BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2493944.2.1
(2055 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU879414.1|BU879414 V059H01 Populus flower cDNA library ... 103 3e-020
gb|AY391776.1| Populus alba x Populus tremula putative inve... 70 4e-010
gb|BU820388.1|BU820388 UA54DPF07 Populus tremula cambium cD... 66 6e-009
gb|BU869595.1|BU869595 Q001H02 Populus flower cDNA library ... 66 6e-009
gb|BU871633.1|BU871633 Q032F11 Populus flower cDNA library ... 66 6e-009
gb|CK106113.1|CK106113 UA54DPF07.5pR Populus dormant cambiu... 62 9e-008
gb|DT500159.1|DT500159 PX0011.BR_G11 PT-X-FL-A-1 Populus tr... 58 1e-006
gb|AY190017.1| Populus tomentosa cell-wall invertase gene, ... 54 2e-005
gb|CX168427.1|CX168427 B06_69-85_04.ab1 leaf inoculated wit... 50 3e-004
gb|CX169703.1|CX169703 E01_69-117_09.ab1 leaf inoculated wi... 50 3e-004
gb|CA925615.1|CA925615 MTU7TL.P3.G07 Aspen leaf cDNA Librar... 46 0.005
gb|CX654517.1|CX654517 PO02011E09 Poplar SC cDNA library Po... 44 0.021
gb|DT514871.1|DT514871 WS02426.B21_A05 PTxD-ICC-N-A-14 Popu... 44 0.021
gb|DT516146.1|DT516146 WS02430.B21_I16 PTxD-ICC-N-A-14 Popu... 44 0.021
gb|DT517940.1|DT517940 WS02435.B21_L21 PTxD-ICC-N-A-14 Popu... 44 0.021
gb|CA925485.1|CA925485 MTU7TL.P1.H09 Aspen leaf cDNA Librar... 42 0.083
gb|CA933578.1|CA933578 MTU5CS.P9.G08 Aspen stem cDNA Librar... 42 0.083
>gb|BU879414.1|BU879414 V059H01 Populus flower cDNA library Populus trichocarpa cDNA 5 prime,
mRNA sequence
Length = 600
Score = 103 bits (52), Expect = 3e-020
Identities = 109/128 (85%)
Strand = Plus / Minus
Query: 1715 gcccacacgatgttgccccatacggcgcccttgggattgtattggtagaagaaatggtac 1774
||||| || ||||||||||| ||||| || |||||||||||||||||||| | ||||||
Sbjct: 368 gcccagacaatgttgccccacacggcacctttgggattgtattggtagaatagatggtat 309
Query: 1775 caccccttgtagtacatgggcgcgttgggatcattgatccagttcttggggggctggaag 1834
|||||||||||||| ||| | || ||||| |||||||||||||| || |||||||||
Sbjct: 308 agccccttgtagtacaaaggcccatttggatcgttgatccagttcttaggaggctggaag 249
Query: 1835 tggtaccc 1842
|| |||||
Sbjct: 248 tgataccc 241
>gb|AY391776.1| Populus alba x Populus tremula putative invertase mRNA, partial cds
Length = 326
Score = 69.9 bits (35), Expect = 4e-010
Identities = 86/103 (83%)
Strand = Plus / Minus
Query: 1715 gcccacacgatgttgccccatacggcgcccttgggattgtattggtagaagaaatggtac 1774
||||| || ||||||||||| ||||| || ||||||||||| |||||||| | ||||||
Sbjct: 104 gcccagacaatgttgccccacacggcacctttgggattgtactggtagaacagatggtat 45
Query: 1775 caccccttgtagtacatgggcgcgttgggatcattgatccagt 1817
|||||||||||||| ||| | || ||||| ||||||||||
Sbjct: 44 agccccttgtagtacaaaggcccatttggatcgttgatccagt 2
>gb|BU820388.1|BU820388 UA54DPF07 Populus tremula cambium cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 562
Score = 65.9 bits (33), Expect = 6e-009
Identities = 87/105 (82%)
Strand = Plus / Minus
Query: 1715 gcccacacgatgttgccccatacggcgcccttgggattgtattggtagaagaaatggtac 1774
||||| || ||||| ||||| || || || ||||| |||||||||||||| | ||||||
Sbjct: 342 gcccaaacaatgttaccccacactgcacctttggggttgtattggtagaatagatggtag 283
Query: 1775 caccccttgtagtacatgggcgcgttgggatcattgatccagttc 1819
||||||||||||||| || || || ||||| ||||||||||||
Sbjct: 282 agccccttgtagtacataggtgcatttggatcgttgatccagttc 238
>gb|BU869595.1|BU869595 Q001H02 Populus flower cDNA library Populus trichocarpa cDNA 5 prime,
mRNA sequence
Length = 608
Score = 65.9 bits (33), Expect = 6e-009
Identities = 87/105 (82%)
Strand = Plus / Minus
Query: 1715 gcccacacgatgttgccccatacggcgcccttgggattgtattggtagaagaaatggtac 1774
||||| || ||||| ||||| || || || ||||| |||||||||||||| | ||||||
Sbjct: 342 gcccaaacaatgttaccccacactgcacctttggggttgtattggtagaatagatggtag 283
Query: 1775 caccccttgtagtacatgggcgcgttgggatcattgatccagttc 1819
||||||||||||||| || || || ||||| ||||||||||||
Sbjct: 282 agccccttgtagtacataggtgcatttggatcgttgatccagttc 238
>gb|BU871633.1|BU871633 Q032F11 Populus flower cDNA library Populus trichocarpa cDNA 5 prime,
mRNA sequence
Length = 589
Score = 65.9 bits (33), Expect = 6e-009
Identities = 87/105 (82%)
Strand = Plus / Minus
Query: 1715 gcccacacgatgttgccccatacggcgcccttgggattgtattggtagaagaaatggtac 1774
||||| || ||||| ||||| || || || ||||| |||||||||||||| | ||||||
Sbjct: 342 gcccaaacaatgttaccccacactgcacctttggggttgtattggtagaatagatggtag 283
Query: 1775 caccccttgtagtacatgggcgcgttgggatcattgatccagttc 1819
||||||||||||||| || || || ||||| ||||||||||||
Sbjct: 282 agccccttgtagtacataggtgcatttggatcgttgatccagttc 238
>gb|CK106113.1|CK106113 UA54DPF07.5pR Populus dormant cambium cDNA library Populus tremula
cDNA clone UA54DPF07 5', mRNA sequence
Length = 437
Score = 61.9 bits (31), Expect = 9e-008
Identities = 64/75 (85%)
Strand = Plus / Minus
Query: 1745 ttgggattgtattggtagaagaaatggtaccaccccttgtagtacatgggcgcgttggga 1804
||||| |||||||||||||| | |||||| ||||||||||||||| || || || |||
Sbjct: 321 ttggggttgtattggtagaatagatggtagagccccttgtagtacataggtgcatttgga 262
Query: 1805 tcattgatccagttc 1819
|| ||||||||||||
Sbjct: 261 tcgttgatccagttc 247
>gb|DT500159.1|DT500159 PX0011.BR_G11 PT-X-FL-A-1 Populus trichocarpa cDNA clone PX0011_G11
5', mRNA sequence
Length = 673
Score = 58.0 bits (29), Expect = 1e-006
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 1748 ggattgtattggtagaagaaatggtaccaccccttgtagtacatgggcgcgttgggatca 1807
|||||||||||||||||||| |||||||| || ||||| |||| || ||||||||||
Sbjct: 242 ggattgtattggtagaagaagtggtaccagcctttgtaatacaatggaccgttgggatcg 183
Query: 1808 ttgatccagttct 1820
|| ||||| ||||
Sbjct: 182 ttcatccaattct 170
>gb|AY190017.1| Populus tomentosa cell-wall invertase gene, partial cds
Length = 518
Score = 54.0 bits (27), Expect = 2e-005
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 1715 gcccacacgatgttgccccatacggcgcccttgggattgtattggtagaagaaatggta 1773
||||| || ||||||||||| ||||| || ||||||||||| |||||||| | ||||||
Sbjct: 59 gcccagacaatgttgccccacacggcacctttgggattgtactggtagaatagatggta 1
>gb|CX168427.1|CX168427 B06_69-85_04.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 592
Score = 50.1 bits (25), Expect = 3e-004
Identities = 34/37 (91%)
Strand = Plus / Minus
Query: 1748 ggattgtattggtagaagaaatggtaccaccccttgt 1784
||||||||||||||||| | ||||||||| |||||||
Sbjct: 282 ggattgtattggtagaatagatggtaccatcccttgt 246
>gb|CX169703.1|CX169703 E01_69-117_09.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 716
Score = 50.1 bits (25), Expect = 3e-004
Identities = 34/37 (91%)
Strand = Plus / Minus
Query: 1748 ggattgtattggtagaagaaatggtaccaccccttgt 1784
||||||||||||||||| | ||||||||| |||||||
Sbjct: 297 ggattgtattggtagaatagatggtaccatcccttgt 261
>gb|CA925615.1|CA925615 MTU7TL.P3.G07 Aspen leaf cDNA Library Populus tremuloides cDNA, mRNA
sequence
Length = 284
Score = 46.1 bits (23), Expect = 0.005
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 1808 ttgatccagttcttggggggctggaagtggtaccc 1842
|||||||||||||| || ||||||||||| |||||
Sbjct: 283 ttgatccagttcttaggaggctggaagtgataccc 249
>gb|CX654517.1|CX654517 PO02011E09 Poplar SC cDNA library Populus alba x Populus tremula
var. glandulosa cDNA clone PO02011E09 5', mRNA sequence
Length = 426
Score = 44.1 bits (22), Expect = 0.021
Identities = 52/62 (83%)
Strand = Plus / Minus
Query: 875 tgcttcccactggggtccagccacaccgtccttggaatcgcctggattccagcccagcct 934
||||| ||||| || || ||||||||| ||||||||||| ||| ||||| ||||| |||
Sbjct: 205 tgctttccactaggatctagccacaccctccttggaatcaactgaattcctgcccatcct 146
Query: 935 tt 936
||
Sbjct: 145 tt 144
>gb|DT514871.1|DT514871 WS02426.B21_A05 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02426_A05 3', mRNA sequence
Length = 857
Score = 44.1 bits (22), Expect = 0.021
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 875 tgcttcccactggggtccagccacaccgtccttggaatcgcctggattccagcccagcct 934
||||| ||||| || || ||||||||| ||||||||||| ||| ||||| ||||| |||
Sbjct: 760 tgctttccactaggatctagccacaccctccttggaatcaactgaattcctgcccatcct 819
Query: 935 tt 936
||
Sbjct: 820 tt 821
>gb|DT516146.1|DT516146 WS02430.B21_I16 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02430_I16 3', mRNA sequence
Length = 893
Score = 44.1 bits (22), Expect = 0.021
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 875 tgcttcccactggggtccagccacaccgtccttggaatcgcctggattccagcccagcct 934
||||| ||||| || || ||||||||| ||||||||||| ||| ||||| ||||| |||
Sbjct: 765 tgctttccactaggatctagccacaccctccttggaatcaactgaattcctgcccatcct 824
Query: 935 tt 936
||
Sbjct: 825 tt 826
>gb|DT517940.1|DT517940 WS02435.B21_L21 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02435_L21 3', mRNA sequence
Length = 904
Score = 44.1 bits (22), Expect = 0.021
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 875 tgcttcccactggggtccagccacaccgtccttggaatcgcctggattccagcccagcct 934
||||| ||||| || || ||||||||| ||||||||||| ||| ||||| ||||| |||
Sbjct: 767 tgctttccactaggatctagccacaccctccttggaatcaactgaattcctgcccatcct 826
Query: 935 tt 936
||
Sbjct: 827 tt 828
>gb|CA925485.1|CA925485 MTU7TL.P1.H09 Aspen leaf cDNA Library Populus tremuloides cDNA, mRNA
sequence
Length = 284
Score = 42.1 bits (21), Expect = 0.083
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 1808 ttgatccagttcttggggggctggaagtg 1836
|||||||||||||| || |||||||||||
Sbjct: 283 ttgatccagttcttaggaggctggaagtg 255
>gb|CA933578.1|CA933578 MTU5CS.P9.G08 Aspen stem cDNA Library Populus tremuloides cDNA, mRNA
sequence
Length = 353
Score = 42.1 bits (21), Expect = 0.083
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 1752 tgtattggtagaagaaatggtaccaccccttgtagtacatgggcgcgttgggatcattga 1811
|||||||||||||||| |||| ||| || ||||| |||| || |||||||||| || |
Sbjct: 333 tgtattggtagaagaagtggttccagcctttgtaatacaatggaccgttgggatcgttca 274
Query: 1812 tccag 1816
|||||
Sbjct: 273 tccag 269
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 159,604
Number of Sequences: 369679
Number of extensions: 159604
Number of successful extensions: 41776
Number of sequences better than 0.5: 17
Number of HSP's better than 0.5 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41754
Number of HSP's gapped (non-prelim): 22
length of query: 2055
length of database: 203,408,664
effective HSP length: 20
effective length of query: 2035
effective length of database: 196,015,084
effective search space: 398890695940
effective search space used: 398890695940
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)