BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2192909.2.3
(674 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA823580.1|CA823580 R28D11 two-month-old roots from clon... 42 0.027
gb|CK099900.1|CK099900 A088P52.5pR Hybrid aspen plasmid lib... 42 0.027
gb|U50522.1|PTU50522 Populus tremuloides caffeic acid O-met... 42 0.027
dbj|D49711.1|POPHOMT3B Populus kitakamiensis (P. sieboldii ... 42 0.027
gb|CN518513.1|CN518513 GQ0094.B3_D03 GQ009 Populus trichoca... 38 0.42
gb|CN524481.1|CN524481 GQ015M13.T3_B02 GQ015 Populus tricho... 38 0.42
gb|CN550533.1|CN550533 GQ0243.B3_K18 GQ024 Populus trichoca... 38 0.42
gb|CK318925.1|CK318925 X9P04h05 Populus stem seasonal libra... 38 0.42
gb|CK319108.1|CK319108 X9P07a02 Populus stem seasonal libra... 38 0.42
gb|CK319115.1|CK319115 X9P07a12 Populus stem seasonal libra... 38 0.42
gb|CK319284.1|CK319284 X9P09a07 Populus stem seasonal libra... 38 0.42
gb|CV225407.1|CV225407 WS0161.B21_E21 PT-DX-A-7 Populus tri... 38 0.42
gb|CV227518.1|CV227518 WS0167.B21_G15 PT-DX-A-7 Populus tri... 38 0.42
gb|CV229588.1|CV229588 WS01913.B21_M20 PT-DX-N-A-10 Populus... 38 0.42
gb|CV231042.1|CV231042 WS0193.B21_G01 PT-DX-N-A-10 Populus ... 38 0.42
gb|CV231165.1|CV231165 WS0193.B21_L15 PT-DX-N-A-10 Populus ... 38 0.42
gb|CV235507.1|CV235507 WS0122.B21_G17 PT-GT-FL-A-3 Populus ... 38 0.42
gb|CV237447.1|CV237447 WS01227.B21_B24 PT-GT-FL-A-3 Populus... 38 0.42
gb|CV237542.1|CV237542 WS0123.B21_D04 PT-GT-FL-A-3 Populus ... 38 0.42
gb|CV251453.1|CV251453 WS0117.B21_B01 PT-P-FL-A-2 Populus t... 38 0.42
gb|CV252549.1|CV252549 PX0015.B21_D06 PT-X-FL-A-1 Populus t... 38 0.42
gb|CV253264.1|CV253264 WS0221.B21_G11 PTxD-ICC-A-12 Populus... 38 0.42
gb|CV257716.1|CV257716 WS0247.B21_H06 PTxD-ICC-N-A-14 Popul... 38 0.42
gb|CV258013.1|CV258013 WS0248.B21_E16 PTxD-ICC-N-A-14 Popul... 38 0.42
gb|CV261308.1|CV261308 WS02016.B21_G21 PTxN-IB-N-A-11 Popul... 38 0.42
gb|CV265340.1|CV265340 WS02026.B21_P18 PTxN-IB-N-A-11 Popul... 38 0.42
gb|CV268703.1|CV268703 WS0206.B21_D12 PTxN-IB-N-A-11 Populu... 38 0.42
gb|CV272694.1|CV272694 WS0158.B21_G20 PTxN-IB-A-6 Populus t... 38 0.42
gb|BP930707.1|BP930707 BP930707 full-length enriched poplar... 38 0.42
gb|BP931958.1|BP931958 BP931958 full-length enriched poplar... 38 0.42
gb|BP932474.1|BP932474 BP932474 full-length enriched poplar... 38 0.42
gb|BP935106.1|BP935106 BP935106 full-length enriched poplar... 38 0.42
gb|DT470070.1|DT470070 WS01919.C21_M11 PT-DX-N-A-10 Populus... 38 0.42
gb|DT484752.1|DT484752 WS02526.B21_F05 PT-MB-N-A-15 Populus... 38 0.42
gb|DT490728.1|DT490728 WS02545.B21_M12 PT-MB-N-A-15 Populus... 38 0.42
gb|DT511606.1|DT511606 WS02416.B21_O19 PTxD-ICC-N-A-14 Popu... 38 0.42
gb|DT521423.1|DT521423 WS02034.B21_D24 PTxN-IB-N-A-11 Popul... 38 0.42
gb|DT526195.1|DT526195 WS02047.C21_G02 PTxN-IB-N-A-11 Popul... 38 0.42
gb|M73431.1|POPOME Populus x generosa tissue-type leaf O-me... 38 0.42
emb|A26484.1| Poplar pPLC4 38 0.42
emb|X62096.1|PTLBCA P. tremuloides mRNA for lignin bispecif... 38 0.42
>gb|CA823580.1|CA823580 R28D11 two-month-old roots from clone 'Beaupre' Populus trichocarpa
x Populus deltoides cDNA 5', mRNA sequence
Length = 531
Score = 42.1 bits (21), Expect = 0.027
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 615 gcagtgcgcgtcgctccagtcgtggaggatccacttcatga 655
|||||||||||||||||| || ||| |||||||||||||
Sbjct: 526 gcagtgcgcgtcgctccaatcatggcatatccacttcatga 486
>gb|CK099900.1|CK099900 A088P52.5pR Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone A088P52 5', mRNA sequence
Length = 419
Score = 42.1 bits (21), Expect = 0.027
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 574 ttttccggcagcgcgtcgtagcagttctt 602
|||||||||||||| || |||||||||||
Sbjct: 225 ttttccggcagcgcatcatagcagttctt 197
>gb|U50522.1|PTU50522 Populus tremuloides caffeic acid O-methyltransferase (PTOMTG2) gene,
complete cds
Length = 1859
Score = 42.1 bits (21), Expect = 0.027
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 574 ttttccggcagcgcgtcgtagcagttctt 602
|||||||||||||| || |||||||||||
Sbjct: 1630 ttttccggcagcgcatcatagcagttctt 1602
>dbj|D49711.1|POPHOMT3B Populus kitakamiensis (P. sieboldii X P. grandidentata) homt3 gene
for caffeic acid O-methyltransferase, complete cds
(exon1-4)
Length = 4785
Score = 42.1 bits (21), Expect = 0.027
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 574 ttttccggcagcgcgtcgtagcagttctt 602
|||||||||||||| || |||||||||||
Sbjct: 4435 ttttccggcagcgcatcatagcagttctt 4407
>gb|CN518513.1|CN518513 GQ0094.B3_D03 GQ009 Populus trichocarpa x Populus deltoides cDNA
clone GQ0094_D03 5', mRNA sequence
Length = 601
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 422 ccggggttgtgcgccagcatgat 400
>gb|CN524481.1|CN524481 GQ015M13.T3_B02 GQ015 Populus trichocarpa x Populus deltoides cDNA
clone GQ015M13_B02 5', mRNA sequence
Length = 812
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 665 ccggggttgtgcgccagcatgat 643
>gb|CN550533.1|CN550533 GQ0243.B3_K18 GQ024 Populus trichocarpa x Populus deltoides cDNA
clone GQ0243_K18 5', mRNA sequence
Length = 385
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 61 ccggggttgtgcgccagcatgat 39
>gb|CK318925.1|CK318925 X9P04h05 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 574
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 453 ccggggttgtgcgccagcatgat 431
>gb|CK319108.1|CK319108 X9P07a02 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 640
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 419 ccggggttgtgcgccagcatgat 397
>gb|CK319115.1|CK319115 X9P07a12 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 708
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 590 ccggggttgtgcgccagcatgat 568
>gb|CK319284.1|CK319284 X9P09a07 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 782
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 683 ccggggttgtgcgccagcatgat 661
>gb|CV225407.1|CV225407 WS0161.B21_E21 PT-DX-A-7 Populus trichocarpa cDNA clone WS0161_E21
3', mRNA sequence
Length = 846
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 459 ccggggttgtgcgccagcatgat 481
>gb|CV227518.1|CV227518 WS0167.B21_G15 PT-DX-A-7 Populus trichocarpa cDNA clone WS0167_G15
3', mRNA sequence
Length = 899
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 367 ccggggttgtgcgccagcatgat 389
>gb|CV229588.1|CV229588 WS01913.B21_M20 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01913_M20 3', mRNA sequence
Length = 806
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 441 ccggggttgtgcgccagcatgat 463
>gb|CV231042.1|CV231042 WS0193.B21_G01 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS0193_G01 3', mRNA sequence
Length = 872
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 368 ccggggttgtgcgccagcatgat 390
>gb|CV231165.1|CV231165 WS0193.B21_L15 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS0193_L15 3', mRNA sequence
Length = 880
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 582 ccggggttgtgcgccagcatgat 560
>gb|CV235507.1|CV235507 WS0122.B21_G17 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0122_G17 3', mRNA sequence
Length = 570
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 343 ccggggttgtgcgccagcatgat 365
>gb|CV237447.1|CV237447 WS01227.B21_B24 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS01227_B24 3', mRNA sequence
Length = 847
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 446 ccggggttgtgcgccagcatgat 468
>gb|CV237542.1|CV237542 WS0123.B21_D04 PT-GT-FL-A-3 Populus trichocarpa cDNA clone
WS0123_D04 3', mRNA sequence
Length = 683
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 437 ccggggttgtgcgccagcatgat 459
>gb|CV251453.1|CV251453 WS0117.B21_B01 PT-P-FL-A-2 Populus trichocarpa cDNA clone
WS0117_B01 3', mRNA sequence
Length = 666
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 441 ccggggttgtgcgccagcatgat 463
>gb|CV252549.1|CV252549 PX0015.B21_D06 PT-X-FL-A-1 Populus trichocarpa cDNA clone
PX0015_D06 3', mRNA sequence
Length = 648
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 420 ccggggttgtgcgccagcatgat 442
>gb|CV253264.1|CV253264 WS0221.B21_G11 PTxD-ICC-A-12 Populus trichocarpa x Populus
deltoides cDNA clone WS0221_G11 3', mRNA sequence
Length = 745
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 472 ccggggttgtgcgccagcatgat 494
>gb|CV257716.1|CV257716 WS0247.B21_H06 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0247_H06 3', mRNA sequence
Length = 691
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 417 ccggggttgtgcgccagcatgat 439
>gb|CV258013.1|CV258013 WS0248.B21_E16 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS0248_E16 3', mRNA sequence
Length = 723
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 458 ccggggttgtgcgccagcatgat 480
>gb|CV261308.1|CV261308 WS02016.B21_G21 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02016_G21 3', mRNA sequence
Length = 935
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 459 ccggggttgtgcgccagcatgat 437
>gb|CV265340.1|CV265340 WS02026.B21_P18 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02026_P18 3', mRNA sequence
Length = 839
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 417 ccggggttgtgcgccagcatgat 439
>gb|CV268703.1|CV268703 WS0206.B21_D12 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS0206_D12 3', mRNA sequence
Length = 656
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 291 ccggggttgtgcgccagcatgat 313
>gb|CV272694.1|CV272694 WS0158.B21_G20 PTxN-IB-A-6 Populus trichocarpa x Populus nigra cDNA
clone WS0158_G20 3', mRNA sequence
Length = 869
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 444 ccggggttgtgcgccagcatgat 466
>gb|BP930707.1|BP930707 BP930707 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-013_K22.r 3', mRNA sequence
Length = 359
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 220 ccggggttgtgcgccagcatgat 242
>gb|BP931958.1|BP931958 BP931958 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-030_C05.r 3', mRNA sequence
Length = 569
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 283 ccggggttgtgcgccagcatgat 305
>gb|BP932474.1|BP932474 BP932474 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-036_J16.r 3', mRNA sequence
Length = 509
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 472 ccggggttgtgcgccagcatgat 494
>gb|BP935106.1|BP935106 BP935106 full-length enriched poplar cDNA library Populus nigra
cDNA clone PnFL1-073_M13.r 3', mRNA sequence
Length = 574
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 341 ccggggttgtgcgccagcatgat 363
>gb|DT470070.1|DT470070 WS01919.C21_M11 PT-DX-N-A-10 Populus trichocarpa cDNA clone
WS01919_M11 3', mRNA sequence
Length = 573
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 441 ccggggttgtgcgccagcatgat 463
>gb|DT484752.1|DT484752 WS02526.B21_F05 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02526_F05 3', mRNA sequence
Length = 838
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 326 ccggggttgtgcgccagcatgat 348
>gb|DT490728.1|DT490728 WS02545.B21_M12 PT-MB-N-A-15 Populus trichocarpa cDNA clone
WS02545_M12 3', mRNA sequence
Length = 841
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 448 ccggggttgtgcgccagcatgat 470
>gb|DT511606.1|DT511606 WS02416.B21_O19 PTxD-ICC-N-A-14 Populus trichocarpa x Populus
deltoides cDNA clone WS02416_O19 3', mRNA sequence
Length = 927
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 347 ccggggttgtgcgccagcatgat 369
>gb|DT521423.1|DT521423 WS02034.B21_D24 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02034_D24 3', mRNA sequence
Length = 544
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 445 ccggggttgtgcgccagcatgat 467
>gb|DT526195.1|DT526195 WS02047.C21_G02 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02047_G02 3', mRNA sequence
Length = 732
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 441 ccggggttgtgcgccagcatgat 463
>gb|M73431.1|POPOME Populus x generosa tissue-type leaf O-methyltransferase mRNA,
complete cds
Length = 1375
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 1032 ccggggttgtgcgccagcatgat 1010
>emb|A26484.1| Poplar pPLC4
Length = 1368
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 1025 ccggggttgtgcgccagcatgat 1003
>emb|X62096.1|PTLBCA P. tremuloides mRNA for lignin bispecific caffeic
acid/5-hydroxyferulic acid O-methyl transferase
Length = 1503
Score = 38.2 bits (19), Expect = 0.42
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 466 ccggggttgtgcgcgagcatgat 488
|||||||||||||| ||||||||
Sbjct: 1041 ccggggttgtgcgccagcatgat 1019
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 67,611
Number of Sequences: 369679
Number of extensions: 67611
Number of successful extensions: 18714
Number of sequences better than 0.5: 41
Number of HSP's better than 0.5 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18636
Number of HSP's gapped (non-prelim): 78
length of query: 674
length of database: 203,408,664
effective HSP length: 19
effective length of query: 655
effective length of database: 196,384,763
effective search space: 128632019765
effective search space used: 128632019765
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)