BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2440806.2.1
(1136 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CN523018.1|CN523018 GQ0121.B3_N15 GQ012 Populus trichoca... 58 8e-007
gb|CV225628.1|CV225628 WS0161.B21_P05 PT-DX-A-7 Populus tri... 58 8e-007
gb|CV229205.1|CV229205 WS01912.B21_I24 PT-DX-N-A-10 Populus... 58 8e-007
gb|CV238390.1|CV238390 WS0126.B21_H06 PT-GT-FL-A-3 Populus ... 58 8e-007
gb|CA927435.1|CA927435 MTU6CR.P9.A02 Aspen root cDNA Librar... 56 3e-006
gb|CA933488.1|CA933488 MTU5CS.P8.G02 Aspen stem cDNA Librar... 56 3e-006
gb|AI162298.1|AI162298 A015P43U Hybrid aspen plasmid librar... 50 2e-004
gb|CK115131.1|CK115131 Y003H07 Populus infected leaf substr... 50 2e-004
gb|CV231695.1|CV231695 WS0195.B21_E22 PT-DX-N-A-10 Populus ... 50 2e-004
gb|DT497043.1|DT497043 WS01125.BR_F03 PT-P-FL-A-2 Populus t... 50 2e-004
gb|CA926654.1|CA926654 MTU6CR.P17.E12 Aspen root cDNA Libra... 48 7e-004
gb|CA932362.1|CA932362 MTU5CS.P12.A03 Aspen stem cDNA Libra... 48 7e-004
gb|CA932363.1|CA932363 MTU5CS.P12.A04 Aspen stem cDNA Libra... 48 7e-004
gb|CF119091.1|CF119091 MTU10CS.P13.D03 Aspen stem cDNA Libr... 48 7e-004
gb|CF119597.1|CF119597 MTU10CS.P3.H07 Aspen stem cDNA Libra... 48 7e-004
gb|CF119974.1|CF119974 MTU10CS.P8.F11 Aspen stem cDNA Libra... 48 7e-004
gb|CF232283.1|CF232283 PtaJXO0008E5E0509 Poplar cDNA librar... 48 7e-004
gb|BI127464.1|BI127464 G061P09Y Populus cambium cDNA librar... 42 0.046
gb|CF232445.1|CF232445 PtaJXO0010E9D0408 Poplar cDNA librar... 42 0.046
gb|BI120266.1|BI120266 F012P73Y Populus flower cDNA library... 40 0.18
gb|BI121559.1|BI121559 F039P83Y Populus flower cDNA library... 40 0.18
gb|DN503449.1|DN503449 Y016F08.5pR Populus infected leaf su... 40 0.18
>gb|CN523018.1|CN523018 GQ0121.B3_N15 GQ012 Populus trichocarpa x Populus deltoides cDNA
clone GQ0121_N15 5', mRNA sequence
Length = 353
Score = 58.0 bits (29), Expect = 8e-007
Identities = 76/89 (85%), Gaps = 2/89 (2%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 186 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 128
Query: 630 gcgtgtagtcgttgttcaccacgtggaag 658
| |||||||| ||||| ||||||||||||
Sbjct: 127 gagtgtagtcattgtttaccacgtggaag 99
>gb|CV225628.1|CV225628 WS0161.B21_P05 PT-DX-A-7 Populus trichocarpa cDNA clone WS0161_P05
3', mRNA sequence
Length = 678
Score = 58.0 bits (29), Expect = 8e-007
Identities = 76/89 (85%), Gaps = 2/89 (2%)
Strand = Plus / Plus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 501 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 559
Query: 630 gcgtgtagtcgttgttcaccacgtggaag 658
| |||||||| ||||| ||||||||||||
Sbjct: 560 gagtgtagtcattgtttaccacgtggaag 588
>gb|CV229205.1|CV229205 WS01912.B21_I24 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01912_I24 3', mRNA sequence
Length = 678
Score = 58.0 bits (29), Expect = 8e-007
Identities = 76/89 (85%), Gaps = 2/89 (2%)
Strand = Plus / Plus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 501 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 559
Query: 630 gcgtgtagtcgttgttcaccacgtggaag 658
| |||||||| ||||| ||||||||||||
Sbjct: 560 gagtgtagtcattgtttaccacgtggaag 588
>gb|CV238390.1|CV238390 WS0126.B21_H06 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0126_H06 3', mRNA sequence
Length = 593
Score = 58.0 bits (29), Expect = 8e-007
Identities = 76/89 (85%), Gaps = 2/89 (2%)
Strand = Plus / Plus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 379 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 437
Query: 630 gcgtgtagtcgttgttcaccacgtggaag 658
| |||||||| ||||| ||||||||||||
Sbjct: 438 gagtgtagtcattgtttaccacgtggaag 466
>gb|CA927435.1|CA927435 MTU6CR.P9.A02 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 509
Score = 56.0 bits (28), Expect = 3e-006
Identities = 75/88 (85%), Gaps = 2/88 (2%)
Strand = Plus / Plus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||||||||| |||||
Sbjct: 423 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcgtacatttcccagt 481
Query: 630 gcgtgtagtcgttgttcaccacgtggaa 657
| ||||| || ||||||||||| |||||
Sbjct: 482 gagtgtaatcattgttcaccacatggaa 509
>gb|CA933488.1|CA933488 MTU5CS.P8.G02 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 509
Score = 56.0 bits (28), Expect = 3e-006
Identities = 75/88 (85%), Gaps = 2/88 (2%)
Strand = Plus / Plus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||||| ||||| |||||||| ||||| |||||
Sbjct: 423 gttgccctggctgttgatggtggg-ttccgcactgccaccgatggcatacatttcccagt 481
Query: 630 gcgtgtagtcgttgttcaccacgtggaa 657
| ||||| || ||||||||||| |||||
Sbjct: 482 gagtgtaatcattgttcaccacatggaa 509
>gb|AI162298.1|AI162298 A015P43U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 385
Score = 50.1 bits (25), Expect = 2e-004
Identities = 75/89 (84%), Gaps = 2/89 (2%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 247 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 189
Query: 630 gcgtgtagtcgttgttcaccacgtggaag 658
| ||||| || ||||||||||| ||||||
Sbjct: 188 gagtgtaatcattgttcaccacatggaag 160
>gb|CK115131.1|CK115131 Y003H07 Populus infected leaf substracted cDNA library Populus
tremula cDNA clone Y003H07 5', mRNA sequence
Length = 611
Score = 50.1 bits (25), Expect = 2e-004
Identities = 75/89 (84%), Gaps = 2/89 (2%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 191 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 133
Query: 630 gcgtgtagtcgttgttcaccacgtggaag 658
| ||||| || ||||||||||| ||||||
Sbjct: 132 gagtgtaatcattgttcaccacatggaag 104
>gb|CV231695.1|CV231695 WS0195.B21_E22 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS0195_E22 3', mRNA sequence
Length = 574
Score = 50.1 bits (25), Expect = 2e-004
Identities = 75/89 (84%), Gaps = 2/89 (2%)
Strand = Plus / Plus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 379 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 437
Query: 630 gcgtgtagtcgttgttcaccacgtggaag 658
| ||||| || ||||||||||| ||||||
Sbjct: 438 gagtgtaatcattgttcaccacatggaag 466
>gb|DT497043.1|DT497043 WS01125.BR_F03 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS01125_F03 5', mRNA sequence
Length = 978
Score = 50.1 bits (25), Expect = 2e-004
Identities = 75/89 (84%), Gaps = 2/89 (2%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 385 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 327
Query: 630 gcgtgtagtcgttgttcaccacgtggaag 658
| ||||| || ||||||||||| ||||||
Sbjct: 326 gagtgtaatcattgttcaccacatggaag 298
>gb|CA926654.1|CA926654 MTU6CR.P17.E12 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 514
Score = 48.1 bits (24), Expect = 7e-004
Identities = 74/88 (84%), Gaps = 2/88 (2%)
Strand = Plus / Plus
Query: 571 gttgccctggctgatgatggtggggttccg-gctgccgccgatggcgtacatgagccagt 629
||||||||||||| ||||||| |||||| | ||||| |||||||| ||||| |||||
Sbjct: 428 gttgccctggctgttgatggt-gggttctgcactgccaccgatggcatacatttcccagt 486
Query: 630 gcgtgtagtcgttgttcaccacgtggaa 657
| |||||||| ||||| ||||| |||||
Sbjct: 487 gagtgtagtcattgtttaccacatggaa 514
>gb|CA932362.1|CA932362 MTU5CS.P12.A03 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 509
Score = 48.1 bits (24), Expect = 7e-004
Identities = 74/88 (84%), Gaps = 2/88 (2%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 87 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 29
Query: 630 gcgtgtagtcgttgttcaccacgtggaa 657
| ||||| || ||||||||||| |||||
Sbjct: 28 gagtgtaatcattgttcaccacatggaa 1
>gb|CA932363.1|CA932363 MTU5CS.P12.A04 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 509
Score = 48.1 bits (24), Expect = 7e-004
Identities = 74/88 (84%), Gaps = 2/88 (2%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccgg-ctgccgccgatggcgtacatgagccagt 629
||||||||||||| |||||||||| ||| | ||||| |||||||| ||||| |||||
Sbjct: 87 gttgccctggctgttgatggtggg-ttctgcactgccaccgatggcatacatttcccagt 29
Query: 630 gcgtgtagtcgttgttcaccacgtggaa 657
| ||||| || ||||||||||| |||||
Sbjct: 28 gagtgtaatcattgttcaccacatggaa 1
>gb|CF119091.1|CF119091 MTU10CS.P13.D03 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 515
Score = 48.1 bits (24), Expect = 7e-004
Identities = 74/88 (84%), Gaps = 2/88 (2%)
Strand = Plus / Plus
Query: 571 gttgccctggctgatgatggtggggttccg-gctgccgccgatggcgtacatgagccagt 629
||||||||||||| ||||||| |||||| | ||||| |||||||| ||||| |||||
Sbjct: 429 gttgccctggctgttgatggt-gggttctgcactgccaccgatggcatacatttcccagt 487
Query: 630 gcgtgtagtcgttgttcaccacgtggaa 657
| |||||||| ||||| ||||| |||||
Sbjct: 488 gagtgtagtcattgtttaccacatggaa 515
>gb|CF119597.1|CF119597 MTU10CS.P3.H07 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 515
Score = 48.1 bits (24), Expect = 7e-004
Identities = 74/88 (84%), Gaps = 2/88 (2%)
Strand = Plus / Plus
Query: 571 gttgccctggctgatgatggtggggttccg-gctgccgccgatggcgtacatgagccagt 629
||||||||||||| ||||||| |||||| | ||||| |||||||| ||||| |||||
Sbjct: 429 gttgccctggctgttgatggt-gggttctgcactgccaccgatggcatacatttcccagt 487
Query: 630 gcgtgtagtcgttgttcaccacgtggaa 657
| |||||||| ||||| ||||| |||||
Sbjct: 488 gagtgtagtcattgtttaccacatggaa 515
>gb|CF119974.1|CF119974 MTU10CS.P8.F11 Aspen stem cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 599
Score = 48.1 bits (24), Expect = 7e-004
Identities = 74/88 (84%), Gaps = 2/88 (2%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccg-gctgccgccgatggcgtacatgagccagt 629
||||||||||||| ||||||| |||||| | ||||| |||||||| ||||| |||||
Sbjct: 87 gttgccctggctgttgatggt-gggttctgcactgccaccgatggcatacatttcccagt 29
Query: 630 gcgtgtagtcgttgttcaccacgtggaa 657
| |||||||| ||||| ||||| |||||
Sbjct: 28 gagtgtagtcattgtttaccacatggaa 1
>gb|CF232283.1|CF232283 PtaJXO0008E5E0509 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 498
Score = 48.1 bits (24), Expect = 7e-004
Identities = 72/88 (81%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccggctgccgccgatggcgtacatgagccagtg 630
||||||||||||| |||||||||| | ||||| |||||||| ||||| ||||||
Sbjct: 170 gttgccctggctgttgatggtgggctctgcactgccaccgatggcatacatttcccagtg 111
Query: 631 cgtgtagtcgttgttcaccacgtggaag 658
|||||||| ||||| ||||| ||||||
Sbjct: 110 agtgtagtcattgtttaccacatggaag 83
>gb|BI127464.1|BI127464 G061P09Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 404
Score = 42.1 bits (21), Expect = 0.046
Identities = 66/81 (81%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccggctgccgccgatggcgtacatgagccagtg 630
||||||||||||| |||||||||| | ||||| |||||||| ||||| ||||||
Sbjct: 109 gttgccctggctgttgatggtgggctctgcactgccaccgatggcatacatttcccagtg 50
Query: 631 cgtgtagtcgttgttcaccac 651
|||||||| ||||| |||||
Sbjct: 49 agtgtagtcattgtttaccac 29
>gb|CF232445.1|CF232445 PtaJXO0010E9D0408 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 708
Score = 42.1 bits (21), Expect = 0.046
Identities = 74/89 (83%), Gaps = 2/89 (2%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggggttccg-gctgccgccgatggcgtacatgagccagt 629
||||||||||||| ||||||| |||||| | ||||| |||||||| ||||| |||||
Sbjct: 535 gttgccctggctgttgatggt-gggttctgcactgccaccgatggcatacatttcccagt 477
Query: 630 gcgtgtagtcgttgttcaccacgtggaag 658
| |||||||| ||||| || || ||||||
Sbjct: 476 gagtgtagtcattgtttactacatggaag 448
>gb|BI120266.1|BI120266 F012P73Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 184
Score = 40.1 bits (20), Expect = 0.18
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggg 594
||||||||||||| ||||||||||
Sbjct: 43 gttgccctggctgttgatggtggg 20
>gb|BI121559.1|BI121559 F039P83Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 282
Score = 40.1 bits (20), Expect = 0.18
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 571 gttgccctggctgatgatggtggg 594
||||||||||||| ||||||||||
Sbjct: 43 gttgccctggctgttgatggtggg 20
>gb|DN503449.1|DN503449 Y016F08.5pR Populus infected leaf substracted cDNA library Populus
tremula cDNA clone Y016F08 5', mRNA sequence
Length = 820
Score = 40.1 bits (20), Expect = 0.18
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 634 gtagtcgttgttcaccacgtggaa 657
|||||||||||| |||||||||||
Sbjct: 375 gtagtcgttgtttaccacgtggaa 352
Score = 40.1 bits (20), Expect = 0.18
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 701 ccgaagtggttgaaggcgacggtgacctgcat 732
||||||||||||||||| | |||||| |||||
Sbjct: 308 ccgaagtggttgaaggcaatggtgacttgcat 277
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 80,155
Number of Sequences: 369679
Number of extensions: 80155
Number of successful extensions: 19390
Number of sequences better than 0.5: 22
Number of HSP's better than 0.5 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19352
Number of HSP's gapped (non-prelim): 28
length of query: 1136
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1117
effective length of database: 196,384,763
effective search space: 219361780271
effective search space used: 219361780271
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)