BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2188214.2.1
         (880 letters)

Database: Populus_nucl_with_EST.fasta 
           369,679 sequences; 203,408,664 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AJ780615.1|AJ780615  AJ780615 Populus euphratica leaf 3-6...    54   9e-006
gb|AJ771301.1|AJ771301  AJ771301 Populus euphratica leaf 3-6...    50   1e-004
gb|AJ771403.1|AJ771403  AJ771403 Populus euphratica leaf 3-6...    48   6e-004

>gb|AJ780615.1|AJ780615 AJ780615 Populus euphratica leaf 3-6 months Populus euphratica cDNA
           clone P0000900010D02F1, mRNA sequence
          Length = 675

 Score = 54.0 bits (27), Expect = 9e-006
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 735 tcccatgccttcgacatgtcacaaaccgacttggagcaaagggggca 781
           |||||| |||| |||||||||||||| ||||| |||||||| |||||
Sbjct: 375 tcccataccttagacatgtcacaaactgacttcgagcaaagagggca 421



>gb|AJ771301.1|AJ771301 AJ771301 Populus euphratica leaf 3-6 months Populus euphratica cDNA
           clone P0001500004F10F1, mRNA sequence
          Length = 564

 Score = 50.1 bits (25), Expect = 1e-004
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 735 tcccatgccttcgacatgtcacaaaccgacttggagcaaag 775
           |||||| |||| |||||||||||||| ||||| ||||||||
Sbjct: 375 tcccataccttagacatgtcacaaactgacttcgagcaaag 415



>gb|AJ771403.1|AJ771403 AJ771403 Populus euphratica leaf 3-6 months Populus euphratica cDNA
           clone P0001500006E11F1, mRNA sequence
          Length = 623

 Score = 48.1 bits (24), Expect = 6e-004
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 742 ccttcgacatgtcacaaaccgacttggagcaaagggggca 781
           |||| |||||||||||||| ||||| |||||||| |||||
Sbjct: 382 ccttagacatgtcacaaactgacttcgagcaaagagggca 421



  Database: Populus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:49 PM
  Number of letters in database: 203,408,664
  Number of sequences in database:  369,679
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 87,222
Number of Sequences: 369679
Number of extensions: 87222
Number of successful extensions: 26650
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 26647
Number of HSP's gapped (non-prelim): 3
length of query: 880
length of database: 203,408,664
effective HSP length: 19
effective length of query: 861
effective length of database: 196,384,763
effective search space: 169087280943
effective search space used: 169087280943
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)