BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBTB.006E19F020311.3.1
         (789 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CF401053.1|CF401053  RTWW1_9_H08.g1_A015 Well-watered lob...    40   0.13 

>gb|CF401053.1|CF401053 RTWW1_9_H08.g1_A015 Well-watered loblolly pine roots WW1 Pinus
           taeda cDNA clone RTWW1_9_H08_A015 5', mRNA sequence
          Length = 744

 Score = 40.1 bits (20), Expect = 0.13
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 709 gcagattgcacttgcatttt 728
           ||||||||||||||||||||
Sbjct: 644 gcagattgcacttgcatttt 663



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 102,724
Number of Sequences: 355925
Number of extensions: 102724
Number of successful extensions: 28264
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28263
Number of HSP's gapped (non-prelim): 1
length of query: 789
length of database: 217,277,237
effective HSP length: 19
effective length of query: 770
effective length of database: 210,514,662
effective search space: 162096289740
effective search space used: 162096289740
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)