BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAN11a10.yg.3.1
(1341 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW226482.1|AW226482 ST82H02 Pine TriplEx shoot tip libra... 42 0.058
gb|AW587600.1|AW587600 ST60D05 Pine TriplEx shoot tip libra... 42 0.058
gb|BX255141.1|BX255141 BX255141 Pinus pinaster differenciat... 42 0.058
gb|CF390626.1|CF390626 RTDR2_20_E02.g1_A021 Loblolly pine r... 42 0.058
gb|DR687768.1|DR687768 EST1077850 Normalized pine embryo li... 42 0.058
gb|DT632758.1|DT632758 EST1147689 Normalized pine embryo li... 42 0.058
>gb|AW226482.1|AW226482 ST82H02 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST82H02, mRNA sequence
Length = 365
Score = 42.1 bits (21), Expect = 0.058
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 98 gagtatgtcaacatagatgattgctgggcggag 130
|||||||| || ||||||||||| |||||||||
Sbjct: 275 gagtatgtaaatatagatgattgttgggcggag 307
>gb|AW587600.1|AW587600 ST60D05 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST60D05, mRNA sequence
Length = 447
Score = 42.1 bits (21), Expect = 0.058
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 98 gagtatgtcaacatagatgattgctgggcggag 130
|||||||| || ||||||||||| |||||||||
Sbjct: 272 gagtatgtaaatatagatgattgttgggcggag 304
>gb|BX255141.1|BX255141 BX255141 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP111G01, mRNA sequence
Length = 665
Score = 42.1 bits (21), Expect = 0.058
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 98 gagtatgtcaacatagatgattgctgggcggag 130
|||||||| || ||||||||||| |||||||||
Sbjct: 277 gagtatgtaaatatagatgattgttgggcggag 309
>gb|CF390626.1|CF390626 RTDR2_20_E02.g1_A021 Loblolly pine roots recovering from drought
DR2 Pinus taeda cDNA clone RTDR2_20_E02_A021 5', mRNA
sequence
Length = 666
Score = 42.1 bits (21), Expect = 0.058
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 98 gagtatgtcaacatagatgattgctgggcggag 130
|||||||| || ||||||||||| |||||||||
Sbjct: 255 gagtatgtaaatatagatgattgttgggcggag 287
>gb|DR687768.1|DR687768 EST1077850 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABW35 3' end, mRNA sequence
Length = 821
Score = 42.1 bits (21), Expect = 0.058
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 98 gagtatgtcaacatagatgattgctgggcggag 130
|||||||| || ||||||||||| |||||||||
Sbjct: 278 gagtatgtaaatatagatgattgttgggcggag 310
>gb|DT632758.1|DT632758 EST1147689 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMFN44 3' end, mRNA sequence
Length = 758
Score = 42.1 bits (21), Expect = 0.058
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 98 gagtatgtcaacatagatgattgctgggcggag 130
|||||||| || ||||||||||| |||||||||
Sbjct: 286 gagtatgtaaatatagatgattgttgggcggag 318
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 137,654
Number of Sequences: 355925
Number of extensions: 137654
Number of successful extensions: 31878
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31868
Number of HSP's gapped (non-prelim): 10
length of query: 1341
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1322
effective length of database: 210,514,662
effective search space: 278300383164
effective search space used: 278300383164
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)