BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.203
(959 letters)
Database: Populus_nucl_with_EST.fasta
369,679 sequences; 203,408,664 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA928899.1|CA928899 MTU6TR.P8.B08 Aspen root cDNA Librar... 40 0.15
>gb|CA928899.1|CA928899 MTU6TR.P8.B08 Aspen root cDNA Library Populus tremuloides cDNA,
mRNA sequence
Length = 341
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 402 ttgatggcggtgcaaaggca 421
||||||||||||||||||||
Sbjct: 183 ttgatggcggtgcaaaggca 164
Database: Populus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:49 PM
Number of letters in database: 203,408,664
Number of sequences in database: 369,679
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 68,165
Number of Sequences: 369679
Number of extensions: 68165
Number of successful extensions: 18489
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18488
Number of HSP's gapped (non-prelim): 1
length of query: 959
length of database: 203,408,664
effective HSP length: 19
effective length of query: 940
effective length of database: 196,384,763
effective search space: 184601677220
effective search space used: 184601677220
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)