BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBL16c05.xg.2.1
(687 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX784172.1|BX784172 BX784172 Pinus pinaster differenciat... 64 8e-009
gb|AY356371.1| Pinus taeda R2R3-MYB transcription factor (M... 64 8e-009
gb|CF390133.1|CF390133 RTDR2_12_C07.g1_A021 Loblolly pine r... 48 5e-004
gb|CO172303.1|CO172303 NDL1_28_G10.g1_A029 Needles control ... 48 5e-004
gb|DR071883.1|DR071883 RTDK1_22_E02.g1_A029 Roots, dark Pin... 48 5e-004
gb|DR694707.1|DR694707 EST1084799 Normalized pine embryo li... 48 5e-004
gb|DT638995.1|DT638995 EST1153926 Normalized pine embryo li... 48 5e-004
gb|AY356372.1| Pinus taeda R2R3-MYB transcription factor (M... 48 5e-004
gb|BG319376.1|BG319376 NXPV_027_C05_F NXPV (Nsf Xylem Plani... 46 0.002
gb|BQ634727.1|BQ634727 NXRV072_E09_F NXRV (Nsf Xylem Root w... 46 0.002
gb|CD022618.1|CD022618 NXPV_071_H11_F NXPV (Nsf Xylem Plani... 46 0.002
gb|CF385274.1|CF385274 RTDR1_2_D01.g1_A015 Loblolly pine ro... 46 0.002
gb|CF388652.1|CF388652 RTDR2_4_A10.g1_A021 Loblolly pine ro... 46 0.002
gb|CF389081.1|CF389081 RTDR2_13_A10.g1_A021 Loblolly pine r... 46 0.002
gb|CF400460.1|CF400460 RTWW1_5_H12.g1_A015 Well-watered lob... 46 0.002
gb|CF401736.1|CF401736 RTWW1_14_C05.g1_A015 Well-watered lo... 46 0.002
gb|CF402623.1|CF402623 RTWW1_21_B11.g1_A015 Well-watered lo... 46 0.002
gb|CO162411.1|CO162411 FLD1_35_D02.b1_A029 Root flooded Pin... 46 0.002
gb|CV034082.1|CV034082 RTNACL1_38_B11.g1_A029 Roots plus ad... 46 0.002
gb|CX646616.1|CX646616 COLD1_10_A05.g1_A029 Root cold Pinus... 46 0.002
gb|CX648418.1|CX648418 COLD1_28_B12.g1_A029 Root cold Pinus... 46 0.002
gb|DR057958.1|DR057958 RTNIT1_8_G05.g1_A029 Roots minus nit... 46 0.002
gb|DR111427.1|DR111427 RTS1_17_F02.g1_A029 Roots minus sulf... 46 0.002
gb|DR164052.1|DR164052 RTFE1_46_B11.g1_A029 Roots minus iro... 46 0.002
gb|DR168212.1|DR168212 RTPHOS1_23_H12.g1_A029 Roots minus p... 46 0.002
gb|DR178268.1|DR178268 RTMNUT1_10_C01.g1_A029 Roots minus m... 46 0.002
gb|DR179654.1|DR179654 RTMNUT1_23_B05.g2_A029 Roots minus m... 46 0.002
gb|DR387764.1|DR387764 RTHG1_24_A11.b1_A029 Roots plus adde... 46 0.002
gb|DR387774.1|DR387774 RTHG1_24_B11.b1_A029 Roots plus adde... 46 0.002
gb|BQ290999.1|BQ290999 NXRV054_D07_F NXRV (Nsf Xylem Root w... 44 0.007
gb|CO164542.1|CO164542 FLD1_48_E08.g1_A029 Root flooded Pin... 44 0.007
gb|CO366297.1|CO366297 RTK1_27_B09.b1_A029 Roots minus pota... 44 0.007
gb|DR050898.1|DR050898 RTBOR1_26_H05.b1_A029 Roots plus add... 44 0.007
gb|DR167765.1|DR167765 RTPHOS1_20_H05.g1_A029 Roots minus p... 44 0.007
gb|DR683147.1|DR683147 EST1073223 Normalized pine embryo li... 42 0.029
gb|DT631233.1|DT631233 EST1146164 Normalized pine embryo li... 42 0.029
gb|CO201585.1|CO201585 RTCNT2_6_F07.g1_A029 Root control 2 ... 38 0.46
gb|DR051127.1|DR051127 RTBOR1_27_G08.g1_A029 Roots plus add... 38 0.46
gb|DR163874.1|DR163874 RTFE1_45_A12.g1_A029 Roots minus iro... 38 0.46
gb|DR167401.1|DR167401 RTPHOS1_18_C09.g1_A029 Roots minus p... 38 0.46
>gb|BX784172.1|BX784172 BX784172 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 130B11, mRNA sequence
Length = 685
Score = 63.9 bits (32), Expect = 8e-009
Identities = 122/152 (80%)
Strand = Plus / Plus
Query: 329 ctctggtcccctgaggaggatgagaaactcatgaatcacataacaaagcatggccatggc 388
|||||||| |||||||||||||| |||||||| || |||| | || | ||||| ||
Sbjct: 107 ctctggtcgcctgaggaggatgataaactcatcaactacatgatgaaaaacggccagggt 166
Query: 389 tgctggagctctgttcccaaactcgctgggcttcaaaggtgcggaaagagttgtaggctg 448
||||||||| ||| |||| | ||||| || || || |||||||| || |||||||||
Sbjct: 167 tgctggagcgatgtcgccaagcaagctggtctgcagagatgcggaaaaagctgtaggctg 226
Query: 449 aggtggataaactatctgaggccagacctcaa 480
|||||||| |||||| | ||||| ||||||||
Sbjct: 227 aggtggattaactatttaaggcccgacctcaa 258
>gb|AY356371.1| Pinus taeda R2R3-MYB transcription factor (MYB4) mRNA, complete cds
Length = 945
Score = 63.9 bits (32), Expect = 8e-009
Identities = 122/152 (80%)
Strand = Plus / Plus
Query: 329 ctctggtcccctgaggaggatgagaaactcatgaatcacataacaaagcatggccatggc 388
|||||||| |||||||||||||| |||||||| || |||| | || | ||||| ||
Sbjct: 61 ctctggtcgcctgaggaggatgataaactcatcaactacatgatgaaaaacggccagggt 120
Query: 389 tgctggagctctgttcccaaactcgctgggcttcaaaggtgcggaaagagttgtaggctg 448
||||||||| ||| |||| | ||||| || || || |||||||| || |||||||||
Sbjct: 121 tgctggagcgatgtcgccaagcaagctggtctgcagagatgcggaaaaagctgtaggctg 180
Query: 449 aggtggataaactatctgaggccagacctcaa 480
|||||||| |||||| | ||||| ||||||||
Sbjct: 181 aggtggattaactatttaaggcccgacctcaa 212
>gb|CF390133.1|CF390133 RTDR2_12_C07.g1_A021 Loblolly pine roots recovering from drought
DR2 Pinus taeda cDNA clone RTDR2_12_C07_A021 5', mRNA
sequence
Length = 712
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 573 tgccagggaggactgataatgagatcaagaat 604
|||||||||| |||||||| ||||||||||||
Sbjct: 563 tgccagggagaactgataacgagatcaagaat 594
>gb|CO172303.1|CO172303 NDL1_28_G10.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_28_G10_A029 5', mRNA sequence
Length = 751
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 573 tgccagggaggactgataatgagatcaagaat 604
|||||||||| |||||||| ||||||||||||
Sbjct: 183 tgccagggagaactgataacgagatcaagaat 214
>gb|DR071883.1|DR071883 RTDK1_22_E02.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_22_E02_A029 5', mRNA sequence
Length = 708
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 573 tgccagggaggactgataatgagatcaagaat 604
|||||||||| |||||||| ||||||||||||
Sbjct: 458 tgccagggagaactgataacgagatcaagaat 489
>gb|DR694707.1|DR694707 EST1084799 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAEF89 3' end, mRNA sequence
Length = 790
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 573 tgccagggaggactgataatgagatcaagaat 604
|||||||||| |||||||| ||||||||||||
Sbjct: 225 tgccagggagaactgataacgagatcaagaat 256
>gb|DT638995.1|DT638995 EST1153926 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMHL85 3' end, mRNA sequence
Length = 812
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 573 tgccagggaggactgataatgagatcaagaat 604
|||||||||| |||||||| ||||||||||||
Sbjct: 233 tgccagggagaactgataacgagatcaagaat 264
>gb|AY356372.1| Pinus taeda R2R3-MYB transcription factor (MYB1) mRNA, complete cds
Length = 1023
Score = 48.1 bits (24), Expect = 5e-004
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 573 tgccagggaggactgataatgagatcaagaat 604
|||||||||| |||||||| ||||||||||||
Sbjct: 287 tgccagggagaactgataacgagatcaagaat 318
>gb|BG319376.1|BG319376 NXPV_027_C05_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_027_C05 5' similar to Arabidopsis
thaliana sequence At1g63910 putative MYB family
transcription factor see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 296
Score = 46.1 bits (23), Expect = 0.002
Identities = 59/71 (83%)
Strand = Plus / Plus
Query: 326 gggctctggtcccctgaggaggatgagaaactcatgaatcacataacaaagcatggccat 385
||||| ||||| || || ||||||||||| ||||| ||| ||||||| ||| |||| ||
Sbjct: 54 gggctatggtcaccagatgaggatgagaagctcatcaattacataaccaagtatggttat 113
Query: 386 ggctgctggag 396
||||| |||||
Sbjct: 114 ggctgttggag 124
>gb|BQ634727.1|BQ634727 NXRV072_E09_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV072_E09 5' similar to Arabidopsis thaliana
sequence At1g09540 putative transcription factor (MYB61)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 742
Score = 46.1 bits (23), Expect = 0.002
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 554 tctcaaattgcagcgcagctgccagggaggactgataatgagatcaagaatctatggaac 613
|||||||| ||| | || ||||| || || |||||||| ||||||||||| || ||||||
Sbjct: 593 tctcaaatagcaacacacctgcccggaagnactgataacgagatcaagaacctctggaac 652
Query: 614 tc 615
||
Sbjct: 653 tc 654
>gb|CD022618.1|CD022618 NXPV_071_H11_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_071_H11 5' similar to Arabidopsis
thaliana sequence At1g63910 putative MYB family
transcription factor see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 193
Score = 46.1 bits (23), Expect = 0.002
Identities = 59/71 (83%)
Strand = Plus / Plus
Query: 326 gggctctggtcccctgaggaggatgagaaactcatgaatcacataacaaagcatggccat 385
||||| ||||| || || ||||||||||| ||||| ||| ||||||| ||| |||| ||
Sbjct: 54 gggctatggtcaccagatgaggatgagaagctcatcaattacataaccaagtatggttat 113
Query: 386 ggctgctggag 396
||||| |||||
Sbjct: 114 ggctgttggag 124
>gb|CF385274.1|CF385274 RTDR1_2_D01.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_2_D01_A015 5', mRNA
sequence
Length = 703
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 41 tgcggaaagagctgtaggctgcgatggataaacta 75
>gb|CF388652.1|CF388652 RTDR2_4_A10.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_4_A10_A021 5', mRNA
sequence
Length = 760
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 169 tgcggaaagagctgtaggctgcgatggataaacta 203
>gb|CF389081.1|CF389081 RTDR2_13_A10.g1_A021 Loblolly pine roots recovering from drought
DR2 Pinus taeda cDNA clone RTDR2_13_A10_A021 5', mRNA
sequence
Length = 743
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 95 tgcggaaagagctgtaggctgcgatggataaacta 129
>gb|CF400460.1|CF400460 RTWW1_5_H12.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_5_H12_A015 5', mRNA sequence
Length = 747
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 103 tgcggaaagagctgtaggctgcgatggataaacta 137
>gb|CF401736.1|CF401736 RTWW1_14_C05.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_14_C05_A015 5', mRNA sequence
Length = 792
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 138 tgcggaaagagctgtaggctgcgatggataaacta 172
>gb|CF402623.1|CF402623 RTWW1_21_B11.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_21_B11_A015 5', mRNA sequence
Length = 755
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 115 tgcggaaagagctgtaggctgcgatggataaacta 149
>gb|CO162411.1|CO162411 FLD1_35_D02.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_35_D02_A029 3', mRNA sequence
Length = 717
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 661 tgcggaaagagctgtaggctgcgatggataaacta 627
>gb|CV034082.1|CV034082 RTNACL1_38_B11.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_38_B11_A029 5', mRNA sequence
Length = 734
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 146 tgcggaaagagctgtaggctgcgatggataaacta 180
>gb|CX646616.1|CX646616 COLD1_10_A05.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_10_A05_A029 5', mRNA sequence
Length = 887
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 138 tgcggaaagagctgtaggctgcgatggataaacta 172
>gb|CX648418.1|CX648418 COLD1_28_B12.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_28_B12_A029 5', mRNA sequence
Length = 868
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 150 tgcggaaagagctgtaggctgcgatggataaacta 184
>gb|DR057958.1|DR057958 RTNIT1_8_G05.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_8_G05_A029 5', mRNA sequence
Length = 849
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 106 tgcggaaagagctgtaggctgcgatggataaacta 140
>gb|DR111427.1|DR111427 RTS1_17_F02.g1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_17_F02_A029 5', mRNA sequence
Length = 630
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 155 tgcggaaagagctgtaggctgcgatggataaacta 189
>gb|DR164052.1|DR164052 RTFE1_46_B11.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_46_B11_A029 5', mRNA sequence
Length = 834
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 186 tgcggaaagagctgtaggctgcgatggataaacta 220
>gb|DR168212.1|DR168212 RTPHOS1_23_H12.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_23_H12_A029 5', mRNA sequence
Length = 600
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 147 tgcggaaagagctgtaggctgcgatggataaacta 181
>gb|DR178268.1|DR178268 RTMNUT1_10_C01.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_10_C01_A029 5', mRNA sequence
Length = 719
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 133 tgcggaaagagctgtaggctgcgatggataaacta 167
>gb|DR179654.1|DR179654 RTMNUT1_23_B05.g2_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_23_B05_A029 5', mRNA sequence
Length = 685
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 57 tgcggaaagagctgtaggctgcgatggataaacta 91
>gb|DR387764.1|DR387764 RTHG1_24_A11.b1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_24_A11_A029 3', mRNA sequence
Length = 796
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 647 tgcggaaagagctgtaggctgcgatggataaacta 613
>gb|DR387774.1|DR387774 RTHG1_24_B11.b1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_24_B11_A029 3', mRNA sequence
Length = 781
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
||||||||||| ||||||||| | |||||||||||
Sbjct: 623 tgcggaaagagctgtaggctgcgatggataaacta 589
>gb|BQ290999.1|BQ290999 NXRV054_D07_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV054_D07 5' similar to Arabidopsis thaliana
sequence At1g09540 putative transcription factor (MYB61)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 764
Score = 44.1 bits (22), Expect = 0.007
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 554 tctcaaattgcagcgcagctgccagggaggactgataatgagatcaagaatctatggaac 613
|||||||| ||| | || ||||| || || |||||||| ||||||||||| || ||||||
Sbjct: 587 tctcaaatagcaacacacctgcccggaagaactgataacgagatcaagaacctctggaac 646
Query: 614 tc 615
||
Sbjct: 647 tc 648
>gb|CO164542.1|CO164542 FLD1_48_E08.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_48_E08_A029 5', mRNA sequence
Length = 862
Score = 44.1 bits (22), Expect = 0.007
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 431 ggaaagagttgtaggctgaggtggataaactatctgag 468
|||||||||||| | ||| |||||| ||||||||||||
Sbjct: 28 ggaaagagttgtcgcctgcggtggacaaactatctgag 65
>gb|CO366297.1|CO366297 RTK1_27_B09.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_27_B09_A029 3', mRNA sequence
Length = 904
Score = 44.1 bits (22), Expect = 0.007
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 431 ggaaagagttgtaggctgaggtggataaactatctgag 468
|||||||||||| | ||| |||||| ||||||||||||
Sbjct: 772 ggaaagagttgtcgcctgcggtggacaaactatctgag 735
>gb|DR050898.1|DR050898 RTBOR1_26_H05.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_26_H05_A029 3', mRNA sequence
Length = 793
Score = 44.1 bits (22), Expect = 0.007
Identities = 52/62 (83%)
Strand = Plus / Minus
Query: 554 tctcaaattgcagcgcagctgccagggaggactgataatgagatcaagaatctatggaac 613
|||||||| ||| | || ||||| || || |||||||| ||||||||||| || ||||||
Sbjct: 432 tctcaaatagcaacacatctgcccggaagaactgataacgagatcaagaacctctggaac 373
Query: 614 tc 615
||
Sbjct: 372 tc 371
>gb|DR167765.1|DR167765 RTPHOS1_20_H05.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_20_H05_A029 5', mRNA sequence
Length = 806
Score = 44.1 bits (22), Expect = 0.007
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 431 ggaaagagttgtaggctgaggtggataaactatctgag 468
|||||||||||| | ||| |||||| ||||||||||||
Sbjct: 110 ggaaagagttgtcgcctgcggtggacaaactatctgag 147
>gb|DR683147.1|DR683147 EST1073223 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAAE70 3' end, mRNA sequence
Length = 768
Score = 42.1 bits (21), Expect = 0.029
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 434 aagagttgtaggctgaggtgg 454
|||||||||||||||||||||
Sbjct: 360 aagagttgtaggctgaggtgg 380
>gb|DT631233.1|DT631233 EST1146164 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMF647 3' end, mRNA sequence
Length = 762
Score = 42.1 bits (21), Expect = 0.029
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 434 aagagttgtaggctgaggtgg 454
|||||||||||||||||||||
Sbjct: 298 aagagttgtaggctgaggtgg 318
>gb|CO201585.1|CO201585 RTCNT2_6_F07.g1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_6_F07_A029 5', mRNA sequence
Length = 859
Score = 38.2 bits (19), Expect = 0.46
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
|||||||||||||| ||||| | |||||||||||
Sbjct: 75 tgcggaaagagttgcaggctccgatggataaacta 109
>gb|DR051127.1|DR051127 RTBOR1_27_G08.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_27_G08_A029 5', mRNA sequence
Length = 772
Score = 38.2 bits (19), Expect = 0.46
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 426 ggtgcggaaagagttgtag 444
|||||||||||||||||||
Sbjct: 180 ggtgcggaaagagttgtag 198
>gb|DR163874.1|DR163874 RTFE1_45_A12.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_45_A12_A029 5', mRNA sequence
Length = 896
Score = 38.2 bits (19), Expect = 0.46
Identities = 31/35 (88%)
Strand = Plus / Plus
Query: 428 tgcggaaagagttgtaggctgaggtggataaacta 462
|||||||||||||| ||||| | |||||||||||
Sbjct: 104 tgcggaaagagttgcaggctccgatggataaacta 138
>gb|DR167401.1|DR167401 RTPHOS1_18_C09.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_18_C09_A029 5', mRNA sequence
Length = 850
Score = 38.2 bits (19), Expect = 0.46
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 426 ggtgcggaaagagttgtag 444
|||||||||||||||||||
Sbjct: 178 ggtgcggaaagagttgtag 196
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 84,331
Number of Sequences: 355925
Number of extensions: 84331
Number of successful extensions: 25236
Number of sequences better than 0.5: 40
Number of HSP's better than 0.5 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25179
Number of HSP's gapped (non-prelim): 57
length of query: 687
length of database: 217,277,237
effective HSP length: 19
effective length of query: 668
effective length of database: 210,514,662
effective search space: 140623794216
effective search space used: 140623794216
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)