BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2623051.2.1
(991 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DT507408.1|DT507408 WS02418.BR_C22 PTxD-ICC-N-A-14 Popul... 56 3e-006
gb|DT518344.1|DT518344 WS02436.B21_O04 PTxD-ICC-N-A-14 Popu... 56 3e-006
gb|BI127953.1|BI127953 G068P72Y Populus cambium cDNA librar... 48 6e-004
gb|BU893054.1|BU893054 P072F11 Populus petioles cDNA librar... 46 0.003
gb|DN486904.1|DN486904 P072F11.3pR Populus petioles cDNA li... 46 0.003
gb|DN496497.1|DN496497 P072F11.5pR Populus petioles cDNA li... 46 0.003
gb|CV240143.1|CV240143 WS0234.B21_I16 PT-MB-A-13 Populus tr... 44 0.010
gb|CV241855.1|CV241855 WS02513.B21_G24 PT-MB-N-A-15 Populus... 44 0.010
gb|CV259570.1|CV259570 WS02011.B21_L08 PTxN-IB-N-A-11 Popul... 44 0.010
gb|CV265341.1|CV265341 WS02026.B21_P19 PTxN-IB-N-A-11 Popul... 44 0.010
gb|CA924745.1|CA924745 MTU7CL.P9.E07 Aspen leaf cDNA Librar... 42 0.040
gb|AJ777428.1|AJ777428 AJ777428 Populus euphratica root 3-6... 42 0.040
gb|CX179664.1|CX179664 H05_45-117_15.ab1 leaf inoculated wi... 42 0.040
gb|BI138306.1|BI138306 F103P22Y Populus flower cDNA library... 40 0.16
gb|BU827173.1|BU827173 UK129TC12 Populus apical shoot cDNA ... 40 0.16
gb|AJ772850.1|AJ772850 AJ772850 Populus euphratica leaf 3-6... 40 0.16
gb|AJ779407.1|AJ779407 AJ779407 Populus euphratica root 3-6... 40 0.16
gb|CV264212.1|CV264212 WS02023.B21_O18 PTxN-IB-N-A-11 Popul... 40 0.16
gb|DT488603.1|DT488603 WS02536.B21_O08 PT-MB-N-A-15 Populus... 40 0.16
>gb|DT507408.1|DT507408 WS02418.BR_C22 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02418_C22 5', mRNA sequence
Length = 828
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Minus
Query: 563 tcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttcactcgcgtg 622
||||| |||||||| ||||| || |||||| |||| ||||| || |||| ||| | ||
Sbjct: 464 tcagatgacatgatgaccacaggtatgtccctgagagatgacgattcctttactttcttg 405
Query: 623 agcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgagactcac 678
|||| ||| || ||||||||||||||||| ||||| || || ||||| ||| ||||
Sbjct: 404 agcaaatcatagcctgtcatgccgggcatacagtaatctgtaatgataagattcac 349
>gb|DT518344.1|DT518344 WS02436.B21_O04 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02436_O04 3', mRNA sequence
Length = 831
Score = 56.0 bits (28), Expect = 3e-006
Identities = 94/116 (81%)
Strand = Plus / Plus
Query: 563 tcagacgacatgatcaccaccggaatgtccgtgagcgatgaggaccccttcactcgcgtg 622
||||| |||||||| ||||| || |||||| |||| ||||| || |||| ||| | ||
Sbjct: 526 tcagatgacatgatgaccacaggtatgtccctgagagatgacgattcctttactttcttg 585
Query: 623 agcagatcgtatcctgtcatgccgggcatgcagtagtcagtgatgatgagactcac 678
|||| ||| || ||||||||||||||||| ||||| || || ||||| ||| ||||
Sbjct: 586 agcaaatcatagcctgtcatgccgggcatacagtaatctgtaatgataagattcac 641
>gb|BI127953.1|BI127953 G068P72Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 476
Score = 48.1 bits (24), Expect = 6e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 632 tatcctgtcatgccgggcatgcagtagtcagt 663
||||||||||| || |||||||||||||||||
Sbjct: 381 tatcctgtcattccaggcatgcagtagtcagt 350
>gb|BU893054.1|BU893054 P072F11 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 656
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagt 663
||||||| || ||||||||||| || ||||| |||||||||||
Sbjct: 273 tgagcagctcatatcctgtcattccaggcatacagtagtcagt 231
>gb|DN486904.1|DN486904 P072F11.3pR Populus petioles cDNA library Populus tremula cDNA
clone P072F11 3', mRNA sequence
Length = 587
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagt 663
||||||| || ||||||||||| || ||||| |||||||||||
Sbjct: 470 tgagcagctcatatcctgtcattccaggcatacagtagtcagt 512
>gb|DN496497.1|DN496497 P072F11.5pR Populus petioles cDNA library Populus tremula cDNA
clone P072F11 5', mRNA sequence
Length = 317
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagtagtcagt 663
||||||| || ||||||||||| || ||||| |||||||||||
Sbjct: 230 tgagcagctcatatcctgtcattccaggcatacagtagtcagt 188
>gb|CV240143.1|CV240143 WS0234.B21_I16 PT-MB-A-13 Populus trichocarpa cDNA clone WS0234_I16
3', mRNA sequence
Length = 653
Score = 44.1 bits (22), Expect = 0.010
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 704 gacgacgacgaagatgaggaggagga 729
|||||||||||||| |||||||||||
Sbjct: 482 gacgacgacgaagacgaggaggagga 457
>gb|CV241855.1|CV241855 WS02513.B21_G24 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02513_G24 3', mRNA sequence
Length = 690
Score = 44.1 bits (22), Expect = 0.010
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 704 gacgacgacgaagatgaggaggagga 729
|||||||||||||| |||||||||||
Sbjct: 484 gacgacgacgaagacgaggaggagga 459
>gb|CV259570.1|CV259570 WS02011.B21_L08 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02011_L08 3', mRNA sequence
Length = 395
Score = 44.1 bits (22), Expect = 0.010
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 704 gacgacgacgaagatgaggaggagga 729
|||||||||||||| |||||||||||
Sbjct: 215 gacgacgacgaagaagaggaggagga 190
>gb|CV265341.1|CV265341 WS02026.B21_P19 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02026_P19 3', mRNA sequence
Length = 395
Score = 44.1 bits (22), Expect = 0.010
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 704 gacgacgacgaagatgaggaggagga 729
|||||||||||||| |||||||||||
Sbjct: 215 gacgacgacgaagaagaggaggagga 190
>gb|CA924745.1|CA924745 MTU7CL.P9.E07 Aspen leaf cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 687
Score = 42.1 bits (21), Expect = 0.040
Identities = 30/33 (90%)
Strand = Plus / Minus
Query: 700 ggaggacgacgacgaagatgaggaggaggatga 732
|||||| ||||| |||||||||||||| |||||
Sbjct: 176 ggaggaagacgatgaagatgaggaggaagatga 144
>gb|AJ777428.1|AJ777428 AJ777428 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400028B04F1, mRNA sequence
Length = 655
Score = 42.1 bits (21), Expect = 0.040
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 621 tgagcagatcgtatcctgtcatgccgggcatgcagta 657
|||||||||| || ||||||||||| ||||| |||||
Sbjct: 487 tgagcagatcatagcctgtcatgccaggcatacagta 451
>gb|CX179664.1|CX179664 H05_45-117_15.ab1 leaf inoculated with Marssonia pathogen of
Populus euramericana Populus x canadensis cDNA, mRNA
sequence
Length = 684
Score = 42.1 bits (21), Expect = 0.040
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 971 gaatgtggcgtcgtgccgaat 991
|||||||||||||||||||||
Sbjct: 36 gaatgtggcgtcgtgccgaat 16
>gb|BI138306.1|BI138306 F103P22Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 248
Score = 40.1 bits (20), Expect = 0.16
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 703 ggacgacgacgaagatgaggagga 726
|||||||||||||||||| |||||
Sbjct: 225 ggacgacgacgaagatgaagagga 248
>gb|BU827173.1|BU827173 UK129TC12 Populus apical shoot cDNA library Populus tremula x
Populus tremuloides cDNA 5 prime, mRNA sequence
Length = 573
Score = 40.1 bits (20), Expect = 0.16
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 632 tatcctgtcatgccgggcatgcagtagtcagt 663
||||||||||| || ||||| |||||||||||
Sbjct: 573 tatcctgtcattccaggcatacagtagtcagt 542
>gb|AJ772850.1|AJ772850 AJ772850 Populus euphratica leaf 3-6 months Populus euphratica cDNA
clone P0000200001C12F1, mRNA sequence
Length = 628
Score = 40.1 bits (20), Expect = 0.16
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 704 gacgacgacgaagatgaggaggaggatg 731
||||||||||| ||||| ||||||||||
Sbjct: 383 gacgacgacgaggatgaagaggaggatg 410
>gb|AJ779407.1|AJ779407 AJ779407 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000800002D05F1, mRNA sequence
Length = 628
Score = 40.1 bits (20), Expect = 0.16
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 626 agatcgtatcctgtcatgccgggcatgcagta 657
|||||||| |||||||| || |||||||||||
Sbjct: 366 agatcgtagcctgtcattcctggcatgcagta 335
>gb|CV264212.1|CV264212 WS02023.B21_O18 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02023_O18 3', mRNA sequence
Length = 802
Score = 40.1 bits (20), Expect = 0.16
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 706 cgacgacgaagatgaggaggagga 729
|||||||||||| |||||||||||
Sbjct: 1 cgacgacgaagaagaggaggagga 24
>gb|DT488603.1|DT488603 WS02536.B21_O08 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02536_O08 3', mRNA sequence
Length = 855
Score = 40.1 bits (20), Expect = 0.16
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 632 tatcctgtcatgccgggcatgcagtagtcagt 663
||||||||||| || ||||| |||||||||||
Sbjct: 549 tatcctgtcattccaggcatacagtagtcagt 580
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 121,674
Number of Sequences: 369679
Number of extensions: 121674
Number of successful extensions: 29276
Number of sequences better than 0.5: 19
Number of HSP's better than 0.5 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29242
Number of HSP's gapped (non-prelim): 34
length of query: 991
length of database: 203,408,664
effective HSP length: 19
effective length of query: 972
effective length of database: 196,384,763
effective search space: 190885989636
effective search space used: 190885989636
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)