BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAF30a10.yg.2.1
         (1130 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|DR023122.1|DR023122  STRS1_55_D03.g1_A034 Shoot tip pitch...    46   0.003
gb|CF385072.1|CF385072  RTDR1_1_F10.g1_A015 Loblolly pine ro...    44   0.012

>gb|DR023122.1|DR023122 STRS1_55_D03.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
           cDNA clone STRS1_55_D03_A034 5', mRNA sequence
          Length = 777

 Score = 46.1 bits (23), Expect = 0.003
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 303 cttggtgaagggggatatggatcagtttataaggg 337
           ||||| |||||||||| |||||| |||||||||||
Sbjct: 135 cttggcgaagggggatttggatccgtttataaggg 169



>gb|CF385072.1|CF385072 RTDR1_1_F10.g1_A015 Loblolly pine roots recovering from drought DR1
           Pinus taeda cDNA clone RTDR1_1_F10_A015 5', mRNA
           sequence
          Length = 742

 Score = 44.1 bits (22), Expect = 0.012
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 961 tcgacattgcggatcccaagctcaca 986
           |||||||||||||||||||| |||||
Sbjct: 463 tcgacattgcggatcccaagttcaca 488



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 114,151
Number of Sequences: 355925
Number of extensions: 114151
Number of successful extensions: 27098
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27095
Number of HSP's gapped (non-prelim): 3
length of query: 1130
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1111
effective length of database: 210,514,662
effective search space: 233881789482
effective search space used: 233881789482
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)