gb|CX177748.1|CX177748 D05_45-107_07.ab1 leaf inoculated wi... 40 0.16
gb|CX177882.1|CX177882 A07_45-56_01.ab1 leaf inoculated wit... 40 0.16
gb|CX177976.1|CX177976 C04_45-58_06.ab1 leaf inoculated wit... 40 0.16
gb|CX178289.1|CX178289 G10_45-106_14.ab1 leaf inoculated wi... 40 0.16
gb|CX178343.1|CX178343 G10_45-66_14.ab1 leaf inoculated wit... 40 0.16
gb|CX178359.1|CX178359 C06_45-105_06.ab1 leaf inoculated wi... 40 0.16
gb|CX178461.1|CX178461 E03_45-95_09.ab1 leaf inoculated wit... 40 0.16
gb|CX179191.1|CX179191 E01_45-95_09.ab1 leaf inoculated wit... 40 0.16
gb|CX179260.1|CX179260 B08_45-94_04.ab1 leaf inoculated wit... 40 0.16
gb|CX179386.1|CX179386 C11_45-94_05.ab1 leaf inoculated wit... 40 0.16
gb|CX179421.1|CX179421 C05_45-58_05.ab1 leaf inoculated wit... 40 0.16
gb|CX179436.1|CX179436 B02_45-52_04.ab1 leaf inoculated wit... 40 0.16
gb|CX179473.1|CX179473 F08_45-96_12.ab1 leaf inoculated wit... 40 0.16
gb|CX179496.1|CX179496 H06_45-107_16.ab1 leaf inoculated wi... 40 0.16
gb|CX179545.1|CX179545 B03_45-120_03.ab1 leaf inoculated wi... 40 0.16
gb|CX179615.1|CX179615 F08_45-70_12.ab1 leaf inoculated wit... 40 0.16
gb|CX179664.1|CX179664 H05_45-117_15.ab1 leaf inoculated wi... 40 0.16
gb|CX179676.1|CX179676 H04_45-69_16.ab1 leaf inoculated wit... 40 0.16
gb|CX179686.1|CX179686 H09_45-60_15.ab1 leaf inoculated wit... 40 0.16
gb|CX179801.1|CX179801 E06_45-95_10.ab1 leaf inoculated wit... 40 0.16
gb|CX179809.1|CX179809 G02_45-98_14.ab1 leaf inoculated wit... 40 0.16
gb|CX179831.1|CX179831 B09_45-56_03.ab1 leaf inoculated wit... 40 0.16
gb|CX180027.1|CX180027 H11_45-97_15.ab1 leaf inoculated wit... 40 0.16
gb|CX180214.1|CX180214 F10_45-64_12.ab1 leaf inoculated wit... 40 0.16
gb|CX180255.1|CX180255 G03_45-77_13.ab1 leaf inoculated wit... 40 0.16
gb|CX180416.1|CX180416 A02_45-124_02.ab1 leaf inoculated wi... 40 0.16
gb|CX180541.1|CX180541 B12_45-40_04.ab1 leaf inoculated wit... 40 0.16
gb|CX180623.1|CX180623 G06_45-97_14.ab1 leaf inoculated wit... 40 0.16
gb|CX180734.1|CX180734 H03_45-65_15.ab1 leaf inoculated wit... 40 0.16
gb|CX180859.1|CX180859 G01_45-94_13.ab1 leaf inoculated wit... 40 0.16
gb|CX180931.1|CX180931 D06_45-79_08.ab1 leaf inoculated wit... 40 0.16
gb|CX180955.1|CX180955 G12_45-73_14.ab1 leaf inoculated wit... 40 0.16
gb|CX180957.1|CX180957 F09_45-100_11.ab1 leaf inoculated wi... 40 0.16
gb|CX180968.1|CX180968 C02_45-124_06.ab1 leaf inoculated wi... 40 0.16
gb|CX181051.1|CX181051 C08_45-56_06.ab1 leaf inoculated wit... 40 0.16
gb|CX181108.1|CX181108 D01_45-80_07.ab1 leaf inoculated wit... 40 0.16
gb|CX181149.1|CX181149 A12_45-105_02.ab1 leaf inoculated wi... 40 0.16
gb|CX181172.1|CX181172 E06_45-56_10.ab1 leaf inoculated wit... 40 0.16
gb|CX181175.1|CX181175 F09_45-53_11.ab1 leaf inoculated wit... 40 0.16
gb|CX181382.1|CX181382 H11_45-58_15.ab1 leaf inoculated wit... 40 0.16
gb|CX181464.1|CX181464 G09_45-71_13.ab1 leaf inoculated wit... 40 0.16
gb|CX181467.1|CX181467 H02_45-77_16.ab1 leaf inoculated wit... 40 0.16
gb|CX181478.1|CX181478 B11_45-58_03.ab1 leaf inoculated wit... 40 0.16
gb|CX181487.1|CX181487 C09_45-35_05.ab1 leaf inoculated wit... 40 0.16
gb|CX181516.1|CX181516 H09_45-100_15.ab1 leaf inoculated wi... 40 0.16
gb|CX181549.1|CX181549 F01_45-97_11.ab1 leaf inoculated wit... 40 0.16
gb|CX181664.1|CX181664 D04_45-70_08.ab1 leaf inoculated wit... 40 0.16
gb|CX181745.1|CX181745 H06_45-106_16.ab1 leaf inoculated wi... 40 0.16
gb|CX181828.1|CX181828 E03_45-98_09.ab1 leaf inoculated wit... 40 0.16
gb|CX181832.1|CX181832 C02_45-95_06.ab1 leaf inoculated wit... 40 0.16
gb|CX181961.1|CX181961 F07_45-40_11.ab1 leaf inoculated wit... 40 0.16
gb|CX182029.1|CX182029 A12_45-94_02.ab1 leaf inoculated wit... 40 0.16
gb|CX182041.1|CX182041 E06_45-94_10.ab1 leaf inoculated wit... 40 0.16
gb|CX182255.1|CX182255 D05_45-105_07.ab1 leaf inoculated wi... 40 0.16
gb|CX182257.1|CX182257 H11_45-96_15.ab1 leaf inoculated wit... 40 0.16
gb|CX182370.1|CX182370 D12_45-59_08.ab1 leaf inoculated wit... 40 0.16
gb|CX182459.1|CX182459 B06_45-120_04.ab1 leaf inoculated wi... 40 0.16
gb|CX182537.1|CX182537 F04_45-107_12.ab1 leaf inoculated wi... 40 0.16
gb|CX182652.1|CX182652 F12_45-97_12.ab1 leaf inoculated wit... 40 0.16
gb|CX182673.1|CX182673 G10_45-121_14.ab1 leaf inoculated wi... 40 0.16
gb|CX182895.1|CX182895 D04_45-57_08.ab1 leaf inoculated wit... 40 0.16
gb|CX182980.1|CX182980 B02_45-119_04.ab1 leaf inoculated wi... 40 0.16
gb|CX183063.1|CX183063 B03_45-64_03.ab1 leaf inoculated wit... 40 0.16
gb|CX183089.1|CX183089 C07_45-73_05.ab1 leaf inoculated wit... 40 0.16
gb|CX183203.1|CX183203 C07_45-56_05.ab1 leaf inoculated wit... 40 0.16
gb|CX183410.1|CX183410 F03_45-40_11.ab1 leaf inoculated wit... 40 0.16
gb|CX183592.1|CX183592 H06_45-41_16.ab1 leaf inoculated wit... 40 0.16
gb|CX183721.1|CX183721 D08_45-56_08.ab1 leaf inoculated wit... 40 0.16
gb|CX183766.1|CX183766 G09_45-66_13.ab1 leaf inoculated wit... 40 0.16
gb|CX183839.1|CX183839 G04_45-53_14.ab1 leaf inoculated wit... 40 0.16
gb|CX183891.1|CX183891 E04_45-98_10.ab1 leaf inoculated wit... 40 0.16
gb|CX183894.1|CX183894 F07_45-95_11.ab1 leaf inoculated wit... 40 0.16
gb|CX183910.1|CX183910 F02_45-95_12.ab1 leaf inoculated wit... 40 0.16
gb|CX184187.1|CX184187 A11_45-94_01.ab1 leaf inoculated wit... 40 0.16
gb|CX184306.1|CX184306 A11_45-77_01.ab1 leaf inoculated wit... 40 0.16
gb|CX184414.1|CX184414 F04_45-73_12.ab1 leaf inoculated wit... 40 0.16
gb|CX184598.1|CX184598 F05_45-95_11.ab1 leaf inoculated wit... 40 0.16
gb|CX184620.1|CX184620 D12_45-58_08.ab1 leaf inoculated wit... 40 0.16
gb|CX184632.1|CX184632 A07_45-53_01.ab1 leaf inoculated wit... 40 0.16
gb|CX184677.1|CX184677 E12_45-65_10.ab1 leaf inoculated wit... 40 0.16
gb|CX184705.1|CX184705 B01_45-98_03.ab1 leaf inoculated wit... 40 0.16
gb|CX184780.1|CX184780 F05_45-106_11.ab1 leaf inoculated wi... 40 0.16
gb|CX184791.1|CX184791 B07_45-97_03.ab1 leaf inoculated wit... 40 0.16
gb|CX184942.1|CX184942 B02_45-71_04.ab1 leaf inoculated wit... 40 0.16
gb|CX185007.1|CX185007 F07_45-99_11.ab1 leaf inoculated wit... 40 0.16
gb|CX185139.1|CX185139 E01_45-124_09.ab1 leaf inoculated wi... 40 0.16
gb|CX185166.1|CX185166 F12_45-53_12.ab1 leaf inoculated wit... 40 0.16
gb|CX185345.1|CX185345 F03_45-95_11.ab1 leaf inoculated wit... 40 0.16
gb|CX185517.1|CX185517 F03_45-65_11.ab1 leaf inoculated wit... 40 0.16
gb|CX185769.1|CX185769 F10_45-70_12.ab1 leaf inoculated wit... 40 0.16
gb|CX185855.1|CX185855 B05_45-41_03.ab1 leaf inoculated wit... 40 0.16
gb|CX185865.1|CX185865 A08_45-56_02.ab1 leaf inoculated wit... 40 0.16
gb|CX186065.1|CX186065 B07_45-75_03.ab1 leaf inoculated wit... 40 0.16
gb|CX186150.1|CX186150 F03_45-107_11.ab1 leaf inoculated wi... 40 0.16
gb|CX186234.1|CX186234 H09_45-96_15.ab1 leaf inoculated wit... 40 0.16
gb|CX186312.1|CX186312 D03_45-35_07.ab1 leaf inoculated wit... 40 0.16
gb|CX186331.1|CX186331 F07_45-64_11.ab1 leaf inoculated wit... 40 0.16
gb|CX186374.1|CX186374 H09_45-70_15.ab1 leaf inoculated wit... 40 0.16
gb|CX186387.1|CX186387 B03_45-71_03.ab1 leaf inoculated wit... 40 0.16
gb|CX186662.1|CX186662 D01_45-95_07.ab1 leaf inoculated wit... 40 0.16
gb|CX186696.1|CX186696 G12_45-58_14.ab1 leaf inoculated wit... 40 0.16
gb|CX186756.1|CX186756 D10_45-100_08.ab1 leaf inoculated wi... 40 0.16
gb|CX187053.1|CX187053 D01_45-35_07.ab1 leaf inoculated wit... 40 0.16
gb|CX187164.1|CX187164 D04_45-98_08.ab1 leaf inoculated wit... 40 0.16
gb|CX187175.1|CX187175 F12_45-95_12.ab1 leaf inoculated wit... 40 0.16
gb|CX187233.1|CX187233 E03_45-113_09.ab1 leaf inoculated wi... 40 0.16
gb|CX187239.1|CX187239 B10_45-117_04.ab1 leaf inoculated wi... 40 0.16
gb|CX187270.1|CX187270 F11_45-66_11.ab1 leaf inoculated wit... 40 0.16
gb|CX187387.1|CX187387 C01_45-98_05.ab1 leaf inoculated wit... 40 0.16
gb|CX187479.1|CX187479 G05_45-65_13.ab1 leaf inoculated wit... 40 0.16
gb|CX187484.1|CX187484 C02_45-97_06.ab1 leaf inoculated wit... 40 0.16
gb|BP934460.1|BP934460 BP934460 full-length enriched poplar... 40 0.16
gb|DT482117.1|DT482117 WS02533.BR_P08 PT-MB-N-A-15 Populus ... 40 0.16
>gb|DT475076.1|DT475076 WS0125.BR_O23 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0125_O23 5', mRNA sequence
Length = 578
Score = 115 bits (58), Expect = 3e-024
Identities = 154/186 (82%)
Strand = Plus / Plus
Query: 206 tgctgctgcaacaaacagccgcttcacaattttctataatcctagggcaagtccaacaga 265
|||||||||||| || ||| | || ||| | |||||||| || ||||| |||||| | ||
Sbjct: 2 tgctgctgcaactaatagctgttttacagtgttctataacccaagggctagtccatctga 61
Query: 266 atttgttatacccctttcgaaatacatcaaggctgtttttcacacgcggatatcagttgg 325
||||||||||| || || |||||||| || || || |||||||| || || ||||||||
Sbjct: 62 gtttgttatacctctatccaaatacattaaagcagtatttcacacacgcatttcagttgg 121
Query: 326 gatgcgattcaggatgttatttgagactgaggaatcaagtgtccgcaggtacatggggac 385
||||| ||| ||||| | ||||||||||| |||||||||||||| ||||||||||| ||
Sbjct: 122 aatgcgcttccggatgctttttgagactgaagaatcaagtgtccgtaggtacatgggtac 181
Query: 386 aataac 391
|||||
Sbjct: 182 gataac 187
>gb|CX171881.1|CX171881 A07_69-49_01.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 756
Score = 83.8 bits (42), Expect = 1e-014
Identities = 186/234 (79%)
Strand = Plus / Plus
Query: 35 gtttgtcagtgctaagagacttgttgctggagattctgtgctattcatatggaatgagaa 94
|||||| |||||||| |||||| ||||||| ||||| ||||| ||||| |||||||| ||
Sbjct: 10 gtttgtgagtgctaaaagacttattgctggggattcagtgcttttcatctggaatgaaaa 69
Query: 95 aaaccagcttttgcttggaatcagacacgctacccggccacagactgtgatgccctcttc 154
|| ||||| | ||||| || | | ||||| || || || ||||||||||| || ||
Sbjct: 70 gaatcagctactacttggcattaagcgtgctactcgacctcaaactgtgatgccttcatc 129
Query: 155 tgttctttcgagtgacagcatgcacatcggactccttgcagcagcagctcatgctgctgc 214
|| | || || || ||||||||| | || || ||||| || ||||||||||| |||||
Sbjct: 130 agtcttatctagcgatagcatgcacttgggccttcttgctgctgcagctcatgcagctgc 189
Query: 215 aacaaacagccgcttcacaattttctataatcctagggcaagtccaacagaatt 268
|||||| ||||| || ||||| || || ||||| ||||| |||||| |||||||
Sbjct: 190 aacaaatagccgttttacaatattttacaatccaagggctagtccatcagaatt 243
Score = 65.9 bits (33), Expect = 3e-009
Identities = 84/101 (83%)
Strand = Plus / Plus
Query: 441 tcagtgaaggttggttgggatgaatcaaccgcaggagaaaggccacctagagtttctctg 500
||||| |||||||| |||||||| || || || || || |||| ||| |||||||||||
Sbjct: 416 tcagtcaaggttggctgggatgagtctacagctggggagaggcaaccaagagtttctcta 475
Query: 501 tgggaaattgagccactgacaacctttcctatgtatccatc 541
||||| ||||| ||||| ||||| || || |||||||||||
Sbjct: 476 tgggagattgaaccactaacaactttcccaatgtatccatc 516
Score = 54.0 bits (27), Expect = 1e-005
Identities = 60/71 (84%)
Strand = Plus / Plus
Query: 321 gttgggatgcgattcaggatgttatttgagactgaggaatcaagtgtccgcaggtacatg 380
||||| ||||| || |||||| | ||||| ||||| |||||||||||||| ||||||||
Sbjct: 296 gttggcatgcgctttaggatgctgtttgaaactgaagaatcaagtgtccgtcggtacatg 355
Query: 381 gggacaataac 391
|| || |||||
Sbjct: 356 ggtacgataac 366
>gb|DT472940.1|DT472940 WS01228.BR_B04 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01228_B04 5', mRNA sequence
Length = 914
Score = 75.8 bits (38), Expect = 3e-012
Identities = 65/74 (87%)
Strand = Plus / Plus
Query: 27 tggagtgtgtttgtcagtgctaagagacttgttgctggagattctgtgctattcatatgg 86
|||||||| ||||| ||||| ||||| ||||||||||| |||||||| || ||||| |||
Sbjct: 612 tggagtgtctttgttagtgcaaagaggcttgttgctggtgattctgtccttttcatttgg 671
Query: 87 aatgagaaaaacca 100
|||||||| |||||
Sbjct: 672 aatgagaagaacca 685
Score = 48.1 bits (24), Expect = 7e-004
Identities = 93/116 (80%)
Strand = Plus / Plus
Query: 165 agtgacagcatgcacatcggactccttgcagcagcagctcatgctgctgcaacaaacagc 224
||||| |||||||| || || || ||||| || ||||||||||| || || || || |||
Sbjct: 750 agtgatagcatgcatataggtcttcttgctgctgcagctcatgcagcagccactaatagc 809
Query: 225 cgcttcacaattttctataatcctagggcaagtccaacagaatttgttatacccct 280
|| || ||||| || ||||| || ||||| ||||| |||||||||| || |||||
Sbjct: 810 cgttttacaatattttataaccccagggctagtccttcagaatttgtcattcccct 865
>gb|CA930279.1|CA930279 MTU2CA.P9.E10 Aspen apex cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 582
Score = 67.9 bits (34), Expect = 7e-010
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 27 tggagtgtgtttgtcagtgctaagagacttgttgctggagattctgtgctattcatatgg 86
|||||||| ||||| ||||| ||||| ||||||||||| |||||||| || ||||| |||
Sbjct: 354 tggagtgtctttgttagtgcaaagaggcttgttgctggtgattctgtcctcttcatttgg 295
Query: 87 aatgagaaaaacca 100
|| ||||| |||||
Sbjct: 294 aacgagaagaacca 281
Score = 48.1 bits (24), Expect = 7e-004
Identities = 93/116 (80%)
Strand = Plus / Minus
Query: 165 agtgacagcatgcacatcggactccttgcagcagcagctcatgctgctgcaacaaacagc 224
||||| |||||||| || || || ||||| || ||||||||||| || || || || |||
Sbjct: 216 agtgatagcatgcatataggtcttcttgctgctgcagctcatgcagcagccactaatagc 157
Query: 225 cgcttcacaattttctataatcctagggcaagtccaacagaatttgttatacccct 280
|| || ||||| || ||||| || ||||| ||||| |||||||||| || |||||
Sbjct: 156 cgttttacaatattttataaccccagggctagtccttcagaatttgtcatccccct 101
Score = 44.1 bits (22), Expect = 0.010
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 331 gattcaggatgttatttgagactgaggaatcaagtgtccgcaggtacatg 380
|||| |||||| |||||||||| || || |||||||||||| | ||||||
Sbjct: 50 gatttaggatgctatttgagacagaagagtcaagtgtccgccgatacatg 1
>gb|AI166599.1|AI166599 xylem.est.415 Poplar xylem Lambda ZAPII library Populus trichocarpa
cDNA 5', mRNA sequence
Length = 520
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 171 agcatgcacatcggactccttgcagcagcagctcatgctgctg 213
||||||||||| || ||||||| || ||||||||||||||||
Sbjct: 371 agcatgcacattggtgtccttgctgctgcagctcatgctgctg 413
>gb|CV232961.1|CV232961 WS0199.B21_D12 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS0199_D12 3', mRNA sequence
Length = 649
Score = 44.1 bits (22), Expect = 0.010
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 855 ctgttgcagcaacaaatactacagca 880
|||||||||||||||||| |||||||
Sbjct: 456 ctgttgcagcaacaaatattacagca 481
>gb|CX177283.1|CX177283 B04_69-106_04.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 588
Score = 44.1 bits (22), Expect = 0.010
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 448 aggttggttgggatgaatcaac 469
||||||||||||||||||||||
Sbjct: 148 aggttggttgggatgaatcaac 169
>gb|BI138876.1|BI138876 F118P18Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 289
Score = 40.1 bits (20), Expect = 0.16
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 171 agcatgcacatcggactccttgcagcagcagctcatgctgctgc 214
||||||||||| || ||||||| || |||||||||||| ||||
Sbjct: 236 agcatgcacattggtgtccttgctgctgcagctcatgctactgc 193
>gb|BU898271.1|BU898271 X077H05 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 644
Score = 40.1 bits (20), Expect = 0.16
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 857 gttgcagcaacaaatactacagca 880
|||||||||||||||| |||||||
Sbjct: 256 gttgcagcaacaaatattacagca 233
>gb|CK090590.1|CK090590 F014P57.3pR Populus flower cDNA library Populus trichocarpa cDNA
clone F014P57 3', mRNA sequence
Length = 817
Score = 40.1 bits (20), Expect = 0.16
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 171 agcatgcacatcggactccttgcagcagcagctcatgctgctgc 214
||||||||||| || ||||||| || |||||||||||| ||||
Sbjct: 720 agcatgcacatgggtgtccttgctgctgcagctcatgctactgc 763
>gb|CK090594.1|CK090594 F014P75.3pR Populus flower cDNA library Populus trichocarpa cDNA
clone F014P75 3', mRNA sequence
Length = 806
Score = 40.1 bits (20), Expect = 0.16
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 171 agcatgcacatcggactccttgcagcagcagctcatgctgctgc 214
||||||||||| || ||||||| || |||||||||||| ||||
Sbjct: 720 agcatgcacattggtgtccttgctgctgcagctcatgctactgc 763
>gb|CK091682.1|CK091682 F118P18.3pR Populus flower cDNA library Populus trichocarpa cDNA
clone F118P18 3', mRNA sequence
Length = 828
Score = 40.1 bits (20), Expect = 0.16
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 171 agcatgcacatcggactccttgcagcagcagctcatgctgctgc 214
||||||||||| || ||||||| || |||||||||||| ||||
Sbjct: 720 agcatgcacattggtgtccttgctgctgcagctcatgctactgc 763
>gb|CV271555.1|CV271555 WS0155.B21_A12 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0155_A12 3', mRNA sequence
Length = 934
Score = 40.1 bits (20), Expect = 0.16
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 857 gttgcagcaacaaatactacagca 880
|||||||||||||||| |||||||
Sbjct: 419 gttgcagcaacaaatattacagca 442
>gb|CX167486.1|CX167486 E01_69-122_09.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 684
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX167501.1|CX167501 H10_69-15_16.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 691
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 4 tccaaagaattcggcacgac 23
>gb|CX167531.1|CX167531 D11_69-22_07.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 673
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 7 tccaaagaattcggcacgac 26
>gb|CX167652.1|CX167652 E02_69-57_10.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 714
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX167789.1|CX167789 G03_69-34_13.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 677
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX167801.1|CX167801 C03_69-120_05.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 725
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168069.1|CX168069 D03_69-120_07.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 712
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168144.1|CX168144 B07_69-121_03.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 668
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168157.1|CX168157 D09_69-15_07.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 681
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168247.1|CX168247 H09_69-34_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 649
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168270.1|CX168270 G12_69-60_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 506
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168276.1|CX168276 F07_69-15_11.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 673
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168285.1|CX168285 F02_69-15_12.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 662
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168386.1|CX168386 G12_69-43_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 655
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 7 tccaaagaattcggcacgac 26
>gb|CX168568.1|CX168568 H11_69-62_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 684
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168630.1|CX168630 E08_69-81_10.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 570
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX168909.1|CX168909 H01_69-22_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 640
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX169024.1|CX169024 B07_69-34_03.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 686
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX169233.1|CX169233 H03_69-39_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 652
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 5 tccaaagaattcggcacgac 24
>gb|CX169274.1|CX169274 H09_69-42_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 436
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 2 tccaaagaattcggcacgac 21
>gb|CX169331.1|CX169331 D11_69-81_07.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 652
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX169543.1|CX169543 G12_69-34_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 612
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX169609.1|CX169609 H06_69-59_16.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 733
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 7 tccaaagaattcggcacgac 26
>gb|CX169627.1|CX169627 A12_69-34_02.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 622
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX169638.1|CX169638 E06_69-34_10.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 675
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX169742.1|CX169742 B05_69-34_03.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 660
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX169789.1|CX169789 F10_69-46_12.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 603
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX169916.1|CX169916 C10_69-58_06.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 760
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 7 tccaaagaattcggcacgac 26
>gb|CX169926.1|CX169926 H11_69-23_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 617
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 5 tccaaagaattcggcacgac 24
>gb|CX169937.1|CX169937 C06_69-81_06.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 607
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX170336.1|CX170336 A10_69-34_02.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 616
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX170548.1|CX170548 E10_69-36_10.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 663
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX170948.1|CX170948 C09_69-34_05.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 691
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX171048.1|CX171048 H07_69-59_15.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 684
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
>gb|CX171108.1|CX171108 C10_69-40_06.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 661
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 5 tccaaagaattcggcacgac 24
>gb|CX171240.1|CX171240 G04_69-23_14.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 657
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 7 tccaaagaattcggcacgac 26
>gb|CX171302.1|CX171302 E07_69-45_09.ab1 leaf inoculated with Marssonia pathogen of
Populus deltoides Populus deltoides cDNA, mRNA sequence
Length = 663
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 tccaaagaattcggcacgac 20
||||||||||||||||||||
Sbjct: 8 tccaaagaattcggcacgac 27
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 159,325
Number of Sequences: 369679
Number of extensions: 159325
Number of successful extensions: 50072
Number of sequences better than 0.5: 228
Number of HSP's better than 0.5 without gapping: 228
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49755
Number of HSP's gapped (non-prelim): 317
length of query: 1029
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1010
effective length of database: 196,384,763
effective search space: 198348610630
effective search space used: 198348610630
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)