BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBTB.064D08F020918.3.1
         (559 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|DR683075.1|DR683075  EST1073151 Normalized pine embryo li...    38   0.37 
gb|CF392212.1|CF392212  RTDR3_8_F01.g1_A022 Loblolly pine ro...    36   1.5  
gb|CZ895943.1|CZ895943  226_2_12340929_5489_37962_079 Pine m...    34   5.8  
gb|CF672105.1|CF672105  RTCNT1_61_H10.b1_A029 Root control P...    34   5.8  
gb|CX652687.1|CX652687  COLD1_60_G05.g1_A029 Root cold Pinus...    34   5.8  
gb|DR055333.1|DR055333  RTCA1_23_B10.b1_A029 Roots minus cal...    34   5.8  
gb|DR743112.1|DR743112  RTCU1_13_D06.g1_A029 Roots plus adde...    34   5.8  

>gb|DR683075.1|DR683075 EST1073151 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAAE21 3' end, mRNA sequence
          Length = 751

 Score = 38.2 bits (19), Expect = 0.37
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 508 gtcaaacatttcccaggca 526
           |||||||||||||||||||
Sbjct: 11  gtcaaacatttcccaggca 29



>gb|CF392212.1|CF392212 RTDR3_8_F01.g1_A022 Loblolly pine roots recovering from drought DR3
           Pinus taeda cDNA clone RTDR3_8_F01_A022 5', mRNA
           sequence
          Length = 403

 Score = 36.2 bits (18), Expect = 1.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 66  tgatgggttgccaatcag 83
           ||||||||||||||||||
Sbjct: 365 tgatgggttgccaatcag 382



>gb|CZ895943.1|CZ895943 226_2_12340929_5489_37962_079 Pine methylation unfiltered library
           (LibID: 226) Pinus taeda genomic, DNA sequence
          Length = 606

 Score = 34.2 bits (17), Expect = 5.8
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 531 aaatgatgcactcaaagaaca 551
           |||||| ||||||||||||||
Sbjct: 167 aaatgaagcactcaaagaaca 147



>gb|CF672105.1|CF672105 RTCNT1_61_H10.b1_A029 Root control Pinus taeda cDNA clone
           RTCNT1_61_H10_A029 3', mRNA sequence
          Length = 472

 Score = 34.2 bits (17), Expect = 5.8
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 493 aaatggtgtaaaatggt 509
           |||||||||||||||||
Sbjct: 412 aaatggtgtaaaatggt 396



>gb|CX652687.1|CX652687 COLD1_60_G05.g1_A029 Root cold Pinus taeda cDNA clone
           COLD1_60_G05_A029 5', mRNA sequence
          Length = 531

 Score = 34.2 bits (17), Expect = 5.8
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 179 gactgtgccaaggcgtg 195
           |||||||||||||||||
Sbjct: 26  gactgtgccaaggcgtg 10



>gb|DR055333.1|DR055333 RTCA1_23_B10.b1_A029 Roots minus calcium Pinus taeda cDNA clone
           RTCA1_23_B10_A029 3', mRNA sequence
          Length = 561

 Score = 34.2 bits (17), Expect = 5.8
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 230 aaattgtccagaacttcacgg 250
           |||||| ||||||||||||||
Sbjct: 319 aaattgcccagaacttcacgg 299



>gb|DR743112.1|DR743112 RTCU1_13_D06.g1_A029 Roots plus added copper Pinus taeda cDNA clone
           RTCU1_13_D06_A029 5', mRNA sequence
          Length = 705

 Score = 34.2 bits (17), Expect = 5.8
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 474 gcagcaagtttatggaa 490
           |||||||||||||||||
Sbjct: 328 gcagcaagtttatggaa 312



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  May 2, 2006  3:25 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 63,346
Number of Sequences: 355925
Number of extensions: 63346
Number of successful extensions: 16014
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16007
Number of HSP's gapped (non-prelim): 7
length of query: 559
length of database: 217,277,237
effective HSP length: 19
effective length of query: 540
effective length of database: 210,514,662
effective search space: 113677917480
effective search space used: 113677917480
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)