BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAJ4a11.xg.3.2
(2249 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BG673802.1|BG673802 NXPV_075_C07_F NXPV (Nsf Xylem Plani... 66 7e-009
gb|BI643905.1|BI643905 NXPV_126_H07_F NXPV (Nsf Xylem Plani... 66 7e-009
gb|BQ698665.1|BQ698665 NXPV_074_F11_F NXPV (Nsf Xylem Plani... 66 7e-009
gb|BQ703174.1|BQ703174 NXSI_137_E05_F NXSI (Nsf Xylem Side ... 44 0.025
>gb|BG673802.1|BG673802 NXPV_075_C07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_075_C07 5' similar to Arabidopsis
thaliana sequence At3g21160 putative alpha
1,2-mannosidase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 525
Score = 65.9 bits (33), Expect = 7e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 1254 gacaagatggatgaacttgcttgctttgctcctggtatgct 1294
|||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 118 gacaagatggatgagcttgcatgctttgctcctggtatgct 158
>gb|BI643905.1|BI643905 NXPV_126_H07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_126_H07 5' similar to Arabidopsis
thaliana sequence At3g21160 putative alpha
1,2-mannosidase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 216
Score = 65.9 bits (33), Expect = 7e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 1254 gacaagatggatgaacttgcttgctttgctcctggtatgct 1294
|||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 118 gacaagatggatgagcttgcatgctttgctcctggtatgct 158
>gb|BQ698665.1|BQ698665 NXPV_074_F11_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_074_F11 5' similar to Arabidopsis
thaliana sequence At3g21160 putative alpha
1,2-mannosidase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 470
Score = 65.9 bits (33), Expect = 7e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 1254 gacaagatggatgaacttgcttgctttgctcctggtatgct 1294
|||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 118 gacaagatggatgagcttgcatgctttgctcctggtatgct 158
>gb|BQ703174.1|BQ703174 NXSI_137_E05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_137_E05 5' similar to Arabidopsis thaliana
sequence At1g51590 mannosyl-oligosaccharide
1,2-alpha-mannosidase, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 253
Score = 44.1 bits (22), Expect = 0.025
Identities = 79/98 (80%)
Strand = Plus / Plus
Query: 1065 tttggtgctatgggagacagcttctacgaatatttgctcaaggtctggatccaggggaat 1124
|||||||||||||| |||||||| || || || || || ||||| |||||||| || ||
Sbjct: 66 tttggtgctatgggtgacagcttttatgagtacttactgaaggtatggatccaaggtaac 125
Query: 1125 aaaactgagcatgtaaaacactacagacaaatgtggga 1162
||||| || ||| || ||||||||| | ||||||||
Sbjct: 126 aaaacggatggtgtgaagcactacagagagatgtggga 163
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 276,071
Number of Sequences: 355925
Number of extensions: 276071
Number of successful extensions: 76988
Number of sequences better than 0.5: 4
Number of HSP's better than 0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76980
Number of HSP's gapped (non-prelim): 8
length of query: 2249
length of database: 217,277,237
effective HSP length: 20
effective length of query: 2229
effective length of database: 210,158,737
effective search space: 468443824773
effective search space used: 468443824773
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)