BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2405118.2.1
(1669 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU820895.1|BU820895 UB16CPB08 Populus tremula cambium cD... 70 3e-010
gb|BU883248.1|BU883248 UM88TB04 Populus flower cDNA library... 70 3e-010
gb|BU883429.1|BU883429 UM90TF01 Populus flower cDNA library... 70 3e-010
gb|BU884254.1|BU884254 R008C05 Populus root cDNA library Po... 70 3e-010
gb|CA822162.1|CA822162 R04E02 two-month-old roots from clon... 70 3e-010
gb|CF233156.1|CF233156 PtaJXO0020A12A1202 Poplar cDNA libra... 70 3e-010
gb|CF233412.1|CF233412 PtaJXO0023A2A0202 Poplar cDNA librar... 70 3e-010
gb|CF233643.1|CF233643 PtaJXO0026A12A1202 Poplar cDNA libra... 70 3e-010
gb|CN518286.1|CN518286 GQ0094.B3_I24 GQ009 Populus trichoca... 70 3e-010
gb|CK318643.1|CK318643 X9P01f05 Populus stem seasonal libra... 70 3e-010
gb|CK318675.1|CK318675 X9P02b05 Populus stem seasonal libra... 70 3e-010
gb|AJ775843.1|AJ775843 AJ775843 Populus euphratica root 3-6... 70 3e-010
gb|AJ777216.1|AJ777216 AJ777216 Populus euphratica root 3-6... 70 3e-010
gb|CV239687.1|CV239687 WS0233.B21_C21 PT-MB-A-13 Populus tr... 70 3e-010
gb|CX169619.1|CX169619 D08_69-82_08.ab1 leaf inoculated wit... 70 3e-010
gb|CX178864.1|CX178864 E05_45-90_09.ab1 leaf inoculated wit... 70 3e-010
gb|CX183246.1|CX183246 D12_45-97_08.ab1 leaf inoculated wit... 70 3e-010
gb|CX184941.1|CX184941 F10_45-28_12.ab1 leaf inoculated wit... 70 3e-010
gb|CX186392.1|CX186392 D03_45-22_07.ab1 leaf inoculated wit... 70 3e-010
gb|BP924148.1|BP924148 BP924148 full-length enriched poplar... 70 3e-010
gb|BP924882.1|BP924882 BP924882 full-length enriched poplar... 70 3e-010
gb|DT501514.1|DT501514 WS01313.BR_B08 PTxD-IL-FL-A-4 Populu... 70 3e-010
emb|A24083.1| pPOPCAD1 cinnamyl alcohol dehydrogenase cDNA 70 3e-010
gb|AF217957.1|AF217957 Populus tremuloides cinnamyl alcohol... 70 3e-010
gb|AY479972.1| Populus tomentosa cinnamyl alcohol dehydroge... 70 3e-010
gb|AY596170.1| Populus tomentosa cinnamyl alcohol dehydroge... 70 3e-010
emb|AJ295837.1|PTR295837 Populus balsamifera subsp. trichoc... 70 3e-010
emb|Z19568.1|PDCIALDHA P.deltoides encoding cinnamyl alcoho... 70 3e-010
gb|CA822274.1|CA822274 R05H05 two-month-old roots from clon... 68 1e-009
gb|CF227789.1|CF227789 PtaXM0004F6F0612 Poplar cDNA library... 62 7e-008
gb|CF235088.1|CF235088 PtaJXT0018G2G0214 Poplar cDNA librar... 62 7e-008
gb|CK319537.1|CK319537 X9P11h05 Populus stem seasonal libra... 56 4e-006
gb|AI162666.1|AI162666 A021P35U Hybrid aspen plasmid librar... 46 0.004
gb|BU810945.1|BU810945 UL78TB01 Populus leaf cDNA library P... 46 0.004
gb|AI162401.1|AI162401 A017P09U Hybrid aspen plasmid librar... 44 0.017
gb|AI165779.1|AI165779 A091p26u Hybrid aspen plasmid librar... 44 0.017
gb|BI127700.1|BI127700 G064P54Y Populus cambium cDNA librar... 44 0.017
gb|BI130815.1|BI130815 G111P20Y Populus cambium cDNA librar... 44 0.017
gb|CK087231.1|CK087231 A001P14.3pR Hybrid aspen plasmid lib... 44 0.017
gb|CK117473.1|CK117473 B051P56 Hybrid aspen plasmid library... 44 0.017
gb|AJ780854.1|AJ780854 AJ780854 Populus euphratica leaf 3-6... 44 0.017
>gb|BU820895.1|BU820895 UB16CPB08 Populus tremula cambium cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 430
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 395 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 341
>gb|BU883248.1|BU883248 UM88TB04 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 575
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 413 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 359
>gb|BU883429.1|BU883429 UM90TF01 Populus flower cDNA library Populus trichocarpa cDNA 5
prime, mRNA sequence
Length = 543
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 131 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 77
>gb|BU884254.1|BU884254 R008C05 Populus root cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 608
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 408 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 354
>gb|CA822162.1|CA822162 R04E02 two-month-old roots from clone 'Beaupre' Populus trichocarpa x
Populus deltoides cDNA 5', mRNA sequence
Length = 580
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 256 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 202
>gb|CF233156.1|CF233156 PtaJXO0020A12A1202 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 613
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 102 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 48
>gb|CF233412.1|CF233412 PtaJXO0023A2A0202 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 636
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 444 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 390
>gb|CF233643.1|CF233643 PtaJXO0026A12A1202 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 647
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 436 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 382
>gb|CN518286.1|CN518286 GQ0094.B3_I24 GQ009 Populus trichocarpa x Populus deltoides cDNA
clone GQ0094_I24 5', mRNA sequence
Length = 523
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 423 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 369
>gb|CK318643.1|CK318643 X9P01f05 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 682
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 153 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 99
>gb|CK318675.1|CK318675 X9P02b05 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 559
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 185 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 131
>gb|AJ775843.1|AJ775843 AJ775843 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400006C04F1, mRNA sequence
Length = 570
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 415 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 361
>gb|AJ777216.1|AJ777216 AJ777216 Populus euphratica root 3-6 months Populus euphratica cDNA
clone P0000400024H04F1, mRNA sequence
Length = 602
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 411 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 357
>gb|CV239687.1|CV239687 WS0233.B21_C21 PT-MB-A-13 Populus trichocarpa cDNA clone WS0233_C21
3', mRNA sequence
Length = 741
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Plus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 462 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 516
>gb|CX169619.1|CX169619 D08_69-82_08.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 618
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 432 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 378
Score = 48.1 bits (24), Expect = 0.001
Identities = 54/64 (84%)
Strand = Plus / Minus
Query: 1011 tcagcccaaagtgcttcagcgggctgtacaccgtcacgccagcgcacagcagcggcgccg 1070
|||| |||||||| || ||||||||||| || |||| |||||||||| |||||||| |
Sbjct: 581 tcagtccaaagtgtttaagcgggctgtaaactgtcaatccagcgcacaatagcggcgctg 522
Query: 1071 cttg 1074
||||
Sbjct: 521 cttg 518
>gb|CX178864.1|CX178864 E05_45-90_09.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 616
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 429 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 375
>gb|CX183246.1|CX183246 D12_45-97_08.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 616
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 433 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 379
>gb|CX184941.1|CX184941 F10_45-28_12.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 626
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 415 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 361
>gb|CX186392.1|CX186392 D03_45-22_07.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 630
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 415 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 361
>gb|BP924148.1|BP924148 BP924148 full-length enriched poplar cDNA library Populus nigra cDNA
clone PnFL1-028_P16.f 5', mRNA sequence
Length = 502
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 435 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 381
>gb|BP924882.1|BP924882 BP924882 full-length enriched poplar cDNA library Populus nigra cDNA
clone PnFL1-037_J18.f 5', mRNA sequence
Length = 547
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 435 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 381
>gb|DT501514.1|DT501514 WS01313.BR_B08 PTxD-IL-FL-A-4 Populus trichocarpa x Populus deltoides
cDNA clone WS01313_B08 5', mRNA sequence
Length = 683
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 436 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 382
>emb|A24083.1| pPOPCAD1 cinnamyl alcohol dehydrogenase cDNA
Length = 1285
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 410 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 356
>gb|AF217957.1|AF217957 Populus tremuloides cinnamyl alcohol dehydrogenase mRNA, complete cds
Length = 1395
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 423 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 369
>gb|AY479972.1| Populus tomentosa cinnamyl alcohol dehydrogenase (CAD) mRNA, complete
cds
Length = 1309
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 413 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 359
>gb|AY596170.1| Populus tomentosa cinnamyl alcohol dehydrogenases gene, complete cds
Length = 2125
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 719 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 665
>emb|AJ295837.1|PTR295837 Populus balsamifera subsp. trichocarpa cad gene for cinnamyl alcohol
dehydrogenase, exons 1-5
Length = 3065
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 1565 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 1511
>emb|Z19568.1|PDCIALDHA P.deltoides encoding cinnamyl alcohol dehydrogenase
Length = 1305
Score = 69.9 bits (35), Expect = 3e-010
Identities = 50/55 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 410 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 356
>gb|CA822274.1|CA822274 R05H05 two-month-old roots from clone 'Beaupre' Populus trichocarpa x
Populus deltoides cDNA 5', mRNA sequence
Length = 633
Score = 67.9 bits (34), Expect = 1e-009
Identities = 49/54 (90%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctca 1213
|||||||||||||| || ||||| |||||||| |||||||||||||| ||||||
Sbjct: 77 ccatcagtgtagacatcattgtaagaccagattttcttgttgcagtattgctca 24
>gb|CF227789.1|CF227789 PtaXM0004F6F0612 Poplar cDNA library from mature xylem Populus alba x
Populus tremula cDNA 5', mRNA sequence
Length = 609
Score = 61.9 bits (31), Expect = 7e-008
Identities = 49/55 (89%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
||||| |||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 150 ccatcggtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 96
>gb|CF235088.1|CF235088 PtaJXT0018G2G0214 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 640
Score = 61.9 bits (31), Expect = 7e-008
Identities = 49/55 (89%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
||||| |||||||| || ||||| |||||||| |||||||||||||| |||||||
Sbjct: 177 ccatcggtgtagacatcattgtaagaccagattttcttgttgcagtattgctcaa 123
>gb|CK319537.1|CK319537 X9P11h05 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 519
Score = 56.0 bits (28), Expect = 4e-006
Identities = 48/55 (87%)
Strand = Plus / Minus
Query: 1160 ccatcagtgtagacgtcgttgtatgaccagatcttcttgttgcagtactgctcaa 1214
|||||||||||||| || ||||| |||||||| ||||||| ||||| |||||||
Sbjct: 366 ccatcagtgtagacatcattgtaagaccagattttcttgtgncagtattgctcaa 312
>gb|AI162666.1|AI162666 A021P35U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 522
Score = 46.1 bits (23), Expect = 0.004
Identities = 29/31 (93%)
Strand = Plus / Minus
Query: 1184 gaccagatcttcttgttgcagtactgctcaa 1214
|||||||| |||||||||||||| |||||||
Sbjct: 387 gaccagattttcttgttgcagtattgctcaa 357
>gb|BU810945.1|BU810945 UL78TB01 Populus leaf cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 436
Score = 46.1 bits (23), Expect = 0.004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 1178 ttgtatgaccagatcttcttgttgcagtactgctc 1212
||||| |||||||| |||||||||||||| |||||
Sbjct: 426 ttgtaagaccagattttcttgttgcagtattgctc 392
>gb|AI162401.1|AI162401 A017P09U Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 607
Score = 44.1 bits (22), Expect = 0.017
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 926 tggtggcccatggccttggctaccttcacgcccatgtg 963
||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 178 tggtgtcccattgcctttgctaccttcacccccatgtg 141
>gb|AI165779.1|AI165779 A091p26u Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA 5', mRNA sequence
Length = 352
Score = 44.1 bits (22), Expect = 0.017
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 926 tggtggcccatggccttggctaccttcacgcccatgtg 963
||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 170 tggtgtcccattgcctttgctaccttcacccccatgtg 133
>gb|BI127700.1|BI127700 G064P54Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 549
Score = 44.1 bits (22), Expect = 0.017
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 926 tggtggcccatggccttggctaccttcacgcccatgtg 963
||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 197 tggtgtcccattgcctttgctaccttcacccccatgtg 160
>gb|BI130815.1|BI130815 G111P20Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 404
Score = 44.1 bits (22), Expect = 0.017
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 926 tggtggcccatggccttggctaccttcacgcccatgtg 963
||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 197 tggtgtcccattgcctttgctaccttcacccccatgtg 160
>gb|CK087231.1|CK087231 A001P14.3pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A001P14 3', mRNA sequence
Length = 782
Score = 44.1 bits (22), Expect = 0.017
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 926 tggtggcccatggccttggctaccttcacgcccatgtg 963
||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 623 tggtgtcccattgcctttgctaccttcacccccatgtg 660
>gb|CK117473.1|CK117473 B051P56 Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone B051P56 5', mRNA sequence
Length = 342
Score = 44.1 bits (22), Expect = 0.017
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 926 tggtggcccatggccttggctaccttcacgcccatgtg 963
||||| ||||| ||||| ||||||||||| ||||||||
Sbjct: 114 tggtgtcccattgcctttgctaccttcacccccatgtg 77
>gb|AJ780854.1|AJ780854 AJ780854 Populus euphratica leaf 3-6 months Populus euphratica cDNA
clone P0000900014C03F1, mRNA sequence
Length = 468
Score = 44.1 bits (22), Expect = 0.017
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 1400 tggcagatcccgcagtagagcacctt 1425
||||| ||||||||||||||||||||
Sbjct: 256 tggcatatcccgcagtagagcacctt 281
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 123,064
Number of Sequences: 369679
Number of extensions: 123064
Number of successful extensions: 34849
Number of sequences better than 0.5: 41
Number of HSP's better than 0.5 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34743
Number of HSP's gapped (non-prelim): 106
length of query: 1669
length of database: 203,408,664
effective HSP length: 20
effective length of query: 1649
effective length of database: 196,015,084
effective search space: 323228873516
effective search space used: 323228873516
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)