BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2405341.2.2
(1164 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU861487.1|BU861487 S002F07 Populus imbibed seed cDNA li... 149 3e-034
gb|DV463532.1|DV463532 MTUNUL1.P17.B06 NUL Populus fremonti... 147 1e-033
gb|CK101222.1|CK101222 F031P11.5pR Populus flower cDNA libr... 117 1e-024
gb|BI068986.1|BI068986 C030P37U Populus strain T89 leaves P... 111 6e-023
gb|BI121049.1|BI121049 F027P24Y Populus flower cDNA library... 103 1e-020
gb|BI120256.1|BI120256 F012P59Y Populus flower cDNA library... 92 6e-017
gb|CV241208.1|CV241208 WS02511.B21_I11 PT-MB-N-A-15 Populus... 84 1e-014
gb|CV283186.1|CV283186 WS0186.B21_K13 PTxD-IL-N-A-9 Populus... 84 1e-014
gb|CV131435.1|CV131435 L2P06g09 Populus stem seasonal libra... 82 5e-014
gb|BI121339.1|BI121339 F034P61Y Populus flower cDNA library... 78 9e-013
gb|CV270717.1|CV270717 WS0152.B21_L20 PTxN-IB-A-6 Populus t... 68 8e-010
gb|CV283341.1|CV283341 WS0187.B21_B04 PTxD-IL-N-A-9 Populus... 68 8e-010
gb|CK096966.1|CK096966 UB34DPB12.3pR Populus active cambium... 48 8e-004
gb|CK090906.1|CK090906 F031P11.3pR Populus flower cDNA libr... 42 0.047
gb|CK095621.1|CK095621 UA17CPB12.3pR Populus dormant cambiu... 42 0.047
gb|CK102420.1|CK102420 G077P09.5pR Populus tension wood cDN... 42 0.047
gb|CV230629.1|CV230629 WS0192.B21_C08 PT-DX-N-A-10 Populus ... 42 0.047
gb|CV275623.1|CV275623 WS0177.B21_B07 PTxD-NR-A-8 Populus t... 42 0.047
gb|DN497512.1|DN497512 R007G08.5pR Populus root cDNA librar... 42 0.047
gb|DT516496.1|DT516496 WS02431.B21_J10 PTxD-ICC-N-A-14 Popu... 42 0.047
gb|BI130382.1|BI130382 G104P87Y Populus cambium cDNA librar... 40 0.19
gb|BU880334.1|BU880334 UM44TE09 Populus flower cDNA library... 40 0.19
gb|BU888604.1|BU888604 P010B03 Populus petioles cDNA librar... 40 0.19
gb|BU891783.1|BU891783 P055B08 Populus petioles cDNA librar... 40 0.19
gb|BU894577.1|BU894577 X011F05 Populus wood cDNA library Po... 40 0.19
gb|CN520031.1|CN520031 GQ0106.B3_I17 GQ010 Populus trichoca... 40 0.19
gb|CV236474.1|CV236474 WS01224.B21.1_E01 PT-GT-FL-A-3 Popul... 40 0.19
gb|CV263469.1|CV263469 WS02021.B21_M21 PTxN-IB-N-A-11 Popul... 40 0.19
gb|CX168025.1|CX168025 G11_69-91_13.ab1 leaf inoculated wit... 40 0.19
gb|DN491535.1|DN491535 UR115TE03.3pR Populus root cDNA libr... 40 0.19
gb|DN492375.1|DN492375 X011F05.3pR Populus wood cDNA librar... 40 0.19
gb|DT479565.1|DT479565 WS02526.BR_E09 PT-MB-N-A-15 Populus ... 40 0.19
>gb|BU861487.1|BU861487 S002F07 Populus imbibed seed cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 752
Score = 149 bits (75), Expect = 3e-034
Identities = 270/335 (80%)
Strand = Plus / Plus
Query: 353 gcaaaaggcttgtcttacttgcatcacgattgttcgcctcgaataatacatcgtgatatc 412
|||||||| || |||||||||||||||||||||| ||| | || || |||||||| ||
Sbjct: 125 gcaaaaggactggcttacttgcatcacgattgttcccctaggatcatccatcgtgacata 184
Query: 413 aagtcgagcaacatcttgcttgacggcagttttgaggcccgcgtatcagactttggactt 472
||||| |||||||| |||||||| |||| || |||| || || | || ||||||||
Sbjct: 185 aagtcaagcaacattttgcttgatggcaacttgaaggctcgagttactgattttggactc 244
Query: 473 gcaaagcttttagaggacgaagaatcccatatcactacaatagttgcaggaacatttggt 532
|| || | |||| ||| | |||||| ||||| || ||||| ||||||||||||||||||
Sbjct: 245 gccaaattattaggggatggagaatcacatattacaacaattgttgcaggaacatttggt 304
Query: 533 tatcttgcgccagagtatatgcagtttggcagagccaccgagaagaccgatgtctacagt 592
||||| || || || || ||||| |||||| || || || ||||| ||||| || |||
Sbjct: 305 tatctagctcccgaatacatgcaaagtggcagggcaactgaaaagactgatgtttatagt 364
Query: 593 tttggggttctggtacttgaaatactcagcggaaagcgacctaccgatgcatccttcatt 652
|| ||||| ||||| |||||| |||| ||||||||||| || || ||||| || ||||||
Sbjct: 365 ttcggggtcctggtgcttgaagtactgagcggaaagcggccaacagatgcgtcattcatt 424
Query: 653 gagaagggattaaacattgttggatggttaaattt 687
|||||||| | ||||||||||| ||| |||||||
Sbjct: 425 gagaagggcctgaacattgttggttggctaaattt 459
>gb|DV463532.1|DV463532 MTUNUL1.P17.B06 NUL Populus fremontii x Populus angustifolia cDNA,
mRNA sequence
Length = 873
Score = 147 bits (74), Expect = 1e-033
Identities = 260/322 (80%)
Strand = Plus / Plus
Query: 366 cttacttgcatcacgattgttcgcctcgaataatacatcgtgatatcaagtcgagcaaca 425
|||||||||||||||||||||| ||| | || || |||||||| || ||||| |||||||
Sbjct: 360 cttacttgcatcacgattgttcccctaggatcatccatcgtgacataaagtcaagcaaca 419
Query: 426 tcttgcttgacggcagttttgaggcccgcgtatcagactttggacttgcaaagcttttag 485
| |||||||| |||| || ||||| || || | || ||||||||||| || | ||||
Sbjct: 420 ttttgcttgatggcaacttggaggctcgagttactgattttggacttgccaaattgttag 479
Query: 486 aggacgaagaatcccatatcactacaatagttgcaggaacatttggttatcttgcgccag 545
||| | |||||| ||||| || ||||| ||||| ||||||||||||||||| || || |
Sbjct: 480 gggatggagaatcacatattacaacaattgttgctggaacatttggttatctagctcccg 539
Query: 546 agtatatgcagtttggcagagccaccgagaagaccgatgtctacagttttggggttctgg 605
| || ||||| |||||| || || || ||||| ||||| || ||||||||||| |||
Sbjct: 540 aatacatgcaaagtggcagggcaactgaaaagactgatgtttatagttttggggtcctga 599
Query: 606 tacttgaaatactcagcggaaagcgacctaccgatgcatccttcattgagaagggattaa 665
| |||||| |||| ||||||||||| || || ||||| || ||||| |||||||| | |
Sbjct: 600 tgcttgaagtactaagcggaaagcggccaacggatgcgtcattcatcgagaagggcctga 659
Query: 666 acattgttggatggttaaattt 687
|||||||||| ||| |||||||
Sbjct: 660 acattgttggttggctaaattt 681
Score = 48.1 bits (24), Expect = 8e-004
Identities = 90/112 (80%)
Strand = Plus / Plus
Query: 152 gatcggttctttgatagagaacttgagatattgggaagtgttaaacatcgttacttggtc 211
||||| |||||||| ||||| ||||| || | ||||| | ||||| || ||| ||||
Sbjct: 146 gatcgattctttgagagagagcttgaaattcttggaagcataaaacaccgctacctggtt 205
Query: 212 aatcttcgtggttattgcaactctccttcatcaaaacttttgatatatgatt 263
||| | |||||||||||||| || ||| |||||||| | ||||| |||||||
Sbjct: 206 aatttacgtggttattgcaattcccctacatcaaaattgttgatttatgatt 257
>gb|CK101222.1|CK101222 F031P11.5pR Populus flower cDNA library Populus trichocarpa cDNA
clone F031P11 5', mRNA sequence
Length = 575
Score = 117 bits (59), Expect = 1e-024
Identities = 221/275 (80%)
Strand = Plus / Plus
Query: 401 catcgtgatatcaagtcgagcaacatcttgcttgacggcagttttgaggcccgcgtatca 460
|||||||| || ||||| |||||||| |||||||| |||| || ||||| || || |
Sbjct: 5 catcgtgacataaagtcaagcaacattttgcttgatggcaacttggaggctcgagttact 64
Query: 461 gactttggacttgcaaagcttttagaggacgaagaatcccatatcactacaatagttgca 520
|| ||||||||||| || | |||| ||| | |||||| ||||| || ||||| |||||
Sbjct: 65 gattttggacttgccaaattattaggggatggagaatcacatattacaacaattgttgct 124
Query: 521 ggaacatttggttatcttgcgccagagtatatgcagtttggcagagccaccgagaagacc 580
||||||||||||||||| || || || || ||||| |||||| || || || |||||
Sbjct: 125 ggaacatttggttatctagctcccgaatacatgcaaagtggcagggcaactgaaaagact 184
Query: 581 gatgtctacagttttggggttctggtacttgaaatactcagcggaaagcgacctaccgat 640
||||| || ||||||||||| ||||| || ||| |||| ||||||||||| || || |||
Sbjct: 185 gatgtttatagttttggggtcctggtgctggaagtactgagcggaaagcggccaacggat 244
Query: 641 gcatccttcattgagaagggattaaacattgttgg 675
|| || |||||||||||||| | |||||||||||
Sbjct: 245 gcgtcattcattgagaagggcctgaacattgttgg 279
>gb|BI068986.1|BI068986 C030P37U Populus strain T89 leaves Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 384
Score = 111 bits (56), Expect = 6e-023
Identities = 149/179 (83%), Gaps = 1/179 (0%)
Strand = Plus / Plus
Query: 509 acaatagttgcaggaacatttggttatcttgcgccagagtatatgcagtttggcagagcc 568
||||| ||||||||||||||||||||||| || || || || ||||| |||||| ||
Sbjct: 3 acaattgttgcaggaacatttggttatctagctcccgaatacatgcaaagtggcagggca 62
Query: 569 accgagaagaccgatgtctacagttttggggttctggtacttgaaatactcagcggaaag 628
|| || ||||| ||||| || ||||||||||| ||||| |||||| |||| |||||||||
Sbjct: 63 actgaaaagactgatgtttatagttttggggtcctggtgcttgaagtactgagcggaaag 122
Query: 629 cgacctaccgatgcatccttcattgagaagggattaaacattgttggatggttaaattt 687
|| || || ||||| || |||||||||||||| | ||||||||||| ||| |||||||
Sbjct: 123 cg-ccaacggatgcgtcattcattgagaagggcctgaacattgttggntggctaaattt 180
>gb|BI121049.1|BI121049 F027P24Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 441
Score = 103 bits (52), Expect = 1e-020
Identities = 221/276 (80%), Gaps = 1/276 (0%)
Strand = Plus / Plus
Query: 401 catcgtgatatcaagtcgagcaacatcttgcttgacggcagttttgaggcccgcgtatca 460
|||||||| || ||||| |||||||| |||||||| |||| || ||||| || || |
Sbjct: 5 catcgtgacataaagtcaagcaacattttgcttgatggcaacttggaggctcgagttact 64
Query: 461 gactttggacttgcaaagcttttagaggacgaagaatcccatatcactacaatagttgca 520
|| ||||||||||| || | |||| ||| | |||||| ||||| || ||||| |||||
Sbjct: 65 gattttggacttgccaaattattaggggatggagaatcacatattacaacaattgttgct 124
Query: 521 ggaacatttggttatcttgcgccagagtatatgcagtttggcagagccaccgagaagacc 580
||||||||||||||||| || || || || ||||| |||||| || || || |||||
Sbjct: 125 ggaacatttggttatctagctcccgaatacatgcaaagtggcagggcaactgaaaagact 184
Query: 581 gatgtctacagttttggggttctggtacttgaa-atactcagcggaaagcgacctaccga 639
||||| || ||||||||||| ||||| || ||| |||| ||||||||||| || || ||
Sbjct: 185 gatgtttatagttttggggtcctggtgctggaaggtactgagcggaaagcggccaacgga 244
Query: 640 tgcatccttcattgagaagggattaaacattgttgg 675
||| || |||||||||||||| | |||||||||||
Sbjct: 245 tgcgtcattcattgagaagggcctgaacattgttgg 280
>gb|BI120256.1|BI120256 F012P59Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 258
Score = 91.7 bits (46), Expect = 6e-017
Identities = 184/230 (80%)
Strand = Plus / Plus
Query: 401 catcgtgatatcaagtcgagcaacatcttgcttgacggcagttttgaggcccgcgtatca 460
|||||||| || ||||| |||||||| |||||||| |||| || ||||| || || |
Sbjct: 5 catcgtgacataaagtcaagcaacattttgcttgatggcaacttggaggctcgagttact 64
Query: 461 gactttggacttgcaaagcttttagaggacgaagaatcccatatcactacaatagttgca 520
|| ||||||||||| || | |||| ||| | |||||| ||||| || ||||| |||||
Sbjct: 65 gattttggacttgccaaattattaggggatggagaatcacatattacaacaattgttgct 124
Query: 521 ggaacatttggttatcttgcgccagagtatatgcagtttggcagagccaccgagaagacc 580
||||||||||||||||| || || || || ||||| |||||| || || || |||||
Sbjct: 125 ggaacatttggttatctagctcccgaatacatgcaaagtggcagggcaactgaaaagact 184
Query: 581 gatgtctacagttttggggttctggtacttgaaatactcagcggaaagcg 630
||||| || ||||||||||| ||||| || ||| |||| |||||||||||
Sbjct: 185 gatgtttatagttttggggtcctggtgctggaagtactgagcggaaagcg 234
>gb|CV241208.1|CV241208 WS02511.B21_I11 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02511_I11 3', mRNA sequence
Length = 711
Score = 83.8 bits (42), Expect = 1e-014
Identities = 138/170 (81%)
Strand = Plus / Plus
Query: 368 tacttgcatcacgattgttcgcctcgaataatacatcgtgatatcaagtcgagcaacatc 427
||||||||||| |||||||| ||| | || || || ||||| || ||||| ||||||||
Sbjct: 343 tacttgcatcatgattgttcccctaggatcatccaccgtgacataaagtcaagcaacatt 402
Query: 428 ttgcttgacggcagttttgaggcccgcgtatcagactttggacttgcaaagcttttagag 487
|||||||| |||| || ||||| || || | || ||||||||||| || | ||||
Sbjct: 403 ttgcttgatggcaacttggaggctcgagtgactgattttggacttgccaaattgttaggt 462
Query: 488 gacgaagaatcccatatcactacaatagttgcaggaacatttggttatct 537
|| |||||||| ||||| |||||||| ||||| |||||||||||||||||
Sbjct: 463 gatgaagaatcacatattactacaattgttgctggaacatttggttatct 512
>gb|CV283186.1|CV283186 WS0186.B21_K13 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS0186_K13 3', mRNA sequence
Length = 878
Score = 83.8 bits (42), Expect = 1e-014
Identities = 141/174 (81%)
Strand = Plus / Minus
Query: 515 gttgcaggaacatttggttatcttgcgccagagtatatgcagtttggcagagccaccgag 574
||||| ||||||||||||||||| || || || || ||||| |||||| || || ||
Sbjct: 874 gttgctggaacatttggttatctagctcctgaatacatgcaaagtggcagggcaactgaa 815
Query: 575 aagaccgatgtctacagttttggggttctggtacttgaaatactcagcggaaagcgacct 634
||||| ||||| || ||||||||||| ||||| |||||| | || || |||||||| ||
Sbjct: 814 aagactgatgtttatagttttggggtcctggtgcttgaagtgctaagtggaaagcggcca 755
Query: 635 accgatgcatccttcattgagaagggattaaacattgttggatggttaaatttt 688
|| |||||||| | ||| |||||||| | || |||||||| ||||||||||||
Sbjct: 754 acagatgcatcatacatcgagaagggcctgaatattgttggttggttaaatttt 701
>gb|CV131435.1|CV131435 L2P06g09 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 605
Score = 81.8 bits (41), Expect = 5e-014
Identities = 141/173 (81%), Gaps = 1/173 (0%)
Strand = Plus / Plus
Query: 366 cttacttgcatcacgattgttcgcctcgaataatacatcgtgatatcaagtcga-gcaac 424
|||||||||||||||||||||| ||| | || || |||||||| || ||||| | |||||
Sbjct: 366 cttacttgcatcacgattgttcccctaggatcatccatcgtgacataaagtccaagcaac 425
Query: 425 atcttgcttgacggcagttttgaggcccgcgtatcagactttggacttgcaaagctttta 484
|| |||||||| |||| || ||||| || || | || ||||||||||| || | |||
Sbjct: 426 attttgcttgatggcaacttggaggctcgagtcactgattttggacttgccaaattgtta 485
Query: 485 gaggacgaagaatcccatatcactacaatagttgcaggaacatttggttatct 537
| ||| | |||||| ||||| || ||||| ||||| |||||||||||||||||
Sbjct: 486 ggggatggagaatcacatattacaacaattgttgctggaacatttggttatct 538
Score = 48.1 bits (24), Expect = 8e-004
Identities = 90/112 (80%)
Strand = Plus / Plus
Query: 152 gatcggttctttgatagagaacttgagatattgggaagtgttaaacatcgttacttggtc 211
||||| |||||||| ||||| ||||| || | ||||| | ||||| || ||| ||||
Sbjct: 152 gatcgattctttgagagagagcttgaaattcttggaagcataaaacaccgctacctggtt 211
Query: 212 aatcttcgtggttattgcaactctccttcatcaaaacttttgatatatgatt 263
||| | |||||||||||||| || ||| |||||||| | ||||| |||||||
Sbjct: 212 aatttacgtggttattgcaattcccctacatcaaaattgttgatttatgatt 263
>gb|BI121339.1|BI121339 F034P61Y Populus flower cDNA library Populus trichocarpa cDNA, mRNA
sequence
Length = 461
Score = 77.8 bits (39), Expect = 9e-013
Identities = 210/263 (79%), Gaps = 3/263 (1%)
Strand = Plus / Plus
Query: 401 catcgtgatatcaagtcgagcaacatcttgcttgacggcagttttgaggcccgcgtatca 460
|||||||| || ||||| |||||||| |||||||| |||| || ||||| || || |
Sbjct: 5 catcgtgacataaagtcaagcaacattttgcttgatggcaacttggaggctcgagttact 64
Query: 461 gactttggacttgcaaagctt-ttagaggacgaagaatcccatatcactacaatagttgc 519
|| ||||||||||| || || |||| ||| | |||||| ||||| || ||||| |||||
Sbjct: 65 gattttggacttgccaaaattattaggggatggagaatcacatattacaacaattgttgc 124
Query: 520 aggaacatttggttatcttgcgccagagtatatgcagtttggcagagccaccgagaagac 579
||||||||||||||||| || || || || ||||| |||||| || || || |||||
Sbjct: 125 tggaacatttggttatctagctcccgaatacatgcaaagtggcagggcaactgaaaagac 184
Query: 580 cgatgtctacagttt-tggggttctggtacttgaa-atactcagcggaaagcgacctacc 637
||||| || ||||| |||||| ||||| || ||| |||| ||||||||||| || ||
Sbjct: 185 tgatgtttatagtttatggggtcctggtgctggaaggtactgagcggaaagcggccaacg 244
Query: 638 gatgcatccttcattgagaaggg 660
||||| || ||||||||||||||
Sbjct: 245 gatgcgtcattcattgagaaggg 267
>gb|CV270717.1|CV270717 WS0152.B21_L20 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0152_L20 3', mRNA sequence
Length = 878
Score = 67.9 bits (34), Expect = 8e-010
Identities = 93/113 (82%)
Strand = Plus / Minus
Query: 575 aagaccgatgtctacagttttggggttctggtacttgaaatactcagcggaaagcgacct 634
||||| ||||| || ||||||||||| ||||| || || |||| ||||||||||| ||
Sbjct: 846 aagactgatgtttatagttttggggtcctggtgctgnaagtactaagcggaaagcggcca 787
Query: 635 accgatgcatccttcattgagaagggattaaacattgttggatggttaaattt 687
|| ||||| || ||||| |||||||| | ||||||||||| ||| |||||||
Sbjct: 786 acagatgcgtcattcatcgagaagggcctgaacattgttggttggctaaattt 734
>gb|CV283341.1|CV283341 WS0187.B21_B04 PTxD-IL-N-A-9 Populus trichocarpa x Populus
deltoides cDNA clone WS0187_B04 3', mRNA sequence
Length = 879
Score = 67.9 bits (34), Expect = 8e-010
Identities = 94/114 (82%)
Strand = Plus / Minus
Query: 575 aagaccgatgtctacagttttggggttctggtacttgaaatactcagcggaaagcgacct 634
||||| ||||| || ||||||||||| ||||| |||||| | || || |||||||| ||
Sbjct: 815 aagactgatgtttatagttttggggtcctggtgcttgaagtgctaagtggaaagcggcca 756
Query: 635 accgatgcatccttcattgagaagggattaaacattgttggatggttaaatttt 688
|| |||||||| | ||| |||||||| | || |||||||| ||||||||||||
Sbjct: 755 acagatgcatcatacatcgagaagggcctgaatattgttggttggttaaatttt 702
>gb|CK096966.1|CK096966 UB34DPB12.3pR Populus active cambium cDNA library Populus tremula
cDNA clone UB34DPB12 3', mRNA sequence
Length = 803
Score = 48.1 bits (24), Expect = 8e-004
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 581 gatgtctacagttttggggttctggtacttgaaatactcagcgg 624
||||| ||||||| ||||||| | |||||||||||| |||||||
Sbjct: 478 gatgtgtacagttatggggttgtagtacttgaaatagtcagcgg 435
>gb|CK090906.1|CK090906 F031P11.3pR Populus flower cDNA library Populus trichocarpa cDNA
clone F031P11 3', mRNA sequence
Length = 784
Score = 42.1 bits (21), Expect = 0.047
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 615 tactcagcggaaagcgacctaccgatgcatccttcattgagaagggattaaacattgttg 674
|||| |||| |||||| || || ||||| || |||||||||||||| | ||||||||||
Sbjct: 776 tactgagcgaaaagcggccaacggatgcgtcattcattgagaagggcctgaacattgttg 717
Query: 675 g 675
|
Sbjct: 716 g 716
>gb|CK095621.1|CK095621 UA17CPB12.3pR Populus dormant cambium cDNA library Populus tremula
cDNA clone UA17CPB12 3', mRNA sequence
Length = 846
Score = 42.1 bits (21), Expect = 0.047
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 581 gatgtctacagttttggggttctggtacttgaaatactcag 621
||||||||||| ||||| |||||| | ||||||||| ||||
Sbjct: 466 gatgtctacagctttggtgttctgcttcttgaaatagtcag 426
>gb|CK102420.1|CK102420 G077P09.5pR Populus tension wood cDNA library Populus tremula x
Populus tremuloides cDNA clone G077P09 5', mRNA sequence
Length = 588
Score = 42.1 bits (21), Expect = 0.047
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggttctggtacttgaaatactcag 621
||||||||||| |||||||| ||| | ||||||||| ||||
Sbjct: 335 gatgtctacagctttggggtgctgcttcttgaaatagtcag 375
>gb|CV230629.1|CV230629 WS0192.B21_C08 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS0192_C08 3', mRNA sequence
Length = 934
Score = 42.1 bits (21), Expect = 0.047
Identities = 63/77 (81%)
Strand = Plus / Minus
Query: 527 tttggttatcttgcgccagagtatatgcagtttggcagagccaccgagaagaccgatgtc 586
||||||||| | || ||||||||| ||||| ||| | |||||||||||| | ||||||
Sbjct: 583 tttggttatttggcaccagagtatctgcagagtgggatagccaccgagaaatcagatgtc 524
Query: 587 tacagttttggggttct 603
|| || ||||| |||||
Sbjct: 523 tatagctttggagttct 507
>gb|CV275623.1|CV275623 WS0177.B21_B07 PTxD-NR-A-8 Populus trichocarpa x Populus deltoides
cDNA clone WS0177_B07 3', mRNA sequence
Length = 615
Score = 42.1 bits (21), Expect = 0.047
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 581 gatgtctacagttttggggttctggtacttgaaatactcag 621
||||| ||||||| ||||||| | |||||||||||| ||||
Sbjct: 537 gatgtgtacagttatggggttgtagtacttgaaatagtcag 497
>gb|DN497512.1|DN497512 R007G08.5pR Populus root cDNA library Populus tremula x Populus
tremuloides cDNA clone R007G08 5', mRNA sequence
Length = 537
Score = 42.1 bits (21), Expect = 0.047
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 572 gagaagaccgatgtctacagttttggggt 600
|||||||| ||||||||||| ||||||||
Sbjct: 15 gagaagactgatgtctacagctttggggt 43
>gb|DT516496.1|DT516496 WS02431.B21_J10 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02431_J10 3', mRNA sequence
Length = 959
Score = 42.1 bits (21), Expect = 0.047
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 581 gatgtctacagttttggggttctggtacttgaaatactcag 621
||||| ||||||| ||||||| | |||||||||||| ||||
Sbjct: 500 gatgtgtacagttatggggttgtagtacttgaaatagtcag 460
>gb|BI130382.1|BI130382 G104P87Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 323
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 461 gactttggacttgcaaagct 480
||||||||||||||||||||
Sbjct: 233 gactttggacttgcaaagct 252
>gb|BU880334.1|BU880334 UM44TE09 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 632
Score = 40.1 bits (20), Expect = 0.19
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 572 gagaagaccgatgtctacagttttgggg 599
|||||||| ||||||||||| |||||||
Sbjct: 495 gagaagactgatgtctacagctttgggg 522
>gb|BU888604.1|BU888604 P010B03 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 627
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 461 gactttggacttgcaaagct 480
||||||||||||||||||||
Sbjct: 527 gactttggacttgcaaagct 546
>gb|BU891783.1|BU891783 P055B08 Populus petioles cDNA library Populus tremula cDNA 5 prime,
mRNA sequence
Length = 685
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggt 600
||||||||||||||||||||
Sbjct: 416 gatgtctacagttttggggt 435
>gb|BU894577.1|BU894577 X011F05 Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 674
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 581 gatgtctacagttttggggt 600
||||||||||||||||||||
Sbjct: 413 gatgtctacagttttggggt 432
>gb|CN520031.1|CN520031 GQ0106.B3_I17 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0106_I17 5', mRNA sequence
Length = 763
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 461 gactttggacttgcaaagct 480
||||||||||||||||||||
Sbjct: 27 gactttggacttgcaaagct 46
>gb|CV236474.1|CV236474 WS01224.B21.1_E01 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01224_E01 3', mRNA sequence
Length = 948
Score = 40.1 bits (20), Expect = 0.19
Identities = 32/36 (88%)
Strand = Plus / Minus
Query: 515 gttgcaggaacatttggttatcttgcgccagagtat 550
||||||||||| |||||||| || || |||||||||
Sbjct: 924 gttgcaggaacctttggttacctggccccagagtat 889
>gb|CV263469.1|CV263469 WS02021.B21_M21 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02021_M21 3', mRNA sequence
Length = 697
Score = 40.1 bits (20), Expect = 0.19
Identities = 26/28 (92%)
Strand = Plus / Minus
Query: 572 gagaagaccgatgtctacagttttgggg 599
|||||||| ||||||||||| |||||||
Sbjct: 586 gagaagactgatgtctacagctttgggg 559
>gb|CX168025.1|CX168025 G11_69-91_13.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 602
Score = 40.1 bits (20), Expect = 0.19
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 515 gttgcaggaacatttggttatcttgcgccagagtat 550
||||||||||| |||||||| || || |||||||||
Sbjct: 44 gttgcaggaacctttggttacctggccccagagtat 79
>gb|DN491535.1|DN491535 UR115TE03.3pR Populus root cDNA library Populus tremula x Populus
tremuloides cDNA clone UR115TE03 3', mRNA sequence
Length = 735
Score = 40.1 bits (20), Expect = 0.19
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 573 agaagaccgatgtctacagttttggggttctggtacttgaaata 616
||||| ||||||| |||||||| ||||| || |||||||||||
Sbjct: 637 agaaggccgatgtatacagtttcggggtgctcatacttgaaata 594
>gb|DN492375.1|DN492375 X011F05.3pR Populus wood cDNA library Populus tremula x Populus
tremuloides cDNA clone X011F05 3', mRNA sequence
Length = 770
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 581 gatgtctacagttttggggt 600
||||||||||||||||||||
Sbjct: 577 gatgtctacagttttggggt 558
>gb|DT479565.1|DT479565 WS02526.BR_E09 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02526_E09 5', mRNA sequence
Length = 732
Score = 40.1 bits (20), Expect = 0.19
Identities = 32/36 (88%)
Strand = Plus / Plus
Query: 515 gttgcaggaacatttggttatcttgcgccagagtat 550
||||||||||| |||||||| || || |||||||||
Sbjct: 75 gttgcaggaacctttggttacctggccccagagtat 110
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 124,294
Number of Sequences: 369679
Number of extensions: 124294
Number of successful extensions: 34728
Number of sequences better than 0.5: 32
Number of HSP's better than 0.5 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34670
Number of HSP's gapped (non-prelim): 52
length of query: 1164
length of database: 203,408,664
effective HSP length: 19
effective length of query: 1145
effective length of database: 196,384,763
effective search space: 224860553635
effective search space used: 224860553635
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)