BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCT19a08.yg.2.1
(645 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BG039059.1|BG039059 NXSI_092_C04_F NXSI (Nsf Xylem Side ... 42 0.028
gb|CO159471.1|CO159471 FLD1_13_G01.g1_A029 Root flooded Pin... 42 0.028
gb|CO176000.1|CO176000 NDL1_58_F11.g1_A029 Needles control ... 42 0.028
gb|CV034213.1|CV034213 RTNACL1_39_A03.g1_A029 Roots plus ad... 40 0.11
gb|DR179312.1|DR179312 RTMNUT1_21_G01.b2_A029 Roots minus m... 40 0.11
gb|DR179988.1|DR179988 RTMNUT1_25_G03.g1_A029 Roots minus m... 40 0.11
gb|CF398874.1|CF398874 RTDS3_11_F02.b1_A022 Drought-stresse... 38 0.43
gb|DR022029.1|DR022029 STRS1_48_H12.b1_A034 Shoot tip pitch... 38 0.43
>gb|BG039059.1|BG039059 NXSI_092_C04_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_092_C04 5', mRNA sequence
Length = 268
Score = 42.1 bits (21), Expect = 0.028
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 73 cttcgacgtcagcttcaactc 93
|||||||||||||||||||||
Sbjct: 142 cttcgacgtcagcttcaactc 162
>gb|CO159471.1|CO159471 FLD1_13_G01.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_13_G01_A029 5', mRNA sequence
Length = 756
Score = 42.1 bits (21), Expect = 0.028
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 73 cttcgacgtcagcttcaactc 93
|||||||||||||||||||||
Sbjct: 425 cttcgacgtcagcttcaactc 445
>gb|CO176000.1|CO176000 NDL1_58_F11.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_58_F11_A029 5', mRNA sequence
Length = 844
Score = 42.1 bits (21), Expect = 0.028
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 73 cttcgacgtcagcttcaactc 93
|||||||||||||||||||||
Sbjct: 165 cttcgacgtcagcttcaactc 185
>gb|CV034213.1|CV034213 RTNACL1_39_A03.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_39_A03_A029 5', mRNA sequence
Length = 682
Score = 40.1 bits (20), Expect = 0.11
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 568 tgcttagattagtagtgttc 587
||||||||||||||||||||
Sbjct: 227 tgcttagattagtagtgttc 208
>gb|DR179312.1|DR179312 RTMNUT1_21_G01.b2_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_21_G01_A029 3', mRNA sequence
Length = 830
Score = 40.1 bits (20), Expect = 0.11
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 568 tgcttagattagtagtgttc 587
||||||||||||||||||||
Sbjct: 611 tgcttagattagtagtgttc 630
>gb|DR179988.1|DR179988 RTMNUT1_25_G03.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_25_G03_A029 5', mRNA sequence
Length = 809
Score = 40.1 bits (20), Expect = 0.11
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 568 tgcttagattagtagtgttc 587
||||||||||||||||||||
Sbjct: 218 tgcttagattagtagtgttc 199
>gb|CF398874.1|CF398874 RTDS3_11_F02.b1_A022 Drought-stressed loblolly pine roots DS3 Pinus
taeda cDNA clone RTDS3_11_F02_A022 3', mRNA sequence
Length = 679
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 568 tgcttagattagtagtgtt 586
|||||||||||||||||||
Sbjct: 469 tgcttagattagtagtgtt 487
>gb|DR022029.1|DR022029 STRS1_48_H12.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_48_H12_A034 3', mRNA sequence
Length = 795
Score = 38.2 bits (19), Expect = 0.43
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 568 tgcttagattagtagtgtt 586
|||||||||||||||||||
Sbjct: 477 tgcttagattagtagtgtt 459
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 46,913
Number of Sequences: 355925
Number of extensions: 46913
Number of successful extensions: 13365
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 13357
Number of HSP's gapped (non-prelim): 8
length of query: 645
length of database: 217,277,237
effective HSP length: 19
effective length of query: 626
effective length of database: 210,514,662
effective search space: 131782178412
effective search space used: 131782178412
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)