BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2478075.2.1
(807 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU835450.1|BU835450 T074A11 Populus apical shoot cDNA li... 42 0.032
gb|CK096703.1|CK096703 UB23CPG01.3pR Populus active cambium... 42 0.032
>gb|BU835450.1|BU835450 T074A11 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 714
Score = 42.1 bits (21), Expect = 0.032
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 40 tgtctacagtctcaagcttca 60
|||||||||||||||||||||
Sbjct: 494 tgtctacagtctcaagcttca 514
>gb|CK096703.1|CK096703 UB23CPG01.3pR Populus active cambium cDNA library Populus tremula
cDNA clone UB23CPG01 3', mRNA sequence
Length = 848
Score = 42.1 bits (21), Expect = 0.032
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 40 tgtctacagtctcaagcttca 60
|||||||||||||||||||||
Sbjct: 720 tgtctacagtctcaagcttca 700
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 68,966
Number of Sequences: 369679
Number of extensions: 68966
Number of successful extensions: 16906
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16904
Number of HSP's gapped (non-prelim): 2
length of query: 807
length of database: 203,408,664
effective HSP length: 19
effective length of query: 788
effective length of database: 196,384,763
effective search space: 154751193244
effective search space used: 154751193244
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)