BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2619423.2.1
(886 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CV226722.1|CV226722 WS0165.B21_B13 PT-DX-A-7 Populus tri... 40 0.14
gb|CV228445.1|CV228445 WS01910.B21_C07 PT-DX-N-A-10 Populus... 40 0.14
gb|CV229096.1|CV229096 WS01912.B21_D11 PT-DX-N-A-10 Populus... 40 0.14
gb|CV232764.1|CV232764 WS0198.B21_J13 PT-DX-N-A-10 Populus ... 40 0.14
gb|BP930386.1|BP930386 BP930386 full-length enriched poplar... 40 0.14
gb|DT477959.1|DT477959 WS02521.BR_H11 PT-MB-N-A-15 Populus ... 40 0.14
gb|DT478365.1|DT478365 WS02522.BR_J09 PT-MB-N-A-15 Populus ... 40 0.14
gb|DT482206.1|DT482206 WS02519.B21_D02 PT-MB-N-A-15 Populus... 40 0.14
gb|DT497461.1|DT497461 WS01126.BR_I18 PT-P-FL-A-2 Populus t... 40 0.14
gb|DT516609.1|DT516609 WS02431.B21_O10 PTxD-ICC-N-A-14 Popu... 40 0.14
>gb|CV226722.1|CV226722 WS0165.B21_B13 PT-DX-A-7 Populus trichocarpa cDNA clone WS0165_B13
3', mRNA sequence
Length = 948
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Plus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 294 tactttggcaatgtaatctttacagcaacaccaattgctg 333
>gb|CV228445.1|CV228445 WS01910.B21_C07 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01910_C07 3', mRNA sequence
Length = 791
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 719 tactttggcaatgtgatctttacagcaacaccaattgctg 680
>gb|CV229096.1|CV229096 WS01912.B21_D11 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01912_D11 3', mRNA sequence
Length = 750
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 735 tactttggcaatgtgatctttacagcaacaccaattgctg 696
>gb|CV232764.1|CV232764 WS0198.B21_J13 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS0198_J13 3', mRNA sequence
Length = 725
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 712 tactttggcaatgtgatctttacagcaacaccaattgctg 673
>gb|BP930386.1|BP930386 BP930386 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-009_E13.r 3', mRNA sequence
Length = 615
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 512 tactttggcaatgtaatctttacagcaacaccaattgctg 473
>gb|DT477959.1|DT477959 WS02521.BR_H11 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02521_H11 5', mRNA sequence
Length = 848
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 722 tactttggcaatgtaatctttacagcaacaccaattgctg 683
>gb|DT478365.1|DT478365 WS02522.BR_J09 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02522_J09 5', mRNA sequence
Length = 870
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Plus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 326 tactttggcaatgtaatctttacagcaacaccaattgctg 365
>gb|DT482206.1|DT482206 WS02519.B21_D02 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02519_D02 3', mRNA sequence
Length = 840
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 768 tactttggcaatgtgatctttacagcaacaccaattgctg 729
>gb|DT497461.1|DT497461 WS01126.BR_I18 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01126_I18 5', mRNA sequence
Length = 941
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Plus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 433 tactttggcaatgtaatctttacagcaacaccaattgctg 472
>gb|DT516609.1|DT516609 WS02431.B21_O10 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02431_O10 3', mRNA sequence
Length = 926
Score = 40.1 bits (20), Expect = 0.14
Identities = 35/40 (87%)
Strand = Plus / Minus
Query: 149 tactttggcaatgtcatcttcaccgcgacaccacttgctg 188
|||||||||||||| ||||| || || |||||| ||||||
Sbjct: 761 tactttggcaatgtgatctttacagcaacaccaattgctg 722
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 91,268
Number of Sequences: 369679
Number of extensions: 91268
Number of successful extensions: 25581
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25562
Number of HSP's gapped (non-prelim): 19
length of query: 886
length of database: 203,408,664
effective HSP length: 19
effective length of query: 867
effective length of database: 196,384,763
effective search space: 170265589521
effective search space used: 170265589521
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)