BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QCA17a05.yg.2.1
         (548 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|DR694121.1|DR694121  EST1084211 Normalized pine embryo li...    40   0.092
gb|DT638404.1|DT638404  EST1153335 Normalized pine embryo li...    40   0.092

>gb|DR694121.1|DR694121 EST1084211 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAE837 3' end, mRNA sequence
          Length = 746

 Score = 40.1 bits (20), Expect = 0.092
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagcc 488
           |||||||| |||||||| || || ||||||||||| ||||
Sbjct: 220 acccacatccccatgctaacatcttccatcttgaaaagcc 181



>gb|DT638404.1|DT638404 EST1153335 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMHE72 3' end, mRNA sequence
          Length = 824

 Score = 40.1 bits (20), Expect = 0.092
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 449 acccacatgcccatgctcacgtcctccatcttgaacagcc 488
           |||||||| |||||||| || || ||||||||||| ||||
Sbjct: 297 acccacatccccatgctaacatcttccatcttgaaaagcc 258



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 53,693
Number of Sequences: 355925
Number of extensions: 53693
Number of successful extensions: 11766
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11764
Number of HSP's gapped (non-prelim): 2
length of query: 548
length of database: 217,277,237
effective HSP length: 19
effective length of query: 529
effective length of database: 210,514,662
effective search space: 111362256198
effective search space used: 111362256198
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)