BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.280
(3445 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BI128110.1|BI128110 G070P93Y Populus cambium cDNA librar... 167 4e-039
gb|BI128475.1|BI128475 G076P35Y Populus cambium cDNA librar... 167 4e-039
gb|BI130293.1|BI130293 G103P48Y Populus cambium cDNA librar... 167 4e-039
gb|BI132288.1|BI132288 G134P67Y Populus cambium cDNA librar... 167 4e-039
gb|BU831561.1|BU831561 T023A06 Populus apical shoot cDNA li... 167 4e-039
gb|CF233496.1|CF233496 PtaJXO0024C6C0606 Poplar cDNA librar... 167 4e-039
gb|CF234458.1|CF234458 Ptajxojxo2H10H1016 Poplar cDNA libra... 167 4e-039
gb|CF234532.1|CF234532 PtaJXO0010H6A0701 Poplar cDNA librar... 167 4e-039
gb|CF234998.1|CF234998 PtaJXT0017F5F0511 Poplar cDNA librar... 167 4e-039
gb|CK103101.1|CK103101 G103P49.5pR Populus tension wood cDN... 167 4e-039
gb|CN517761.1|CN517761 GQ0092.B3_J09 GQ009 Populus trichoca... 167 4e-039
gb|CN519255.1|CN519255 GQ0104.B3_D16 GQ010 Populus trichoca... 167 4e-039
gb|CN520973.1|CN520973 GQ0105.B3_K21 GQ010 Populus trichoca... 167 4e-039
gb|CK319038.1|CK319038 X9P06b12 Populus stem seasonal libra... 167 4e-039
gb|CK320848.1|CK320848 X9SP07c09 Populus stem seasonal libr... 167 4e-039
gb|CX169075.1|CX169075 F08_69-78_12.ab1 leaf inoculated wit... 167 4e-039
gb|AY341026.1| Populus tremuloides sucrose synthase mRNA, c... 167 4e-039
gb|BI129484.1|BI129484 G091P27Y Populus cambium cDNA librar... 165 1e-038
gb|CF236082.1|CF236082 PtaJXT0030D7D0707 Poplar cDNA librar... 161 2e-037
gb|CN522671.1|CN522671 GQ0124.B3_M16 GQ012 Populus trichoca... 161 2e-037
gb|BI128937.1|BI128937 G083P76Y Populus cambium cDNA librar... 159 9e-037
gb|CF235263.1|CF235263 PtaJXT0020F9F0911 Poplar cDNA librar... 159 9e-037
gb|CF233466.1|CF233466 PtaJXO0023H9H0915 Poplar cDNA librar... 135 1e-029
gb|BI127350.1|BI127350 G058P96Y Populus cambium cDNA librar... 131 2e-028
gb|BI130456.1|BI130456 G105P82Y Populus cambium cDNA librar... 131 2e-028
gb|BI130652.1|BI130652 G108P76Y Populus cambium cDNA librar... 131 2e-028
gb|CF235850.1|CF235850 PtaJXT0027G3G0313 Poplar cDNA librar... 131 2e-028
gb|CK103506.1|CK103506 G120P78.5pR Populus tension wood cDN... 131 2e-028
gb|CF233979.1|CF233979 PtaJXO0029H3H0315 Poplar cDNA librar... 127 3e-027
gb|CF234728.1|CF234728 PtaJXT0014D8D0808 Poplar cDNA librar... 127 3e-027
gb|CK107902.1|CK107902 G058P96 Populus tension wood cDNA li... 127 3e-027
gb|BI131553.1|BI131553 G122P47Y Populus cambium cDNA librar... 125 1e-026
gb|BU821510.1|BU821510 UB24CPB03 Populus tremula cambium cD... 123 5e-026
gb|CF236455.1|CF236455 PtaJXT3A12A1202 Poplar cDNA library ... 123 5e-026
gb|CF237149.1|CF237149 Ptajxtjxt2F5F0511 Poplar cDNA librar... 123 5e-026
gb|BI130516.1|BI130516 G106P67Y Populus cambium cDNA librar... 121 2e-025
gb|BU814342.1|BU814342 N028B03 Populus bark cDNA library Po... 121 2e-025
gb|BU824841.1|BU824841 UK100E04 Populus apical shoot cDNA l... 121 2e-025
gb|BU866311.1|BU866311 S065C02 Populus imbibed seed cDNA li... 121 2e-025
gb|CK116674.1|CK116674 B015P50 Hybrid aspen plasmid library... 121 2e-025
gb|CV261825.1|CV261825 WS02017.B21_O03 PTxN-IB-N-A-11 Popul... 121 2e-025
gb|CX179218.1|CX179218 G04_45-72_14.ab1 leaf inoculated wit... 121 2e-025
gb|CX183403.1|CX183403 B05_45-72_03.ab1 leaf inoculated wit... 121 2e-025
gb|DT524905.1|DT524905 WS02043.C21_O13 PTxN-IB-N-A-11 Popul... 121 2e-025
gb|DT525148.1|DT525148 WS02044.C21_J05 PTxN-IB-N-A-11 Popul... 121 2e-025
gb|BI131388.1|BI131388 G120P19Y Populus cambium cDNA librar... 119 7e-025
gb|BU816910.1|BU816910 UA10BPG02 Populus tremula cambium cD... 119 7e-025
gb|BU817019.1|BU817019 UA11BPH10 Populus tremula cambium cD... 119 7e-025
gb|BU820043.1|BU820043 UA50BPF05 Populus tremula cambium cD... 119 7e-025
gb|BU824605.1|BU824605 UB66DPE12 Populus tremula cambium cD... 119 7e-025
gb|BU864414.1|BU864414 S040C08 Populus imbibed seed cDNA li... 119 7e-025
gb|BU864427.1|BU864427 S040D09 Populus imbibed seed cDNA li... 119 7e-025
gb|BU864529.1|BU864529 S041F11 Populus imbibed seed cDNA li... 119 7e-025
gb|BU875627.1|BU875627 V009D03 Populus flower cDNA library ... 119 7e-025
gb|CF228376.1|CF228376 PtaXM0012C2C0206 Poplar cDNA library... 119 7e-025
gb|CF229261.1|CF229261 PtaXM0023B9B0903 Poplar cDNA library... 119 7e-025
gb|CF229564.1|CF229564 PtaXM0027A2A0202 Poplar cDNA library... 119 7e-025
gb|CF232540.1|CF232540 PtaJXO0011F9F0911 Poplar cDNA librar... 119 7e-025
gb|CF235494.1|CF235494 PtaJXT0023E5E0509 Poplar cDNA librar... 119 7e-025
gb|CF236425.1|CF236425 PtaJXT2F1F0111 Poplar cDNA library f... 119 7e-025
gb|CK095476.1|CK095476 UA10BPG02.3pR Populus dormant cambiu... 119 7e-025
gb|CV226488.1|CV226488 WS0164.B21_G16 PT-DX-A-7 Populus tri... 119 7e-025
gb|CV231513.1|CV231513 WS0194.B21_M07 PT-DX-N-A-10 Populus ... 119 7e-025
gb|CV246146.1|CV246146 WS0111.B21_H03 PT-P-FL-A-2 Populus t... 119 7e-025
gb|CV246242.1|CV246242 WS0111.B21_L22 PT-P-FL-A-2 Populus t... 119 7e-025
gb|CV246264.1|CV246264 WS0111.B21_N05 PT-P-FL-A-2 Populus t... 119 7e-025
gb|CV246429.1|CV246429 WS01110.B21_H07 PT-P-FL-A-2 Populus ... 119 7e-025
gb|CV247336.1|CV247336 WS01117.B21_N07 PT-P-FL-A-2 Populus ... 119 7e-025
gb|CV247544.1|CV247544 WS01118.B21_I11 PT-P-FL-A-2 Populus ... 119 7e-025
gb|CV250687.1|CV250687 WS0114.B21_G23 PT-P-FL-A-2 Populus t... 119 7e-025
gb|CV250862.1|CV250862 WS0115.B21_A18 PT-P-FL-A-2 Populus t... 119 7e-025
gb|CV251504.1|CV251504 WS0117.B21_E08 PT-P-FL-A-2 Populus t... 119 7e-025
gb|CV252097.1|CV252097 WS0119.B21_G13 PT-P-FL-A-2 Populus t... 119 7e-025
gb|CV259742.1|CV259742 WS02012.B21_C12 PTxN-IB-N-A-11 Popul... 119 7e-025
gb|CV265098.1|CV265098 WS02026.B21_F04 PTxN-IB-N-A-11 Popul... 119 7e-025
gb|CV267524.1|CV267524 WS02031.B21_P18 PTxN-IB-N-A-11 Popul... 119 7e-025
gb|CV272500.1|CV272500 WS0157.B21_N09 PTxN-IB-A-6 Populus t... 119 7e-025
gb|CV275971.1|CV275971 WS0178.B21.1_D13 PTxD-NR-A-8 Populus... 119 7e-025
gb|CV276660.1|CV276660 WS0141.B21_G23 PTxD-IL-A-5 Populus t... 119 7e-025
gb|CV277390.1|CV277390 WS0143.B21_H10 PTxD-IL-A-5 Populus t... 119 7e-025
gb|CV277436.1|CV277436 WS0143.B21_J09 PTxD-IL-A-5 Populus t... 119 7e-025
gb|CV278280.1|CV278280 WS0145.B21_P09 PTxD-IL-A-5 Populus t... 119 7e-025
gb|CX168710.1|CX168710 B11_69-58_03.ab1 leaf inoculated wit... 119 7e-025
gb|CX173252.1|CX173252 C07_69-5_05.ab1 leaf inoculated with... 119 7e-025
gb|CX186972.1|CX186972 B05_45-45_03.ab1 leaf inoculated wit... 119 7e-025
gb|CX658216.1|CX658216 PO01011C12 Poplar SC cDNA library Po... 119 7e-025
gb|DT469961.1|DT469961 WS01919.C21_H05 PT-DX-N-A-10 Populus... 119 7e-025
gb|DT493207.1|DT493207 WS02553.C21_L10 PT-MB-N-A-15 Populus... 119 7e-025
gb|DT493463.1|DT493463 WS0111.BR_H03 PT-P-FL-A-2 Populus tr... 119 7e-025
gb|DT493565.1|DT493565 WS0111.BR_L22 PT-P-FL-A-2 Populus tr... 119 7e-025
gb|DT493589.1|DT493589 WS0111.BR_N05 PT-P-FL-A-2 Populus tr... 119 7e-025
gb|DT494236.1|DT494236 WS01117.BR_N07 PT-P-FL-A-2 Populus t... 119 7e-025
gb|DT494473.1|DT494473 WS01118.BR.1_I11 PT-P-FL-A-2 Populus... 119 7e-025
gb|DT498120.1|DT498120 WS0114.BR_G23 PT-P-FL-A-2 Populus tr... 119 7e-025
gb|DT498330.1|DT498330 WS0115.BR_A18 PT-P-FL-A-2 Populus tr... 119 7e-025
gb|DT499090.1|DT499090 WS0117.BR_E08 PT-P-FL-A-2 Populus tr... 119 7e-025
gb|DT499896.1|DT499896 WS9991.BR_K13 PT-P-FL-A-2 Populus tr... 119 7e-025
gb|DT499999.1|DT499999 WS9991.BR_O24 PT-P-FL-A-2 Populus tr... 119 7e-025
gb|DT507648.1|DT507648 WS02418.BR_N11 PTxD-ICC-N-A-14 Popul... 119 7e-025
gb|DT512276.1|DT512276 WS02418.B21_N11 PTxD-ICC-N-A-14 Popu... 119 7e-025
gb|DT522373.1|DT522373 WS02036.B21_M23 PTxN-IB-N-A-11 Popul... 119 7e-025
gb|DT523382.1|DT523382 WS02039.B21_I20 PTxN-IB-N-A-11 Popul... 119 7e-025
gb|DT523542.1|DT523542 WS02039.B21_P14 PTxN-IB-N-A-11 Popul... 119 7e-025
gb|DT525489.1|DT525489 WS02045.C21_H19 PTxN-IB-N-A-11 Popul... 119 7e-025
gb|DT526344.1|DT526344 WS02047.C21_M11 PTxN-IB-N-A-11 Popul... 119 7e-025
gb|AI162587.1|AI162587 A019P79U Hybrid aspen plasmid librar... 117 3e-024
gb|BI130908.1|BI130908 G112P52Y Populus cambium cDNA librar... 117 3e-024
gb|CF236412.1|CF236412 PtaJXT2E10E1010 Poplar cDNA library ... 117 3e-024
gb|CV226987.1|CV226987 WS0165.B21_N20 PT-DX-A-7 Populus tri... 117 3e-024
gb|BU837546.1|BU837546 T103A06 Populus apical shoot cDNA li... 113 5e-023
gb|BU875448.1|BU875448 V007C06 Populus flower cDNA library ... 113 5e-023
gb|BU875890.1|BU875890 V012G05 Populus flower cDNA library ... 113 5e-023
gb|BU877380.1|BU877380 V033D03 Populus flower cDNA library ... 113 5e-023
gb|BU881344.1|BU881344 UM61TE11 Populus flower cDNA library... 113 5e-023
gb|CA926004.1|CA926004 MTU7TL.P8.H04 Aspen leaf cDNA Librar... 113 5e-023
gb|CF234305.1|CF234305 PtaJXO4H6H0616 Poplar cDNA library f... 113 5e-023
gb|AJ769690.1|AJ769690 AJ769690 Populus euphratica leaf 3-6... 113 5e-023
gb|CV225812.1|CV225812 WS0162.B21_H12 PT-DX-A-7 Populus tri... 113 5e-023
gb|CV227423.1|CV227423 WS0167.B21_C11 PT-DX-A-7 Populus tri... 113 5e-023
gb|CV246286.1|CV246286 WS0111.B21_O10 PT-P-FL-A-2 Populus t... 113 5e-023
gb|CV246383.1|CV246383 WS01110.B21_E08 PT-P-FL-A-2 Populus ... 113 5e-023
gb|CV246775.1|CV246775 WS01111.B21_O10 PT-P-FL-A-2 Populus ... 113 5e-023
gb|CV247016.1|CV247016 WS01116.B21_M01 PT-P-FL-A-2 Populus ... 113 5e-023
gb|CV247396.1|CV247396 WS01118.B21_A09 PT-P-FL-A-2 Populus ... 113 5e-023
gb|CV247527.1|CV247527 WS01118.B21_H12 PT-P-FL-A-2 Populus ... 113 5e-023
gb|CV248401.1|CV248401 WS01120.B21_J14 PT-P-FL-A-2 Populus ... 113 5e-023
gb|CV249655.1|CV249655 WS01124.B21_O10 PT-P-FL-A-2 Populus ... 113 5e-023
gb|CV250284.1|CV250284 WS0113.B21_B06 PT-P-FL-A-2 Populus t... 113 5e-023
gb|CV250384.1|CV250384 WS0113.B21_G07 PT-P-FL-A-2 Populus t... 113 5e-023
gb|CV251246.1|CV251246 WS0116.B21_F12 PT-P-FL-A-2 Populus t... 113 5e-023
gb|CV252100.1|CV252100 WS0119.B21_G22 PT-P-FL-A-2 Populus t... 113 5e-023
gb|CV255491.1|CV255491 WS02414.B21_C19 PTxD-ICC-N-A-14 Popu... 113 5e-023
gb|CV262118.1|CV262118 WS02018.B21_K22 PTxN-IB-N-A-11 Popul... 113 5e-023
gb|CV268101.1|CV268101 WS0204.B21_I24 PTxN-IB-N-A-11 Populu... 113 5e-023
gb|CV270794.1|CV270794 WS0152.B21_P07 PTxN-IB-A-6 Populus t... 113 5e-023
gb|DT493319.1|DT493319 WS0111.BR_A08 PT-P-FL-A-2 Populus tr... 113 5e-023
gb|DT493613.1|DT493613 WS0111.BR_O10 PT-P-FL-A-2 Populus tr... 113 5e-023
gb|DT493880.1|DT493880 WS01116.BR_M01 PT-P-FL-A-2 Populus t... 113 5e-023
gb|DT494301.1|DT494301 WS01118.BR.1_A09 PT-P-FL-A-2 Populus... 113 5e-023
gb|DT494453.1|DT494453 WS01118.BR.1_H12 PT-P-FL-A-2 Populus... 113 5e-023
gb|DT495481.1|DT495481 WS01120.BR_J14 PT-P-FL-A-2 Populus t... 113 5e-023
gb|DT496906.1|DT496906 WS01124.BR_O10 PT-P-FL-A-2 Populus t... 113 5e-023
gb|DT497647.1|DT497647 WS0113.BR_B06 PT-P-FL-A-2 Populus tr... 113 5e-023
gb|DT497756.1|DT497756 WS0113.BR_G07 PT-P-FL-A-2 Populus tr... 113 5e-023
gb|DT498781.1|DT498781 WS0116.BR_F12 PT-P-FL-A-2 Populus tr... 113 5e-023
gb|BI131418.1|BI131418 G120P61Y Populus cambium cDNA librar... 111 2e-022
gb|BU822429.1|BU822429 UB37DPE06 Populus tremula cambium cD... 111 2e-022
gb|BU831909.1|BU831909 T027B11 Populus apical shoot cDNA li... 111 2e-022
gb|BU836507.1|BU836507 T087D11 Populus apical shoot cDNA li... 111 2e-022
gb|CA925061.1|CA925061 MTU7TL.P13.B04 Aspen leaf cDNA Libra... 111 2e-022
gb|CA925392.1|CA925392 MTU7TL.P17.E12 Aspen leaf cDNA Libra... 111 2e-022
gb|CV251051.1|CV251051 WS0115.B21_K24 PT-P-FL-A-2 Populus t... 111 2e-022
gb|DT518691.1|DT518691 WS02438.B21_P02 PTxD-ICC-N-A-14 Popu... 111 2e-022
gb|BI129788.1|BI129788 G095P61Y Populus cambium cDNA librar... 107 3e-021
gb|BI131617.1|BI131617 G123P33Y Populus cambium cDNA librar... 107 3e-021
gb|BI132218.1|BI132218 G133P37Y Populus cambium cDNA librar... 107 3e-021
gb|BU829217.1|BU829217 K036P73P Populus apical shoot cDNA l... 107 3e-021
gb|AI167022.1|AI167022 xylem.est.797 Poplar xylem Lambda ZA... 105 1e-020
gb|BI127384.1|BI127384 G059P65Y Populus cambium cDNA librar... 105 1e-020
gb|BI127607.1|BI127607 G063P17Y Populus cambium cDNA librar... 105 1e-020
gb|BU829207.1|BU829207 K036P61P Populus apical shoot cDNA l... 105 1e-020
gb|BU833181.1|BU833181 T043C08 Populus apical shoot cDNA li... 105 1e-020
gb|BU835468.1|BU835468 T074C10 Populus apical shoot cDNA li... 105 1e-020
gb|BU836058.1|BU836058 T082B11 Populus apical shoot cDNA li... 105 1e-020
gb|BU864783.1|BU864783 S044H03 Populus imbibed seed cDNA li... 105 1e-020
gb|BU869423.1|BU869423 M129H08 Populus flower cDNA library ... 105 1e-020
gb|BU872419.1|BU872419 Q042G05 Populus flower cDNA library ... 105 1e-020
gb|BU874603.1|BU874603 Q069H03 Populus flower cDNA library ... 105 1e-020
gb|BU877437.1|BU877437 V034A07 Populus flower cDNA library ... 105 1e-020
gb|BU887602.1|BU887602 R064A04 Populus root cDNA library Po... 105 1e-020
gb|CA821735.1|CA821735 RSH06G05 two-month-old roots from cl... 105 1e-020
gb|CF227766.1|CF227766 PtaXM0004D10D1008 Poplar cDNA librar... 105 1e-020
gb|AJ768641.1|AJ768641 AJ768641 Populus euphratica leaf adu... 105 1e-020
gb|AJ779628.1|AJ779628 AJ779628 Populus euphratica root 3-6... 105 1e-020
gb|CV226164.1|CV226164 WS0163.B21_H14 PT-DX-A-7 Populus tri... 105 1e-020
gb|CV231789.1|CV231789 WS0195.B21_J04 PT-DX-N-A-10 Populus ... 105 1e-020
gb|CV233745.1|CV233745 WS01212.B21_D11 PT-GT-FL-A-3 Populus... 105 1e-020
gb|CV233963.1|CV233963 WS01213.B21_A24 PT-GT-FL-A-3 Populus... 105 1e-020
gb|CV234000.1|CV234000 WS01213.B21_D04 PT-GT-FL-A-3 Populus... 105 1e-020
gb|CV234355.1|CV234355 WS01214.B21_J17 PT-GT-FL-A-3 Populus... 105 1e-020
gb|CV235122.1|CV235122 WS01217.B21_N01 PT-GT-FL-A-3 Populus... 105 1e-020
gb|CV236091.1|CV236091 WS01222.B21_M21 PT-GT-FL-A-3 Populus... 105 1e-020
gb|CV237918.1|CV237918 WS0124.B21_J06 PT-GT-FL-A-3 Populus ... 105 1e-020
gb|CV238547.1|CV238547 WS0127.B21.1_B14 PT-GT-FL-A-3 Populu... 105 1e-020
gb|CV239988.1|CV239988 WS0234.B21_B05 PT-MB-A-13 Populus tr... 105 1e-020
gb|CV247265.1|CV247265 WS01117.B21_J10 PT-P-FL-A-2 Populus ... 105 1e-020
gb|CV251049.1|CV251049 WS0115.B21_K21 PT-P-FL-A-2 Populus t... 105 1e-020
gb|CV271911.1|CV271911 WS0156.B21.1_A12 PTxN-IB-A-6 Populus... 105 1e-020
gb|CV276970.1|CV276970 WS0142.B21_E22 PTxD-IL-A-5 Populus t... 105 1e-020
gb|CX168978.1|CX168978 D11_69-4_07.ab1 leaf inoculated with... 105 1e-020
gb|CX657953.1|CX657953 PO01007D07 Poplar SC cDNA library Po... 105 1e-020
gb|DT471092.1|DT471092 WS01212.BR_D11 PT-GT-FL-A-3 Populus ... 105 1e-020
gb|DT471228.1|DT471228 WS01213.BR_A24 PT-GT-FL-A-3 Populus ... 105 1e-020
gb|DT471266.1|DT471266 WS01213.BR_D04 PT-GT-FL-A-3 Populus ... 105 1e-020
gb|DT471650.1|DT471650 WS01214.BR_J17 PT-GT-FL-A-3 Populus ... 105 1e-020
gb|DT473187.1|DT473187 WS01228.BR_N16 PT-GT-FL-A-3 Populus ... 105 1e-020
gb|DT473890.1|DT473890 WS01230.BR_B01 PT-GT-FL-A-3 Populus ... 105 1e-020
gb|DT474196.1|DT474196 WS01231.BR_C13 PT-GT-FL-A-3 Populus ... 105 1e-020
gb|DT474656.1|DT474656 WS0124.BR_J06 PT-GT-FL-A-3 Populus t... 105 1e-020
gb|DT475426.1|DT475426 WS0127.BR_B14 PT-GT-FL-A-3 Populus t... 105 1e-020
gb|DT476244.1|DT476244 WS01228.B21_N16 PT-GT-FL-A-3 Populus... 105 1e-020
gb|DT476570.1|DT476570 WS01230.B21_B01 PT-GT-FL-A-3 Populus... 105 1e-020
gb|DT476870.1|DT476870 WS01231.B21_C13 PT-GT-FL-A-3 Populus... 105 1e-020
gb|DT494157.1|DT494157 WS01117.BR_J10 PT-P-FL-A-2 Populus t... 105 1e-020
gb|DT494184.1|DT494184 WS01117.BR_K16 PT-P-FL-A-2 Populus t... 105 1e-020
gb|DT494360.1|DT494360 WS01118.BR.1_D02 PT-P-FL-A-2 Populus... 105 1e-020
gb|DT494426.1|DT494426 WS01118.BR.1_G09 PT-P-FL-A-2 Populus... 105 1e-020
gb|DT497699.1|DT497699 WS0113.BR_D16 PT-P-FL-A-2 Populus tr... 105 1e-020
gb|DT498366.1|DT498366 WS0115.BR_C12 PT-P-FL-A-2 Populus tr... 105 1e-020
gb|DT498554.1|DT498554 WS0115.BR_K21 PT-P-FL-A-2 Populus tr... 105 1e-020
gb|DT520164.1|DT520164 WS02446.B21.1_M11 PTxD-ICC-N-A-14 Po... 105 1e-020
gb|DT524815.1|DT524815 WS02043.C21_K18 PTxN-IB-N-A-11 Popul... 105 1e-020
gb|DT525212.1|DT525212 WS02044.C21_L24 PTxN-IB-N-A-11 Popul... 105 1e-020
gb|DT526471.1|DT526471 WS02048.C21_C03 PTxN-IB-N-A-11 Popul... 105 1e-020
gb|BI130722.1|BI130722 G109P76Y Populus cambium cDNA librar... 103 4e-020
gb|CA930561.1|CA930561 MTU4CA.P24.A07 Aspen apex cDNA Libra... 103 4e-020
gb|DT494997.1|DT494997 WS0112.BR_A21 PT-P-FL-A-2 Populus tr... 103 4e-020
gb|AC149428.1| Populus trichocarpa clone Pop1-080J15, compl... 101 2e-019
gb|AC149479.1| Populus trichocarpa clone Pop1-017N13, compl... 101 2e-019
gb|BI130423.1|BI130423 G105P42Y Populus cambium cDNA librar... 100 7e-019
gb|BU864444.1|BU864444 S040F05 Populus imbibed seed cDNA li... 98 3e-018
gb|CV249076.1|CV249076 WS01122.B21_O23 PT-P-FL-A-2 Populus ... 98 3e-018
gb|CV249454.1|CV249454 WS01124.B21_D09 PT-P-FL-A-2 Populus ... 98 3e-018
gb|CV250329.1|CV250329 WS0113.B21_D16 PT-P-FL-A-2 Populus t... 98 3e-018
gb|DT496271.1|DT496271 WS01122.BR_O23 PT-P-FL-A-2 Populus t... 98 3e-018
gb|DT498448.1|DT498448 WS0115.BR_G06 PT-P-FL-A-2 Populus tr... 98 3e-018
gb|CN518761.1|CN518761 GQ0104.B3_P08 GQ010 Populus trichoca... 96 1e-017
gb|CV248001.1|CV248001 WS0112.B21_A21 PT-P-FL-A-2 Populus t... 96 1e-017
gb|CV282069.1|CV282069 WS0183.B21_K04 PTxD-IL-N-A-9 Populus... 96 1e-017
gb|CA932895.1|CA932895 MTU5CS.P18.H07 Aspen stem cDNA Libra... 92 2e-016
gb|CF231413.1|CF231413 PtaC0021B5B0503 Poplar cDNA library ... 92 2e-016
gb|CV231532.1|CV231532 WS0194.B21_N03 PT-DX-N-A-10 Populus ... 92 2e-016
gb|DT469685.1|DT469685 WS01918.C21_J05 PT-DX-N-A-10 Populus... 92 2e-016
gb|BI130127.1|BI130127 G100P68Y Populus cambium cDNA librar... 90 7e-016
gb|BU827755.1|BU827755 K008P40P Populus apical shoot cDNA l... 90 7e-016
gb|CA932744.1|CA932744 MTU5CS.P16.H05 Aspen stem cDNA Libra... 90 7e-016
gb|CA932877.1|CA932877 MTU5CS.P18.F07 Aspen stem cDNA Libra... 90 7e-016
gb|CA932974.1|CA932974 MTU5CS.P1.H02 Aspen stem cDNA Librar... 90 7e-016
gb|CA933178.1|CA933178 MTU5CS.P4.E02 Aspen stem cDNA Librar... 90 7e-016
gb|CA933712.1|CA933712 MTU3TS.P11.D09 Aspen stem cDNA Libra... 90 7e-016
gb|CF118943.1|CF118943 MTU10CS.P11.D12 Aspen stem cDNA Libr... 90 7e-016
gb|CF118999.1|CF118999 MTU10CS.P12.B11 Aspen stem cDNA Libr... 90 7e-016
gb|CF119738.1|CF119738 MTU10CS.P5.G02 Aspen stem cDNA Libra... 90 7e-016
gb|CF119784.1|CF119784 MTU10CS.P6.C07 Aspen stem cDNA Libra... 90 7e-016
gb|CF120071.1|CF120071 MTU10CS.P9.H09 Aspen stem cDNA Libra... 90 7e-016
gb|CF236843.1|CF236843 PtaJXT7H10H1016 Poplar cDNA library ... 90 7e-016
gb|AJ778233.1|AJ778233 AJ778233 Populus euphratica cambium ... 90 7e-016
gb|AJ778234.1|AJ778234 AJ778234 Populus euphratica cambium ... 90 7e-016
gb|CX171786.1|CX171786 E03_69-11_09.ab1 leaf inoculated wit... 90 7e-016
gb|CN517611.1|CN517611 GQ0091.B3_P04 GQ009 Populus trichoca... 88 3e-015
gb|CN524686.1|CN524686 GQ015M16.T3_H01 GQ015 Populus tricho... 88 3e-015
gb|CX168406.1|CX168406 C02_69-27_06.ab1 leaf inoculated wit... 88 3e-015
gb|CX179762.1|CX179762 C11_45-34_05.ab1 leaf inoculated wit... 88 3e-015
gb|BU881052.1|BU881052 UM58TB03 Populus flower cDNA library... 86 1e-014
gb|BU895169.1|BU895169 X020C01 Populus wood cDNA library Po... 86 1e-014
gb|CA823986.1|CA823986 R34E11 two-month-old roots from clon... 86 1e-014
gb|CV231167.1|CV231167 WS0193.B21_L17 PT-DX-N-A-10 Populus ... 86 1e-014
gb|CV235063.1|CV235063 WS01217.B21_I14 PT-GT-FL-A-3 Populus... 86 1e-014
gb|CV237252.1|CV237252 WS01227.B21.1_B13 PT-GT-FL-A-3 Popul... 86 1e-014
gb|CV237308.1|CV237308 WS01227.B21.1_F07 PT-GT-FL-A-3 Popul... 86 1e-014
gb|CV238244.1|CV238244 WS0125.B21_N14 PT-GT-FL-A-3 Populus ... 86 1e-014
gb|CV238293.1|CV238293 WS0126.B21_A21 PT-GT-FL-A-3 Populus ... 86 1e-014
gb|CV241145.1|CV241145 WS02511.B21_F11 PT-MB-N-A-15 Populus... 86 1e-014
gb|CV243689.1|CV243689 WS0252.B21_J09 PT-MB-N-A-15 Populus ... 86 1e-014
gb|CV249455.1|CV249455 WS01124.B21_D10 PT-P-FL-A-2 Populus ... 86 1e-014
gb|CV249899.1|CV249899 WS01125.B21_K15 PT-P-FL-A-2 Populus ... 86 1e-014
gb|CV251240.1|CV251240 WS0116.B21_F04 PT-P-FL-A-2 Populus t... 86 1e-014
gb|CV252152.1|CV252152 WS0119.B21_K02 PT-P-FL-A-2 Populus t... 86 1e-014
gb|CV252880.1|CV252880 PX0019.B21.1_F10 PT-X-FL-A-1 Populus... 86 1e-014
gb|CV254092.1|CV254092 WS0223.B21_P21 PTxD-ICC-A-12 Populus... 86 1e-014
gb|CV260555.1|CV260555 WS02014.B21_G05 PTxN-IB-N-A-11 Popul... 86 1e-014
gb|CV267985.1|CV267985 WS0204.B21_D21 PTxN-IB-N-A-11 Populu... 86 1e-014
gb|CV269334.1|CV269334 WS0207.B21_P15 PTxN-IB-N-A-11 Populu... 86 1e-014
gb|CV272496.1|CV272496 WS0157.B21_N05 PTxN-IB-A-6 Populus t... 86 1e-014
gb|CV274528.1|CV274528 WS0173.B21_J02 PTxD-NR-A-8 Populus t... 86 1e-014
gb|CV275442.1|CV275442 WS0176.B21_H21 PTxD-NR-A-8 Populus t... 86 1e-014
gb|CV276060.1|CV276060 WS0178.B21.1_I01 PTxD-NR-A-8 Populus... 86 1e-014
gb|DT477095.1|DT477095 WS01231.B21_P05 PT-GT-FL-A-3 Populus... 86 1e-014
gb|DT497141.1|DT497141 WS01125.BR_J16 PT-P-FL-A-2 Populus t... 86 1e-014
gb|DT500813.1|DT500813 PX0019.BR_F10 PT-X-FL-A-1 Populus tr... 86 1e-014
gb|DT513834.1|DT513834 WS02423.B21_C06 PTxD-ICC-N-A-14 Popu... 86 1e-014
gb|DT519705.1|DT519705 WS02443.B21_G23 PTxD-ICC-N-A-14 Popu... 86 1e-014
gb|DT522727.1|DT522727 WS02037.B21_M13 PTxN-IB-N-A-11 Popul... 86 1e-014
gb|DT525005.1|DT525005 WS02044.C21_C22 PTxN-IB-N-A-11 Popul... 86 1e-014
gb|BI127551.1|BI127551 G062P23Y Populus cambium cDNA librar... 84 4e-014
gb|BU875910.1|BU875910 V013C02 Populus flower cDNA library ... 84 4e-014
gb|CA932243.1|CA932243 MTU5CS.P10.E03 Aspen stem cDNA Libra... 84 4e-014
gb|CA932252.1|CA932252 MTU5CS.P10.F03 Aspen stem cDNA Libra... 84 4e-014
gb|CA932813.1|CA932813 MTU5CS.P17.G08 Aspen stem cDNA Libra... 84 4e-014
gb|CA932828.1|CA932828 MTU5CS.P18.A04 Aspen stem cDNA Libra... 84 4e-014
gb|CA933427.1|CA933427 MTU5CS.P7.H09 Aspen stem cDNA Librar... 84 4e-014
gb|CF119276.1|CF119276 MTU10CS.P15.G02 Aspen stem cDNA Libr... 84 4e-014
gb|CF119592.1|CF119592 MTU10CS.P3.H02 Aspen stem cDNA Libra... 84 4e-014
gb|CN550192.1|CN550192 GQ0242.B3_D19 GQ024 Populus trichoca... 84 4e-014
gb|CV240373.1|CV240373 WS0251.B21_D08 PT-MB-N-A-15 Populus ... 84 4e-014
gb|CV268883.1|CV268883 WS0206.B21_L11 PTxN-IB-N-A-11 Populu... 84 4e-014
gb|CV272854.1|CV272854 WS0158.B21_O18 PTxN-IB-A-6 Populus t... 84 4e-014
gb|DT480647.1|DT480647 WS02529.BR_I06 PT-MB-N-A-15 Populus ... 84 4e-014
gb|DT485913.1|DT485913 WS02529.B21_I06 PT-MB-N-A-15 Populus... 84 4e-014
gb|DT520261.1|DT520261 WS02447.B21_A21 PTxD-ICC-N-A-14 Popu... 84 4e-014
gb|DT526617.1|DT526617 WS02048.C21_I06 PTxN-IB-N-A-11 Popul... 84 4e-014
gb|BI130028.1|BI130028 G099P19Y Populus cambium cDNA librar... 82 2e-013
gb|BU895930.1|BU895930 X033B09 Populus wood cDNA library Po... 82 2e-013
gb|CK318275.1|CK318275 B9P07e02 Populus stem seasonal libra... 82 2e-013
gb|CK089801.1|CK089801 C034P23.3pR Populus strain T89 leave... 80 6e-013
gb|CK100453.1|CK100453 C034P23.5pR Populus strain T89 leave... 80 6e-013
gb|AJ772207.1|AJ772207 AJ772207 Populus euphratica shoot in... 80 6e-013
gb|AJ772281.1|AJ772281 AJ772281 Populus euphratica shoot in... 80 6e-013
gb|AJ772782.1|AJ772782 AJ772782 Populus euphratica shoot in... 80 6e-013
gb|CX177399.1|CX177399 F12_45-35_12.ab1 leaf inoculated wit... 80 6e-013
gb|CX177870.1|CX177870 H01_45-92_15.ab1 leaf inoculated wit... 80 6e-013
gb|CX179028.1|CX179028 D11_45-31_07.ab1 leaf inoculated wit... 80 6e-013
gb|CX180140.1|CX180140 B09_45-4_03.ab1 leaf inoculated with... 80 6e-013
gb|CX180694.1|CX180694 F11_45-39_11.ab1 leaf inoculated wit... 80 6e-013
gb|CX183545.1|CX183545 E02_45-112_10.ab1 leaf inoculated wi... 80 6e-013
gb|CX184555.1|CX184555 E12_45-82_10.ab1 leaf inoculated wit... 80 6e-013
gb|CX184610.1|CX184610 B09_45-2_03.ab1 leaf inoculated with... 80 6e-013
gb|CX185085.1|CX185085 D08_45-17_08.ab1 leaf inoculated wit... 80 6e-013
gb|CX185934.1|CX185934 C05_45-98_05.ab1 leaf inoculated wit... 80 6e-013
gb|CX185941.1|CX185941 D11_45-11_07.ab1 leaf inoculated wit... 80 6e-013
gb|DT497251.1|DT497251 WS01125.BR_O23 PT-P-FL-A-2 Populus t... 80 6e-013
gb|DT510330.1|DT510330 WS02426.BR_D22 PTxD-ICC-N-A-14 Popul... 80 6e-013
gb|BI121808.1|BI121808 F047P39Y Populus flower cDNA library... 78 3e-012
gb|BI127759.1|BI127759 G065P43Y Populus cambium cDNA librar... 78 3e-012
gb|BI128003.1|BI128003 G069P54Y Populus cambium cDNA librar... 78 3e-012
gb|BI128712.1|BI128712 G080P38Y Populus cambium cDNA librar... 78 3e-012
gb|BI128929.1|BI128929 G083P65Y Populus cambium cDNA librar... 78 3e-012
gb|BI129078.1|BI129078 G085P62Y Populus cambium cDNA librar... 78 3e-012
gb|BI130014.1|BI130014 G099P03Y Populus cambium cDNA librar... 78 3e-012
gb|BI131516.1|BI131516 G121P96Y Populus cambium cDNA librar... 78 3e-012
gb|BI131561.1|BI131561 G122P58Y Populus cambium cDNA librar... 78 3e-012
gb|BI131657.1|BI131657 G123P87Y Populus cambium cDNA librar... 78 3e-012
gb|BU824686.1|BU824686 UB67DPF10 Populus tremula cambium cD... 78 3e-012
gb|BU829906.1|BU829906 T001E08 Populus apical shoot cDNA li... 78 3e-012
gb|BU835779.1|BU835779 T078E11 Populus apical shoot cDNA li... 78 3e-012
gb|BU881535.1|BU881535 UM64TA06 Populus flower cDNA library... 78 3e-012
gb|BU896281.1|BU896281 X038C11 Populus wood cDNA library Po... 78 3e-012
gb|BU896823.1|BU896823 X046D05 Populus wood cDNA library Po... 78 3e-012
gb|BU897808.1|BU897808 X070A08 Populus wood cDNA library Po... 78 3e-012
gb|CF227564.1|CF227564 PtaXM0001E7E0709 Poplar cDNA library... 78 3e-012
gb|CF227791.1|CF227791 PtaXM0004F8F0812 Poplar cDNA library... 78 3e-012
gb|CF228173.1|CF228173 PtaXM0009G5G0513 Poplar cDNA library... 78 3e-012
gb|CF228668.1|CF228668 PtaXM0015H8H0816 Poplar cDNA library... 78 3e-012
gb|CF229236.1|CF229236 PtaXM0022H4H0416 Poplar cDNA library... 78 3e-012
gb|CF229489.1|CF229489 PtaXM0026A9A0901 Poplar cDNA library... 78 3e-012
gb|CF229734.1|CF229734 PtaXM0028H9H0915 Poplar cDNA library... 78 3e-012
gb|CF233058.1|CF233058 PtaJXO0018H12H1216 Poplar cDNA libra... 78 3e-012
gb|CF234882.1|CF234882 PtaJXT0016C4C0406 Poplar cDNA librar... 78 3e-012
gb|CF235571.1|CF235571 PtaJXT0024D4D0408 Poplar cDNA librar... 78 3e-012
gb|CF235668.1|CF235668 PtaJXT0025F12F1212 Poplar cDNA libra... 78 3e-012
gb|CF235959.1|CF235959 PtaJXT0029A2A0202 Poplar cDNA librar... 78 3e-012
gb|CF235974.1|CF235974 PtaJXT0029B7B0703 Poplar cDNA librar... 78 3e-012
gb|CF236007.1|CF236007 PtaJXT0029E7E0709 Poplar cDNA librar... 78 3e-012
gb|CF236553.1|CF236553 PtaJXT4C10C1006 Poplar cDNA library ... 78 3e-012
gb|CF237054.1|CF237054 PtajxtjxoD12D1208 Poplar cDNA librar... 78 3e-012
gb|CF237341.1|CF237341 Ptajxtjxt4H7H0715 Poplar cDNA librar... 78 3e-012
gb|CK092432.1|CK092432 G083P57.3pR Populus tension wood cDN... 78 3e-012
gb|CK093182.1|CK093182 G110P90.3pR Populus tension wood cDN... 78 3e-012
gb|CK093248.1|CK093248 G113P19.3pR Populus tension wood cDN... 78 3e-012
gb|CK098837.1|CK098837 A037P68.5pR Hybrid aspen plasmid lib... 78 3e-012
gb|CK108347.1|CK108347 GO85P62 Populus tension wood cDNA li... 78 3e-012
gb|CN517737.1|CN517737 GQ0094.B3_L08 GQ009 Populus trichoca... 78 3e-012
gb|CN520390.1|CN520390 GQ0108.B3_F19 GQ010 Populus trichoca... 78 3e-012
gb|CN524382.1|CN524382 GQ015M13.T3_F08 GQ015 Populus tricho... 78 3e-012
gb|CK320869.1|CK320869 X9SP08d08 Populus stem seasonal libr... 78 3e-012
gb|CV226148.1|CV226148 WS0163.B21_G22 PT-DX-A-7 Populus tri... 78 3e-012
gb|CV226247.1|CV226247 WS0163.B21_L13 PT-DX-A-7 Populus tri... 78 3e-012
gb|CV226836.1|CV226836 WS0165.B21_G23 PT-DX-A-7 Populus tri... 78 3e-012
gb|CV232237.1|CV232237 WS0196.B21_P12 PT-DX-N-A-10 Populus ... 78 3e-012
gb|CV272972.1|CV272972 WS0171.B21_E12 PTxD-NR-A-8 Populus t... 78 3e-012
gb|CV274745.1|CV274745 WS0174.B21.1_E03 PTxD-NR-A-8 Populus... 78 3e-012
gb|CX657777.1|CX657777 PO01005B11 Poplar SC cDNA library Po... 78 3e-012
gb|BI130019.1|BI130019 G099P09Y Populus cambium cDNA librar... 76 1e-011
gb|CF228324.1|CF228324 PtaXM0011F3F0311 Poplar cDNA library... 76 1e-011
gb|CX179108.1|CX179108 D02_45-59_08.ab1 leaf inoculated wit... 76 1e-011
gb|CF227545.1|CF227545 PtaXM0001C5C0505 Poplar cDNA library... 74 4e-011
gb|CK319573.1|CK319573 B9SP02h04 Populus stem seasonal libr... 74 4e-011
gb|AJ772653.1|AJ772653 AJ772653 Populus euphratica shoot in... 74 4e-011
gb|CV247286.1|CV247286 WS01117.B21_K16 PT-P-FL-A-2 Populus ... 74 4e-011
gb|BI131633.1|BI131633 G123P53Y Populus cambium cDNA librar... 72 2e-010
gb|CF227742.1|CF227742 PtaXM0004A6A0602 Poplar cDNA library... 72 2e-010
gb|CF227812.1|CF227812 PtaXM0004H8H0816 Poplar cDNA library... 72 2e-010
gb|CF236341.1|CF236341 PtaJXT11F5F0511 Poplar cDNA library ... 72 2e-010
gb|CF236647.1|CF236647 PtaJXT5D3D0307 Poplar cDNA library f... 72 2e-010
gb|AJ772492.1|AJ772492 AJ772492 Populus euphratica shoot in... 72 2e-010
gb|BU891574.1|BU891574 P052D01 Populus petioles cDNA librar... 70 6e-010
gb|CA932247.1|CA932247 MTU5CS.P10.E09 Aspen stem cDNA Libra... 70 6e-010
gb|AJ776327.1|AJ776327 AJ776327 Populus euphratica root 3-6... 70 6e-010
gb|CV225729.1|CV225729 WS0162.B21_D19 PT-DX-A-7 Populus tri... 70 6e-010
gb|CV241686.1|CV241686 WS02512.B21_P09 PT-MB-N-A-15 Populus... 70 6e-010
gb|DT472200.1|DT472200 WS01225.BR.1_M09 PT-GT-FL-A-3 Populu... 70 6e-010
gb|CF216258.1|CF216258 PT1077 Hybrid aspen xylem up-regulat... 68 2e-009
gb|CK320752.1|CK320752 X9SP02f08 Populus stem seasonal libr... 68 2e-009
gb|BI128740.1|BI128740 G080P72Y Populus cambium cDNA librar... 66 1e-008
gb|BU861457.1|BU861457 S002C08 Populus imbibed seed cDNA li... 66 1e-008
gb|CF234726.1|CF234726 PtaJXT0014D6D0608 Poplar cDNA librar... 64 4e-008
gb|CF236456.1|CF236456 PtaJXT3A2A0202 Poplar cDNA library f... 64 4e-008
gb|CV227050.1|CV227050 WS0166.B21_A19 PT-DX-A-7 Populus tri... 64 4e-008
gb|CV261473.1|CV261473 WS02016.B21_O02 PTxN-IB-N-A-11 Popul... 64 4e-008
gb|AI163479.1|AI163479 A042p58u Hybrid aspen plasmid librar... 62 2e-007
gb|AI165766.1|AI165766 A090P68U Hybrid aspen plasmid librar... 62 2e-007
gb|BI127276.1|BI127276 G058P06Y Populus cambium cDNA librar... 62 2e-007
gb|BI127316.1|BI127316 G058P57Y Populus cambium cDNA librar... 62 2e-007
gb|BI127735.1|BI127735 G065P14Y Populus cambium cDNA librar... 62 2e-007
gb|BI129619.1|BI129619 G093P35Y Populus cambium cDNA librar... 62 2e-007
gb|BI129636.1|BI129636 G093P58Y Populus cambium cDNA librar... 62 2e-007
gb|BI131456.1|BI131456 G121P11Y Populus cambium cDNA librar... 62 2e-007
gb|BI132347.1|BI132347 G135P57Y Populus cambium cDNA librar... 62 2e-007
gb|BU896868.1|BU896868 X047B02 Populus wood cDNA library Po... 62 2e-007
gb|CA932229.1|CA932229 MTU5CS.P10.C09 Aspen stem cDNA Libra... 62 2e-007
gb|CA933144.1|CA933144 MTU5CS.P4.A08 Aspen stem cDNA Librar... 62 2e-007
gb|CF229780.1|CF229780 PtaXM0029F11F1111 Poplar cDNA librar... 62 2e-007
gb|CF237337.1|CF237337 Ptajxtjxt4H3H0315 Poplar cDNA librar... 62 2e-007
gb|CN524230.1|CN524230 GQ015M12.T3_C08 GQ015 Populus tricho... 62 2e-007
gb|CN549841.1|CN549841 GQ0243.B3_A08 GQ024 Populus trichoca... 62 2e-007
gb|CK319453.1|CK319453 X9P10h10 Populus stem seasonal libra... 62 2e-007
gb|AJ778166.1|AJ778166 AJ778166 Populus euphratica root 3-6... 62 2e-007
gb|AY246545.1| Populus x canescens putative sucrose synthas... 62 2e-007
gb|AI163699.1|AI163699 A046p54u Hybrid aspen plasmid librar... 60 6e-007
gb|AI164295.1|AI164295 A058p67u Hybrid aspen plasmid librar... 60 6e-007
gb|AI164415.1|AI164415 A061P20U Hybrid aspen plasmid librar... 60 6e-007
gb|AI165555.1|AI165555 A085p66u Hybrid aspen plasmid librar... 60 6e-007
gb|AI165740.1|AI165740 A090P08U Hybrid aspen plasmid librar... 60 6e-007
gb|BI069238.1|BI069238 C034P23U Populus strain T89 leaves P... 60 6e-007
gb|BI128348.1|BI128348 G074P55Y Populus cambium cDNA librar... 60 6e-007
gb|BI129976.1|BI129976 G098P37Y Populus cambium cDNA librar... 60 6e-007
gb|BI131500.1|BI131500 G121P76Y Populus cambium cDNA librar... 60 6e-007
gb|BU823473.1|BU823473 UB52DPH10 Populus tremula cambium cD... 60 6e-007
gb|CA931562.1|CA931562 MTU2TA.P9.A08 Aspen apex cDNA Librar... 60 6e-007
gb|CA931607.1|CA931607 MTU2TA.P9.F05 Aspen apex cDNA Librar... 60 6e-007
gb|CF233618.1|CF233618 PtaJXO0025F9F0911 Poplar cDNA librar... 60 6e-007
gb|CK099833.1|CK099833 A085P66.5pR Hybrid aspen plasmid lib... 60 6e-007
gb|CK107827.1|CK107827 G058P06 Populus tension wood cDNA li... 60 6e-007
gb|CK107868.1|CK107868 G058P57 Populus tension wood cDNA li... 60 6e-007
gb|CK116780.1|CK116780 B017P24 Hybrid aspen plasmid library... 60 6e-007
gb|CK117177.1|CK117177 B030P08 Hybrid aspen plasmid library... 60 6e-007
gb|CN550203.1|CN550203 GQ0243.B3_P07 GQ024 Populus trichoca... 60 6e-007
gb|AJ775898.1|AJ775898 AJ775898 Populus euphratica root 3-6... 60 6e-007
gb|DT509220.1|DT509220 WS02423.BR_C06 PTxD-ICC-N-A-14 Popul... 60 6e-007
gb|AI164858.1|AI164858 A069p77u Hybrid aspen plasmid librar... 58 2e-006
gb|CF119737.1|CF119737 MTU10CS.P5.G01 Aspen stem cDNA Libra... 58 2e-006
gb|CN520581.1|CN520581 GQ0106.B3_F18 GQ010 Populus trichoca... 58 2e-006
gb|CN523832.1|CN523832 GQ015M09.T3_H04 GQ015 Populus tricho... 58 2e-006
gb|DN493619.1|DN493619 G068P86.5pR Populus tension wood cDN... 58 2e-006
gb|DT472007.1|DT472007 WS0122.BR_M17 PT-GT-FL-A-3 Populus t... 58 2e-006
gb|DT472660.1|DT472660 WS01227.BR.1_B13 PT-GT-FL-A-3 Populu... 58 2e-006
gb|DT472692.1|DT472692 WS01227.BR.1_F07 PT-GT-FL-A-3 Populu... 58 2e-006
gb|DT474449.1|DT474449 WS01231.BR_P05 PT-GT-FL-A-3 Populus ... 58 2e-006
gb|DT475054.1|DT475054 WS0125.BR_N14 PT-GT-FL-A-3 Populus t... 58 2e-006
gb|DT475113.1|DT475113 WS0126.BR_A21 PT-GT-FL-A-3 Populus t... 58 2e-006
gb|DT496702.1|DT496702 WS01124.BR_D10 PT-P-FL-A-2 Populus t... 58 2e-006
gb|DT497163.1|DT497163 WS01125.BR_K15 PT-P-FL-A-2 Populus t... 58 2e-006
gb|DT498775.1|DT498775 WS0116.BR_F04 PT-P-FL-A-2 Populus tr... 58 2e-006
gb|CF119060.1|CF119060 MTU10CS.P12.H12 Aspen stem cDNA Libr... 56 9e-006
gb|CN517985.1|CN517985 GQ0092.B3_C05 GQ009 Populus trichoca... 56 9e-006
gb|AJ780649.1|AJ780649 AJ780649 Populus euphratica leaf 3-6... 56 9e-006
gb|BI129951.1|BI129951 G097P91Y Populus cambium cDNA librar... 54 4e-005
gb|BU836549.1|BU836549 T087H11 Populus apical shoot cDNA li... 54 4e-005
gb|BU898234.1|BU898234 X077A10 Populus wood cDNA library Po... 54 4e-005
gb|CK319639.1|CK319639 B9SP06e05 Populus stem seasonal libr... 54 4e-005
gb|CX182209.1|CX182209 D01_45-84_07.ab1 leaf inoculated wit... 54 4e-005
gb|AI164134.1|AI164134 A055P30U Hybrid aspen plasmid librar... 52 1e-004
gb|BU833106.1|BU833106 T042C07 Populus apical shoot cDNA li... 52 1e-004
gb|CK108119.1|CK108119 G102P64 Populus tension wood cDNA li... 52 1e-004
gb|AI164510.1|AI164510 A064P49U Hybrid aspen plasmid librar... 50 6e-004
gb|BI127798.1|BI127798 G066P14Y Populus cambium cDNA librar... 50 6e-004
gb|BI132253.1|BI132253 G134P04Y Populus cambium cDNA librar... 50 6e-004
gb|BU823209.1|BU823209 UB49DPD02 Populus tremula cambium cD... 50 6e-004
gb|BU835979.1|BU835979 T081B04 Populus apical shoot cDNA li... 50 6e-004
gb|CK103277.1|CK103277 G110P90.5pR Populus tension wood cDN... 50 6e-004
gb|CV263524.1|CV263524 WS02022.B21_B11 PTxN-IB-N-A-11 Popul... 50 6e-004
gb|CV267564.1|CV267564 WS02032.B21_B11 PTxN-IB-N-A-11 Popul... 50 6e-004
gb|AI166709.1|AI166709 xylem.est.514 Poplar xylem Lambda ZA... 48 0.002
gb|CN522917.1|CN522917 GQ0123.B3_E16 GQ012 Populus trichoca... 48 0.002
gb|BP922643.1|BP922643 BP922643 full-length enriched poplar... 48 0.002
gb|DV465974.1|DV465974 MTUNUL1.P45.F06 NUL Populus fremonti... 48 0.002
gb|BI128324.1|BI128324 G074P22Y Populus cambium cDNA librar... 46 0.009
gb|BI130271.1|BI130271 G103P21Y Populus cambium cDNA librar... 46 0.009
gb|BI130316.1|BI130316 G103P76Y Populus cambium cDNA librar... 46 0.009
gb|BI131744.1|BI131744 G125P08Y Populus cambium cDNA librar... 46 0.009
gb|DV463229.1|DV463229 MTUNUL1.P13.C11 NUL Populus fremonti... 44 0.035
gb|BI131276.1|BI131276 G118P15Y Populus cambium cDNA librar... 42 0.14
gb|BI131511.1|BI131511 G121P89Y Populus cambium cDNA librar... 42 0.14
gb|BU820099.1|BU820099 UA51CPC06 Populus tremula cambium cD... 42 0.14
gb|BU820359.1|BU820359 UA54DPC07 Populus tremula cambium cD... 42 0.14
gb|CK320887.1|CK320887 X9SP09c06 Populus stem seasonal libr... 42 0.14
gb|AJ771680.1|AJ771680 AJ771680 Populus euphratica root 3-6... 42 0.14
gb|AJ772013.1|AJ772013 AJ772013 Populus euphratica root 3-6... 42 0.14
gb|AJ772081.1|AJ772081 AJ772081 Populus euphratica shoot in... 42 0.14
gb|AJ772533.1|AJ772533 AJ772533 Populus euphratica shoot in... 42 0.14
gb|AJ776251.1|AJ776251 AJ776251 Populus euphratica root 3-6... 42 0.14
gb|AJ780505.1|AJ780505 AJ780505 Populus euphratica leaf 3-6... 42 0.14
gb|BP928698.1|BP928698 BP928698 full-length enriched poplar... 42 0.14
gb|BP928788.1|BP928788 BP928788 full-length enriched poplar... 42 0.14
>gb|BI128110.1|BI128110 G070P93Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 538
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 215 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 274
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 275 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 334
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 335 gccacacagctttcactctccctggcctctacagagttgtgcatggtatcgatgtatttg 394
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 395 atcccaaattcaacattgtatcccctgg 422
>gb|BI128475.1|BI128475 G076P35Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 520
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 158 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 217
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 218 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 277
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 278 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 337
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 338 atcccaaattcaacattgtatcccctgg 365
>gb|BI130293.1|BI130293 G103P48Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 408
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 31 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 90
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 91 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 150
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 151 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 210
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 211 atcccaaattcaacattgtatcccctgg 238
>gb|BI132288.1|BI132288 G134P67Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 392
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 12 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 71
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 72 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 131
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 132 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 191
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 192 atcccaaattcaacattgtatcccctgg 219
>gb|BU831561.1|BU831561 T023A06 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 577
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 53 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 112
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 113 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 172
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 173 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 232
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 233 atcccaaattcaacattgtatcccctgg 260
>gb|CF233496.1|CF233496 PtaJXO0024C6C0606 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 622
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 289 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 348
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 349 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 408
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 409 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 468
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 469 atcccaaattcaacattgtatcccctgg 496
Score = 69.9 bits (35), Expect = 6e-010
Identities = 80/95 (84%)
Strand = Plus / Plus
Query: 1167 ttcgcgttcccttcagaaatgagaatggcatcctccgcaagtggatctctcgttttgatg 1226
|||| |||||||||||| |||| || || || |||| || ||||||||||| ||||| |
Sbjct: 9 ttcgagttcccttcagagatgaaaagggaatggtccggaaatggatctctcgctttgaag 68
Query: 1227 tctggccatacctggagacatacactgaggatgtt 1261
| ||||||||||| || || |||||||||||||||
Sbjct: 69 tttggccatacctagaaacttacactgaggatgtt 103
>gb|CF234458.1|CF234458 Ptajxojxo2H10H1016 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 677
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 156 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 215
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 216 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 275
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 276 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 335
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 336 atcccaaattcaacattgtatcccctgg 363
>gb|CF234532.1|CF234532 PtaJXO0010H6A0701 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 705
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 26 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 85
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 86 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 145
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 146 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 205
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 206 atcccaaattcaacattgtatcccctgg 233
>gb|CF234998.1|CF234998 PtaJXT0017F5F0511 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 760
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 333 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 392
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 393 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 452
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 453 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 512
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 513 atcccaaattcaacattgtatcccctgg 540
Score = 69.9 bits (35), Expect = 6e-010
Identities = 80/95 (84%)
Strand = Plus / Plus
Query: 1167 ttcgcgttcccttcagaaatgagaatggcatcctccgcaagtggatctctcgttttgatg 1226
|||| |||||||||||| |||| || || || |||| || ||||||||||| ||||| |
Sbjct: 54 ttcgagttcccttcagagatgaaaagggaatggtccggaaatggatctctcgctttgaag 113
Query: 1227 tctggccatacctggagacatacactgaggatgtt 1261
| ||||||||||| || || |||||||||||||||
Sbjct: 114 tttggccatacctagaaacttacactgaggatgtt 148
>gb|CK103101.1|CK103101 G103P49.5pR Populus tension wood cDNA library Populus tremula x
Populus tremuloides cDNA clone G103P49 5', mRNA sequence
Length = 524
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 34 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 93
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 94 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 153
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 154 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 213
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 214 atcccaaattcaacattgtatcccctgg 241
>gb|CN517761.1|CN517761 GQ0092.B3_J09 GQ009 Populus trichocarpa x Populus deltoides cDNA
clone GQ0092_J09 5', mRNA sequence
Length = 444
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 141 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 200
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 201 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 260
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 261 gccacactgctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 320
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 321 atcccaaattcaacattgtatcccctgg 348
>gb|CN519255.1|CN519255 GQ0104.B3_D16 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0104_D16 5', mRNA sequence
Length = 735
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 316 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 375
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 376 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 435
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 436 gccacactgctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 495
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 496 atcccaaattcaacattgtatcccctgg 523
Score = 61.9 bits (31), Expect = 2e-007
Identities = 79/95 (83%)
Strand = Plus / Plus
Query: 1167 ttcgcgttcccttcagaaatgagaatggcatcctccgcaagtggatctctcgttttgatg 1226
|||| |||||||||||| |||| || || || |||| || ||||| ||||| ||||| |
Sbjct: 37 ttcgagttcccttcagagatgaaaagggaatggtccggaaatggatttctcgctttgaag 96
Query: 1227 tctggccatacctggagacatacactgaggatgtt 1261
| ||||||||||| || || |||||||||||||||
Sbjct: 97 tttggccatacctagaaacttacactgaggatgtt 131
>gb|CN520973.1|CN520973 GQ0105.B3_K21 GQ010 Populus trichocarpa x Populus deltoides cDNA
clone GQ0105_K21 5', mRNA sequence
Length = 821
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 31 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 90
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 91 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 150
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 151 gccacactgctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 210
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 211 atcccaaattcaacattgtatcccctgg 238
Score = 58.0 bits (29), Expect = 2e-006
Identities = 59/69 (85%)
Strand = Plus / Plus
Query: 2015 cagatgaaccgcgtccgcaacggggagctgtaccgctacatttgcgataccaagggcgca 2074
|||||||||||||| | || || ||||| ||||| |||||||| ||||||||||| ||
Sbjct: 600 cagatgaaccgcgtgaggaatggagagctctaccgttacatttgtgataccaagggagct 659
Query: 2075 ttcgtgcag 2083
|||||||||
Sbjct: 660 ttcgtgcag 668
>gb|CK319038.1|CK319038 X9P06b12 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 708
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 146 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 205
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 206 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 265
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 266 gccacactgctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 325
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 326 atcccaaattcaacattgtatcccctgg 353
>gb|CK320848.1|CK320848 X9SP07c09 Populus stem seasonal library Populus deltoides cDNA, mRNA
sequence
Length = 653
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 290 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 349
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 350 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 409
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 410 gccacactgctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 469
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 470 atcccaaattcaacattgtatcccctgg 497
Score = 61.9 bits (31), Expect = 2e-007
Identities = 79/95 (83%)
Strand = Plus / Plus
Query: 1167 ttcgcgttcccttcagaaatgagaatggcatcctccgcaagtggatctctcgttttgatg 1226
|||| |||||||||||| |||| || || || |||| || ||||| ||||| ||||| |
Sbjct: 11 ttcgagttcccttcagagatgaaaagggaatggtccggaaatggatttctcgctttgaag 70
Query: 1227 tctggccatacctggagacatacactgaggatgtt 1261
| ||||||||||| || || |||||||||||||||
Sbjct: 71 tttggccatacctagaaacttacactgaggatgtt 105
>gb|CX169075.1|CX169075 F08_69-78_12.ab1 leaf inoculated with Marssonia pathogen of Populus
deltoides Populus deltoides cDNA, mRNA sequence
Length = 653
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 35 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 94
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 95 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 154
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 155 gccacactgctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 214
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 215 atcccaaattcaacattgtatcccctgg 242
>gb|AY341026.1| Populus tremuloides sucrose synthase mRNA, complete cds
Length = 2792
Score = 167 bits (84), Expect = 4e-039
Identities = 177/208 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 1492 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 1551
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 1552 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 1611
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 1612 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 1671
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 1672 atcccaaattcaacattgtatcccctgg 1699
Score = 89.7 bits (45), Expect = 7e-016
Identities = 129/157 (82%)
Strand = Plus / Plus
Query: 908 ttcaatgttgttatcctttctcctcatggctacttcgctcagtccaatgtgcttggatac 967
||||||||||| ||| | || |||||||| |||||||| || |||||| | || ||
Sbjct: 954 ttcaatgttgtgatcatgtcccctcatggatacttcgcccaagacaatgttttggggtat 1013
Query: 968 cctgacactggcggtcaggttgtgtacattctggatcaggtccgtgctttggagaatgag 1027
||||| || || || |||||||| |||||| ||||||| || ||||| |||||||||||
Sbjct: 1014 cctgataccggaggccaggttgtttacattttggatcaagttcgtgccttggagaatgaa 1073
Query: 1028 atgcttctgaggattaagcagcaaggccttgatatca 1064
||||||||| | || ||||||||||| ||||||||||
Sbjct: 1074 atgcttctgcgtatcaagcagcaaggacttgatatca 1110
Score = 77.8 bits (39), Expect = 3e-012
Identities = 78/91 (85%)
Strand = Plus / Plus
Query: 2250 acttctttgacaaatgcaaggcagatccgagctactgggacaagatctcacagggcggcc 2309
|||||||||| || |||||||| ||||| | ||||||||||| ||||| ||||| ||||
Sbjct: 2296 acttctttgagaagtgcaaggctgatcccacttactgggacaaaatctcccagggaggcc 2355
Query: 2310 tgcagagaatctatgagaagtacacctggaa 2340
||||| ||||| | |||||||| ||||||||
Sbjct: 2356 tgcagcgaatccaagagaagtatacctggaa 2386
Score = 77.8 bits (39), Expect = 3e-012
Identities = 135/167 (80%)
Strand = Plus / Plus
Query: 2015 cagatgaaccgcgtccgcaacggggagctgtaccgctacatttgcgataccaagggcgca 2074
|||||||||||||| | || || ||||| ||||| |||||||| ||||||||||| ||
Sbjct: 2061 cagatgaaccgcgtgaggaatggagagctctaccgttacatttgtgataccaagggagct 2120
Query: 2075 ttcgtgcagcctgcgttctacgaagcgttcggcctgactgtgatcgagtccatgacgtgc 2134
|||||||||||||| || || || || || || ||||||| | ||| ||||||| ||
Sbjct: 2121 ttcgtgcagcctgctttgtatgaggcttttggattgactgttgttgaggccatgacatgt 2180
Query: 2135 ggtctgccaacgatcgcgacctgccatggtggccctgctgagatcat 2181
||| ||||||| | || || ||| ||||||| ||||||||||||||
Sbjct: 2181 ggtttgccaacctttgctacttgcaatggtggtcctgctgagatcat 2227
Score = 54.0 bits (27), Expect = 4e-005
Identities = 78/95 (82%)
Strand = Plus / Plus
Query: 1167 ttcgcgttcccttcagaaatgagaatggcatcctccgcaagtggatctctcgttttgatg 1226
|||| |||||||||||| |||| || || || |||| || |||| ||||| ||||| |
Sbjct: 1213 ttcgagttcccttcagagatgaaaagggaatggtccggaaaaggatttctcgctttgaag 1272
Query: 1227 tctggccatacctggagacatacactgaggatgtt 1261
| ||||||||||| || || |||||||||||||||
Sbjct: 1273 tttggccatacctagaaacttacactgaggatgtt 1307
Score = 48.1 bits (24), Expect = 0.002
Identities = 60/72 (83%)
Strand = Plus / Plus
Query: 302 caggaagcaattgtgctccccccatgggttgcacttgctatcaggccaaggcctggtgtc 361
|||||||||||||| | || |||||| |||| |||||| | | || ||||||||||||
Sbjct: 348 caggaagcaattgttgtgcctccatggattgctcttgctctgcgcccgaggcctggtgtc 407
Query: 362 tgggattacatt 373
||||| ||||||
Sbjct: 408 tgggagtacatt 419
>gb|BI129484.1|BI129484 G091P27Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 475
Score = 165 bits (83), Expect = 1e-038
Identities = 170/199 (85%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 277 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 336
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 337 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 396
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 397 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 456
Query: 1626 atcccaagttcaacattgt 1644
||||||| |||||||||||
Sbjct: 457 atcccaaattcaacattgt 475
Score = 67.9 bits (34), Expect = 2e-009
Identities = 76/90 (84%)
Strand = Plus / Plus
Query: 1172 gttcccttcagaaatgagaatggcatcctccgcaagtggatctctcgttttgatgtctgg 1231
|||||||||||| |||| || || || |||| || ||||||||||| ||||| || |||
Sbjct: 2 gttcccttcagagatgaaaagggaatggtccggaaatggatctctcgctttgaagtttgg 61
Query: 1232 ccatacctggagacatacactgaggatgtt 1261
|||||||| || || |||||||||||||||
Sbjct: 62 ccatacctagaaacttacactgaggatgtt 91
>gb|CF236082.1|CF236082 PtaJXT0030D7D0707 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 606
Score = 161 bits (81), Expect = 2e-037
Identities = 176/208 (84%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 130 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 189
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||| ||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 190 tcatnaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 249
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 250 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 309
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 310 atcccaaattcaacattgtatcccctgg 337
>gb|CN522671.1|CN522671 GQ0124.B3_M16 GQ012 Populus trichocarpa x Populus deltoides cDNA
clone GQ0124_M16 5', mRNA sequence
Length = 466
Score = 161 bits (81), Expect = 2e-037
Identities = 176/208 (84%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 186 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 245
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 246 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 305
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 306 gccacactgctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 365
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||| ||||||| || |||||
Sbjct: 366 atcccaaattcnacattgtatcccctgg 393
>gb|BI128937.1|BI128937 G083P76Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 448
Score = 159 bits (80), Expect = 9e-037
Identities = 176/208 (84%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||| ||| ||| ||||||||||||| || |||||||
Sbjct: 141 agtaccacttttcatgccagtttacaggtgatctttttgccatgaaccatacagatttca 200
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 201 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 260
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 261 gccacacagctttcactctccctggcctctacagagttgttcatggtatcgatgtatttg 320
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 321 atcccaaattcaacattgtatcccctgg 348
>gb|CF235263.1|CF235263 PtaJXT0020F9F0911 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 772
Score = 159 bits (80), Expect = 9e-037
Identities = 176/208 (84%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
|||||||||| || |||||||| |||||||| ||| ||||||||||||| || |||||||
Sbjct: 231 agtaccacttttcatgccagtttacagctgatctttttgccatgaaccatacagatttca 290
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
|||||||||||||||||||||| || || ||||||||||| || || || |||||||||
Sbjct: 291 tcatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtacgaga 350
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || | |||||| ||||| |||||| | || || ||||| |||||||| || |
Sbjct: 351 gccacacagcttccactctccctggcctctacagagttgttcatggtatcgatgtatttg 410
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 411 atcccaaattcaacattgtatcccctgg 438
Score = 42.1 bits (21), Expect = 0.14
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 1229 tggccatacctggagacatacactgaggatgtt 1261
||||||||||| || || |||||||||||||||
Sbjct: 13 tggccatacctagaaacttacactgaggatgtt 45
>gb|CF233466.1|CF233466 PtaJXO0023H9H0915 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 710
Score = 135 bits (68), Expect = 1e-029
Identities = 162/194 (83%)
Strand = Plus / Plus
Query: 1460 tgccagttcacagctgaccttattgccatgaaccacaccgatttcatcatcaccagcaca 1519
|||||||| |||||||| ||| ||||||||||||| || |||||||||||||||||||||
Sbjct: 22 tgccagtttacagctgatctttttgccatgaaccatacagatttcatcatcaccagcaca 81
Query: 1520 ttccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagtcccacatcgcgttc 1579
|||||||| || || ||||||||||| || || || ||||||||| ||||| || |||
Sbjct: 82 ttccaagagattgctggaagcaaggatactgttggacagtacgagagccacacagctttc 141
Query: 1580 actcttcctgggctctaccgtgtcgtccatggcatcgatgttttcgatcccaagttcaac 1639
||||| ||||| |||| | || | ||||| |||||||| || |||||||| ||||||
Sbjct: 142 actctccctggcctctnctnagttggtcatggtatcgatgtatttgatcccaaattcaac 201
Query: 1640 attgtctctcctgg 1653
||||| || |||||
Sbjct: 202 attgtatcccctgg 215
>gb|BI127350.1|BI127350 G058P96Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 473
Score = 131 bits (66), Expect = 2e-028
Identities = 177/214 (82%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
||||||||||||| |||||||| |||||||| ||| |||| |||||||| || |||||||
Sbjct: 134 agtaccacttctcatgccagtttacagctgatctttttgcaatgaaccatacagatttca 193
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
| |||||||||||||||||||| || || ||||||||||| || || || ||||| ||
Sbjct: 194 ttatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtatgaaa 253
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| ||||| | || || ||||| || ||||| || |
Sbjct: 254 gccacactgctttcactctccctggcctctatagagttgttcatggtattgatgtctttg 313
Query: 1626 atcccaagttcaacattgtctctcctggagcaga 1659
||||||| ||||||||||| || ||||| |||||
Sbjct: 314 atcccaaattcaacattgtatcccctggcgcaga 347
>gb|BI130456.1|BI130456 G105P82Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 429
Score = 131 bits (66), Expect = 2e-028
Identities = 177/214 (82%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
||||||||||||| |||||||| |||||||| ||| |||| |||||||| || |||||||
Sbjct: 95 agtaccacttctcatgccagtttacagctgatctttttgcaatgaaccatacagatttca 154
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
| |||||||||||||||||||| || || ||||||||||| || || || ||||| ||
Sbjct: 155 ttatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtatgaaa 214
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| ||||| | || || ||||| || ||||| || |
Sbjct: 215 gccacactgctttcactctccctggcctctatagagttgttcatggtattgatgtctttg 274
Query: 1626 atcccaagttcaacattgtctctcctggagcaga 1659
||||||| ||||||||||| || ||||| |||||
Sbjct: 275 atcccaaattcaacattgtatcccctggcgcaga 308
>gb|BI130652.1|BI130652 G108P76Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 464
Score = 131 bits (66), Expect = 2e-028
Identities = 177/214 (82%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
||||||||||||| |||||||| |||||||| ||| |||| |||||||| || |||||||
Sbjct: 66 agtaccacttctcatgccagtttacagctgatctttttgcaatgaaccatacagatttca 125
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
| |||||||||||||||||||| || || ||||||||||| || || || ||||| ||
Sbjct: 126 ttatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtatgaaa 185
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| ||||| | || || ||||| || ||||| || |
Sbjct: 186 gccacactgctttcactctccctggcctctatagagttgttcatggtattgatgtctttg 245
Query: 1626 atcccaagttcaacattgtctctcctggagcaga 1659
||||||| ||||||||||| || ||||| |||||
Sbjct: 246 atcccaaattcaacattgtatcccctggcgcaga 279
>gb|CF235850.1|CF235850 PtaJXT0027G3G0313 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 714
Score = 131 bits (66), Expect = 2e-028
Identities = 172/208 (82%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
||||||||||||| |||||||| |||||||| ||| |||| |||||||| || |||||||
Sbjct: 425 agtaccacttctcatgccagtttacagctgatctttttgcaatgaaccatacagatttca 484
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
| |||||||||||||||||||| || || ||||||||||| || || || ||||| ||
Sbjct: 485 ttatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtatgaaa 544
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| ||||| | || || ||||| || ||||| || |
Sbjct: 545 gccacactgctttcactctccctggcctctanngagttgttcatggtattgatgtctttg 604
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 605 atcccaaattcaacattgtatcccctgg 632
Score = 50.1 bits (25), Expect = 6e-004
Identities = 61/73 (83%)
Strand = Plus / Plus
Query: 1167 ttcgcgttcccttcagaaatgagaatggcatcctccgcaagtggatctctcgttttgatg 1226
|||| |||||||||||| ||| || || || ||||||| ||||||||||| ||||| |
Sbjct: 146 ttcgagttcccttcagagatggaaagggtatggtccgcaaatggatctctcgctttgaag 205
Query: 1227 tctggccatacct 1239
| |||||||||||
Sbjct: 206 tgtggccatacct 218
>gb|CK103506.1|CK103506 G120P78.5pR Populus tension wood cDNA library Populus tremula x
Populus tremuloides cDNA clone G120P78 5', mRNA sequence
Length = 602
Score = 131 bits (66), Expect = 2e-028
Identities = 177/214 (82%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
||||||||||||| |||||||| |||||||| ||| |||| |||||||| || |||||||
Sbjct: 253 agtaccacttctcatgccagtttacagctgatctttttgcaatgaaccatacagatttca 312
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
| |||||||||||||||||||| || || ||||||||||| || || || ||||| ||
Sbjct: 313 ttatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtatgaaa 372
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| ||||| | || || ||||| || ||||| || |
Sbjct: 373 gccacactgctttcactctccctggcctctatagagttgttcatggtattgatgtctttg 432
Query: 1626 atcccaagttcaacattgtctctcctggagcaga 1659
||||||| ||||||||||| || ||||| |||||
Sbjct: 433 atcccaaattcaacattgtatcccctggcgcaga 466
Score = 46.1 bits (23), Expect = 0.009
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 1284 tgcaggccaagcctgaccttatcattggcaactacagcgatgg 1326
|||||| ||||||||| ||||||||||| || ||||| |||||
Sbjct: 91 tgcagggcaagcctgatcttatcattggaaattacagtgatgg 133
Score = 46.1 bits (23), Expect = 0.009
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 1201 ccgcaagtggatctctcgttttgatgtctggccatacct 1239
|||||| ||||||||||| ||||| || |||||||||||
Sbjct: 8 ccgcaaatggatctctcgctttgaagtgtggccatacct 46
>gb|CF233979.1|CF233979 PtaJXO0029H3H0315 Poplar cDNA library from young opposite xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 445
Score = 127 bits (64), Expect = 3e-027
Identities = 76/80 (95%)
Strand = Plus / Plus
Query: 2869 atgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaagatg 2928
||||| || ||||||||||||||||||||||||||| | |||||||||||||||||||||
Sbjct: 93 atgagagctaagtggaagaagaagcgcatgaggaggttgaagaggaagcgcagaaagatg 152
Query: 2929 aggcagagatccaagtaggc 2948
||||||||||||||||||||
Sbjct: 153 aggcagagatccaagtaggc 172
>gb|CF234728.1|CF234728 PtaJXT0014D8D0808 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 474
Score = 127 bits (64), Expect = 3e-027
Identities = 142/168 (84%)
Strand = Plus / Plus
Query: 1486 catgaaccacaccgatttcatcatcaccagcacattccaagaaatcgcgggaagcaagga 1545
||||||||| || ||||||||||||||||||||||||||||| || || |||||||||||
Sbjct: 1 catgaaccatacagatttcatcatcaccagcacattccaagagattgctggaagcaagga 60
Query: 1546 caccgtggggcagtacgagtcccacatcgcgttcactcttcctgggctctaccgtgtcgt 1605
|| || || ||||||||| ||||| || |||||||| ||||| |||||| | || ||
Sbjct: 61 tactgttggacagtacgagagccacacagctttcactctccctggcctctacagagttgt 120
Query: 1606 ccatggcatcgatgttttcgatcccaagttcaacattgtctctcctgg 1653
||||| |||||||| || |||||||| ||||||||||| || |||||
Sbjct: 121 tcatggtatcgatgtatttgatcccaaattcaacattgtatcccctgg 168
>gb|CK107902.1|CK107902 G058P96 Populus tension wood cDNA library Populus tremula x Populus
tremuloides cDNA clone G058P96 5', mRNA sequence
Length = 503
Score = 127 bits (64), Expect = 3e-027
Identities = 172/208 (82%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
||||||||||||| |||||||| |||||||| ||| |||| |||||||| || |||||||
Sbjct: 135 agtaccacttctcatgccagtttacagctgatctttttgcaatgaaccatacagatttca 194
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
| ||||||||||||| |||||| || || ||||||||||| || || || ||||| ||
Sbjct: 195 ttatcaccagcacataccaagagattgctggaagcaaggatactgttggacagtatgaaa 254
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| ||||| | || |||||||| || ||||| || |
Sbjct: 255 gccacactgctttcactctccctggcctctatagagttgtccatggtattgatgtctttg 314
Query: 1626 atcccaagttcaacattgtctctcctgg 1653
||||||| ||||||||||| || |||||
Sbjct: 315 atcccaaattcaacattgtatcccctgg 342
>gb|BI131553.1|BI131553 G122P47Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 462
Score = 125 bits (63), Expect = 1e-026
Identities = 165/199 (82%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
||||||||||||| |||||||| |||||||| ||| |||| |||||||| || |||||||
Sbjct: 260 agtaccacttctcatgccagtttacagctgatctttttgcaatgaaccatacagatttca 319
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
| |||||||||||||||||||| || || ||||||||||| || || || ||||| ||
Sbjct: 320 ttatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtatgaaa 379
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| ||||| ||||| | || || ||||| || ||||| || |
Sbjct: 380 gccacactgctttcactctccctggcctctatagagttgttcatggtattgatgtctttg 439
Query: 1626 atcccaagttcaacattgt 1644
||||||| |||||||||||
Sbjct: 440 atcccaaattcaacattgt 458
Score = 48.1 bits (24), Expect = 0.002
Identities = 36/40 (90%)
Strand = Plus / Plus
Query: 1200 tccgcaagtggatctctcgttttgatgtctggccatacct 1239
||||||| ||||||||||| ||||| || |||||||||||
Sbjct: 14 tccgcaaatggatctctcgctttgaagtgtggccatacct 53
Score = 46.1 bits (23), Expect = 0.009
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 1284 tgcaggccaagcctgaccttatcattggcaactacagcgatgg 1326
|||||| ||||||||| ||||||||||| || ||||| |||||
Sbjct: 98 tgcagggcaagcctgatcttatcattggaaattacagtgatgg 140
>gb|BU821510.1|BU821510 UB24CPB03 Populus tremula cambium cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 466
Score = 123 bits (62), Expect = 5e-026
Identities = 176/214 (82%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
||||||||||||| |||||||| |||||||| ||| |||| |||||||| || |||||||
Sbjct: 130 agtaccacttctcatgccagtttacagctgatctttttgcaatgaaccatacagatttca 189
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
| |||||||||||||||||||| || || ||||||||||| || || || ||||| ||
Sbjct: 190 ttatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtatgaaa 249
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggcatcgatgttttcg 1625
||||| || |||||||| || || ||||| | || || ||||| || ||||| || |
Sbjct: 250 gccacactgctttcactctccccggcctctatagagttgttcatggtattgatgtctttg 309
Query: 1626 atcccaagttcaacattgtctctcctggagcaga 1659
||||||| ||||||||||| || ||||| |||||
Sbjct: 310 atcccaaattcaacattgtatcccctggcgcaga 343
>gb|CF236455.1|CF236455 PtaJXT3A12A1202 Poplar cDNA library from young tension xylem Populus
alba x Populus tremula cDNA 5', mRNA sequence
Length = 688
Score = 123 bits (62), Expect = 5e-026
Identities = 140/166 (84%)
Strand = Plus / Plus
Query: 1488 tgaaccacaccgatttcatcatcaccagcacattccaagaaatcgcgggaagcaaggaca 1547
||||||| || ||||||||||||||||||||||||||||| || || ||||||||||| |
Sbjct: 6 tgaaccatacagatttcatcatcaccagcacattccaagagattgctggaagcaaggata 65
Query: 1548 ccgtggggcagtacgagtcccacatcgcgttcactcttcctgggctctaccgtgtcgtcc 1607
| || || ||||||||| ||||| || |||||||| ||||| |||||| | || || |
Sbjct: 66 ctgttggacagtacgagagccacacagctttcactctccctggcctctacagagttgttc 125
Query: 1608 atggcatcgatgttttcgatcccaagttcaacattgtctctcctgg 1653
|||| |||||||| || |||||||| ||||||||||| || |||||
Sbjct: 126 atggtatcgatgtatttgatcccaaattcaacattgtatcccctgg 171
Score = 61.9 bits (31), Expect = 2e-007
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 2018 atgaaccgcgtccgcaacggggagctgtaccgctacatttgcgataccaagggcgcattc 2077
||||||||||| | || || ||||| ||||| |||||||| ||||||||||| || |||
Sbjct: 536 atgaaccgcgtgaggaatggagagctctaccgttacatttgtgataccaagggagctttc 595
Query: 2078 gtgcagcctgc 2088
|||||||||||
Sbjct: 596 gtgcagcctgc 606
>gb|CF237149.1|CF237149 Ptajxtjxt2F5F0511 Poplar cDNA library from young tension xylem
Populus alba x Populus tremula cDNA 5', mRNA sequence
Length = 565
Score = 123 bits (62), Expect = 5e-026
Identities = 162/193 (83%), Gaps = 2/193 (1%)
Strand = Plus / Plus
Query: 1463 cagttcacagctgaccttattgccatgaaccacaccg-atttcatcatcaccagcacatt 1521
||||| |||||||| ||| ||||||||||||| || | ||||||||||||||||||||||
Sbjct: 1 cagtttacagctgatctttttgccatgaaccatacaggatttcatcatcaccagcacatt 60
Query: 1522 ccaagaaatcgcgggaagcaa-ggacaccgtggggcagtacgagtcccacatcgcgttca 1580
|||||| || || |||||||| ||| || || || ||||||||| ||||| || ||||
Sbjct: 61 ccaagagattgctggaagcaagggatactgttggacagtacgagagccacacagctttca 120
Query: 1581 ctcttcctgggctctaccgtgtcgtccatggcatcgatgttttcgatcccaagttcaaca 1640
|||| ||||| |||||| | || || ||||| |||||||| || |||||||| |||||||
Sbjct: 121 ctctccctggcctctacagagttgttcatggnatcgatgtatttgatcccaaattcaaca 180
Query: 1641 ttgtctctcctgg 1653
|||| || |||||
Sbjct: 181 ttgtatcccctgg 193
>gb|BI130516.1|BI130516 G106P67Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 296
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Plus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 66 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 125
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 126 atgaggcagagatccaagtag 146
>gb|BU814342.1|BU814342 N028B03 Populus bark cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 293
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Plus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 68 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 127
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 128 atgaggcagagatccaagtag 148
>gb|BU824841.1|BU824841 UK100E04 Populus apical shoot cDNA library Populus tremula x Populus
tremuloides cDNA 5 prime, mRNA sequence
Length = 322
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Plus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 83 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 142
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 143 atgaggcagagatccaagtag 163
>gb|BU866311.1|BU866311 S065C02 Populus imbibed seed cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 334
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Plus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 83 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 142
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 143 atgaggcagagatccaagtag 163
>gb|CK116674.1|CK116674 B015P50 Hybrid aspen plasmid library Populus tremula x Populus
tremuloides cDNA clone B015P50 5', mRNA sequence
Length = 241
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Plus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 54 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 113
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 114 atgaggcagagatccaagtag 134
>gb|CV261825.1|CV261825 WS02017.B21_O03 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02017_O03 3', mRNA sequence
Length = 860
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Plus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 578 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 637
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 638 atgaggcagagatccaagtag 658
>gb|CX179218.1|CX179218 G04_45-72_14.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 383
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Plus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 100 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 159
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 160 atgaggcagagatccaagtag 180
>gb|CX183403.1|CX183403 B05_45-72_03.ab1 leaf inoculated with Marssonia pathogen of Populus
euramericana Populus x canadensis cDNA, mRNA sequence
Length = 454
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Plus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 81 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 140
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 141 atgaggcagagatccaagtag 161
>gb|DT524905.1|DT524905 WS02043.C21_O13 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02043_O13 3', mRNA sequence
Length = 329
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Minus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 276 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 217
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 216 atgaggcagagatccaagtag 196
>gb|DT525148.1|DT525148 WS02044.C21_J05 PTxN-IB-N-A-11 Populus trichocarpa x Populus nigra
cDNA clone WS02044_J05 3', mRNA sequence
Length = 782
Score = 121 bits (61), Expect = 2e-025
Identities = 76/81 (93%)
Strand = Plus / Minus
Query: 2866 accatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaag 2925
|||||||| |||||||||||||||||||| ||||||||| | |||||||||||| |||||
Sbjct: 735 accatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaag 676
Query: 2926 atgaggcagagatccaagtag 2946
|||||||||||||||||||||
Sbjct: 675 atgaggcagagatccaagtag 655
>gb|BI131388.1|BI131388 G120P19Y Populus cambium cDNA library Populus tremula x Populus
tremuloides cDNA, mRNA sequence
Length = 448
Score = 119 bits (60), Expect = 7e-025
Identities = 166/200 (83%), Gaps = 1/200 (0%)
Strand = Plus / Plus
Query: 1446 agtaccacttctcttgccagttcacagctgaccttattgccatgaaccacaccgatttca 1505
||||||||||||| |||||||| |||||||| ||| |||| |||||||| || |||||||
Sbjct: 246 agtaccacttctcatgccagtttacagctgatctttttgcaatgaaccatacagatttca 305
Query: 1506 tcatcaccagcacattccaagaaatcgcgggaagcaaggacaccgtggggcagtacgagt 1565
| |||||||||||||||||||| || || ||||||||||| || || || ||||| ||
Sbjct: 306 ttatcaccagcacattccaagagattgctggaagcaaggatactgttggacagtatgaaa 365
Query: 1566 cccacatcgcgttcactcttcctgggctctaccgtgtcgtccatggc-atcgatgttttc 1624
||||| || |||||||| ||||| ||||| | || || |||||| || ||||| ||
Sbjct: 366 gccacactgctttcactctccctggcctctatagagttgttcatggctattgatgtcttt 425
Query: 1625 gatcccaagttcaacattgt 1644
|||||||| |||||||||||
Sbjct: 426 gatcccaaattcaacattgt 445
Score = 46.1 bits (23), Expect = 0.009
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 1284 tgcaggccaagcctgaccttatcattggcaactacagcgatgg 1326
|||||| ||||||||| ||||||||||| || ||||| |||||
Sbjct: 84 tgcagggcaagcctgatcttatcattggaaattacagtgatgg 126
Score = 46.1 bits (23), Expect = 0.009
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 1201 ccgcaagtggatctctcgttttgatgtctggccatacct 1239
|||||| ||||||||||| ||||| || |||||||||||
Sbjct: 1 ccgcaaatggatctctcgctttgaagtgtggccatacct 39
>gb|BU816910.1|BU816910 UA10BPG02 Populus tremula cambium cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 317
Score = 119 bits (60), Expect = 7e-025
Identities = 75/80 (93%)
Strand = Plus / Plus
Query: 2867 ccatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaaga 2926
||||||| |||||||||||||||||||| ||||||||| | |||||||||||| ||||||
Sbjct: 74 ccatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaaga 133
Query: 2927 tgaggcagagatccaagtag 2946
||||||||||||||||||||
Sbjct: 134 tgaggcagagatccaagtag 153
>gb|BU817019.1|BU817019 UA11BPH10 Populus tremula cambium cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 317
Score = 119 bits (60), Expect = 7e-025
Identities = 75/80 (93%)
Strand = Plus / Plus
Query: 2867 ccatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaaga 2926
||||||| |||||||||||||||||||| ||||||||| | |||||||||||| ||||||
Sbjct: 74 ccatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaaga 133
Query: 2927 tgaggcagagatccaagtag 2946
||||||||||||||||||||
Sbjct: 134 tgaggcagagatccaagtag 153
>gb|BU820043.1|BU820043 UA50BPF05 Populus tremula cambium cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 322
Score = 119 bits (60), Expect = 7e-025
Identities = 75/80 (93%)
Strand = Plus / Plus
Query: 2867 ccatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaaga 2926
||||||| |||||||||||||||||||| ||||||||| | |||||||||||| ||||||
Sbjct: 75 ccatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaaga 134
Query: 2927 tgaggcagagatccaagtag 2946
||||||||||||||||||||
Sbjct: 135 tgaggcagagatccaagtag 154
>gb|BU824605.1|BU824605 UB66DPE12 Populus tremula cambium cDNA library Populus tremula cDNA 5
prime, mRNA sequence
Length = 322
Score = 119 bits (60), Expect = 7e-025
Identities = 75/80 (93%)
Strand = Plus / Plus
Query: 2867 ccatgagggccaagtggaagaagaagcgcatgaggaggctcaagaggaagcgcagaaaga 2926
||||||| |||||||||||||||||||| ||||||||| | |||||||||||| ||||||
Sbjct: 76 ccatgagagccaagtggaagaagaagcgtatgaggaggttgaagaggaagcgccgaaaga 135
Query: 2927 tgaggcagagatccaagtag 2946
||||||||||||||||||||
Sbjct: 136 tgaggcagagatccaagtag 155
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 365,727
Number of Sequences: 369679
Number of extensions: 365727
Number of successful extensions: 103028
Number of sequences better than 0.5: 494
Number of HSP's better than 0.5 without gapping: 493
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 101825
Number of HSP's gapped (non-prelim): 1093
length of query: 3445
length of database: 203,408,664
effective HSP length: 20
effective length of query: 3425
effective length of database: 196,015,084
effective search space: 671351662700
effective search space used: 671351662700
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)