BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= AB021175.2.1
(1225 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX249989.1|BX249989 BX249989 Pinus pinaster differenciat... 54 1e-005
gb|BE496611.1|BE496611 NXCI_021_G04_F NXCI (Nsf Xylem Compr... 54 1e-005
gb|BQ654468.1|BQ654468 NXRV080_F11_F NXRV (Nsf Xylem Root w... 54 1e-005
gb|CF664403.1|CF664403 RTCNT1_9_C04.g1_A029 Root control Pi... 54 1e-005
gb|CF667780.1|CF667780 RTCNT1_32_B01.g1_A029 Root control P... 54 1e-005
gb|CF671866.1|CF671866 RTCNT1_59_F11.g1_A029 Root control P... 54 1e-005
gb|CN783735.1|CN783735 EST782426 Sequencing ESTs from loblo... 54 1e-005
gb|CN783967.1|CN783967 EST782658 Sequencing ESTs from loblo... 54 1e-005
gb|CN785116.1|CN785116 EST783807 Sequencing ESTs from loblo... 54 1e-005
gb|CN785360.1|CN785360 EST784051 Sequencing ESTs from loblo... 54 1e-005
gb|CN785698.1|CN785698 EST784389 Sequencing ESTs from loblo... 54 1e-005
gb|CN785730.1|CN785730 EST784421 Sequencing ESTs from loblo... 54 1e-005
gb|CO175055.1|CO175055 NDL1_48_C05.b1_A029 Needles control ... 54 1e-005
gb|CO198161.1|CO198161 GEO1_11_E04.g1_A029 Root gravitropis... 54 1e-005
gb|CO409001.1|CO409001 EST839386 Sequencing ESTs from loblo... 54 1e-005
gb|CO409023.1|CO409023 EST839408 Sequencing ESTs from loblo... 54 1e-005
gb|CO409040.1|CO409040 EST839425 Sequencing ESTs from loblo... 54 1e-005
gb|CO410358.1|CO410358 EST840743 Sequencing ESTs from loblo... 54 1e-005
gb|CO411477.1|CO411477 EST841862 Sequencing ESTs from loblo... 54 1e-005
gb|CO411961.1|CO411961 EST842346 Sequencing ESTs from loblo... 54 1e-005
gb|CO412371.1|CO412371 EST842756 Sequencing ESTs from loblo... 54 1e-005
gb|CO412580.1|CO412580 EST842965 Sequencing ESTs from loblo... 54 1e-005
gb|CO413394.1|CO413394 EST843779 Sequencing ESTs from loblo... 54 1e-005
gb|CO413834.1|CO413834 EST844219 Sequencing ESTs from loblo... 54 1e-005
gb|CO413853.1|CO413853 EST844238 Sequencing ESTs from loblo... 54 1e-005
gb|CO414360.1|CO414360 EST844745 Sequencing ESTs from loblo... 54 1e-005
gb|CO414557.1|CO414557 EST844942 Sequencing ESTs from loblo... 54 1e-005
gb|CO370464.1|CO370464 RTK1_68_C04.b1_A029 Roots minus pota... 54 1e-005
gb|CV133871.1|CV133871 EST845080 Sequencing ESTs from loblo... 54 1e-005
gb|CV136995.1|CV136995 EST848204 Sequencing ESTs from loblo... 54 1e-005
gb|CV137214.1|CV137214 EST848423 Sequencing ESTs from loblo... 54 1e-005
gb|CV137257.1|CV137257 EST848466 Sequencing ESTs from loblo... 54 1e-005
gb|CV137335.1|CV137335 EST848544 Sequencing ESTs from loblo... 54 1e-005
gb|CV137390.1|CV137390 EST848599 Sequencing ESTs from loblo... 54 1e-005
gb|CV137436.1|CV137436 EST848645 Sequencing ESTs from loblo... 54 1e-005
gb|CV137618.1|CV137618 EST848827 Sequencing ESTs from loblo... 54 1e-005
gb|CV137627.1|CV137627 EST848836 Sequencing ESTs from loblo... 54 1e-005
gb|CV137635.1|CV137635 EST848844 Sequencing ESTs from loblo... 54 1e-005
gb|CV137863.1|CV137863 EST849072 Sequencing ESTs from loblo... 54 1e-005
gb|CV137955.1|CV137955 EST849164 Sequencing ESTs from loblo... 54 1e-005
gb|CV137988.1|CV137988 EST849197 Sequencing ESTs from loblo... 54 1e-005
gb|CV138046.1|CV138046 EST849255 Sequencing ESTs from loblo... 54 1e-005
gb|CV138084.1|CV138084 EST849293 Sequencing ESTs from loblo... 54 1e-005
gb|CV138450.1|CV138450 EST849659 Sequencing ESTs from loblo... 54 1e-005
gb|CV139040.1|CV139040 EST850249 Sequencing ESTs from loblo... 54 1e-005
gb|CV139228.1|CV139228 EST850437 Sequencing ESTs from loblo... 54 1e-005
gb|CV143592.1|CV143592 EST854801 Sequencing ESTs from loblo... 54 1e-005
gb|CV143743.1|CV143743 EST854952 Sequencing ESTs from loblo... 54 1e-005
gb|CV143752.1|CV143752 EST854961 Sequencing ESTs from loblo... 54 1e-005
gb|CV143830.1|CV143830 EST855039 Sequencing ESTs from loblo... 54 1e-005
gb|CV144318.1|CV144318 EST855527 Sequencing ESTs from loblo... 54 1e-005
gb|CV144536.1|CV144536 EST855745 Sequencing ESTs from loblo... 54 1e-005
gb|CV144580.1|CV144580 EST855789 Sequencing ESTs from loblo... 54 1e-005
gb|CV145493.1|CV145493 EST856702 Sequencing ESTs from loblo... 54 1e-005
gb|CV145784.1|CV145784 EST856993 Sequencing ESTs from loblo... 54 1e-005
gb|CV145926.1|CV145926 EST857135 Sequencing ESTs from loblo... 54 1e-005
gb|CV145944.1|CV145944 EST857153 Sequencing ESTs from loblo... 54 1e-005
gb|CV146269.1|CV146269 EST857478 Sequencing ESTs from loblo... 54 1e-005
gb|CV146674.1|CV146674 EST857883 Sequencing ESTs from loblo... 54 1e-005
gb|CV146965.1|CV146965 EST858174 Sequencing ESTs from loblo... 54 1e-005
gb|CV147072.1|CV147072 EST858281 Sequencing ESTs from loblo... 54 1e-005
gb|CV147131.1|CV147131 EST858340 Sequencing ESTs from loblo... 54 1e-005
gb|CV147195.1|CV147195 EST858404 Sequencing ESTs from loblo... 54 1e-005
gb|CV147253.1|CV147253 EST858462 Sequencing ESTs from loblo... 54 1e-005
gb|CV147355.1|CV147355 EST858564 Sequencing ESTs from loblo... 54 1e-005
gb|CV147433.1|CV147433 EST858642 Sequencing ESTs from loblo... 54 1e-005
gb|CV147674.1|CV147674 EST858883 Sequencing ESTs from loblo... 54 1e-005
gb|CV148037.1|CV148037 EST859246 Sequencing ESTs from loblo... 54 1e-005
gb|CV148608.1|CV148608 EST859817 Sequencing ESTs from loblo... 54 1e-005
gb|DN445572.1|DN445572 EST941371 Sequencing ESTs from loblo... 54 1e-005
gb|DN445721.1|DN445721 EST941520 Sequencing ESTs from loblo... 54 1e-005
gb|DN445740.1|DN445740 EST941539 Sequencing ESTs from loblo... 54 1e-005
gb|DN446152.1|DN446152 EST941951 Sequencing ESTs from loblo... 54 1e-005
gb|DN446216.1|DN446216 EST942015 Sequencing ESTs from loblo... 54 1e-005
gb|DN446331.1|DN446331 EST942130 Sequencing ESTs from loblo... 54 1e-005
gb|DN446640.1|DN446640 EST942439 Sequencing ESTs from loblo... 54 1e-005
gb|DN446849.1|DN446849 EST942648 Sequencing ESTs from loblo... 54 1e-005
gb|DN447555.1|DN447555 EST943354 Sequencing ESTs from loblo... 54 1e-005
gb|DN448307.1|DN448307 EST944106 Sequencing ESTs from loblo... 54 1e-005
gb|DN448473.1|DN448473 EST944272 Sequencing ESTs from loblo... 54 1e-005
gb|DN450210.1|DN450210 EST946009 Sequencing ESTs from loblo... 54 1e-005
gb|DN450274.1|DN450274 EST946073 Sequencing ESTs from loblo... 54 1e-005
gb|DN450290.1|DN450290 EST946089 Sequencing ESTs from loblo... 54 1e-005
gb|DN450399.1|DN450399 EST946198 Sequencing ESTs from loblo... 54 1e-005
gb|DN450544.1|DN450544 EST946343 Sequencing ESTs from loblo... 54 1e-005
gb|DN450671.1|DN450671 EST946470 Sequencing ESTs from loblo... 54 1e-005
gb|DN450866.1|DN450866 EST946665 Sequencing ESTs from loblo... 54 1e-005
gb|DN451258.1|DN451258 EST947057 Sequencing ESTs from loblo... 54 1e-005
gb|DN451807.1|DN451807 EST947606 Sequencing ESTs from loblo... 54 1e-005
gb|DN451854.1|DN451854 EST947653 Sequencing ESTs from loblo... 54 1e-005
gb|DN451878.1|DN451878 EST947677 Sequencing ESTs from loblo... 54 1e-005
gb|DN452012.1|DN452012 EST947811 Sequencing ESTs from loblo... 54 1e-005
gb|DN452938.1|DN452938 EST948737 Sequencing ESTs from loblo... 54 1e-005
gb|DN452972.1|DN452972 EST948771 Sequencing ESTs from loblo... 54 1e-005
gb|DN454494.1|DN454494 EST950293 Sequencing ESTs from loblo... 54 1e-005
gb|DN454936.1|DN454936 EST950735 Sequencing ESTs from loblo... 54 1e-005
gb|DN454964.1|DN454964 EST950763 Sequencing ESTs from loblo... 54 1e-005
gb|DN455026.1|DN455026 EST950825 Sequencing ESTs from loblo... 54 1e-005
gb|DN455636.1|DN455636 EST951435 Sequencing ESTs from loblo... 54 1e-005
gb|DN455673.1|DN455673 EST951472 Sequencing ESTs from loblo... 54 1e-005
gb|DN455918.1|DN455918 EST951717 Sequencing ESTs from loblo... 54 1e-005
gb|DN455970.1|DN455970 EST951769 Sequencing ESTs from loblo... 54 1e-005
gb|DN456000.1|DN456000 EST951799 Sequencing ESTs from loblo... 54 1e-005
gb|DN456044.1|DN456044 EST951843 Sequencing ESTs from loblo... 54 1e-005
gb|DN456262.1|DN456262 EST952061 Sequencing ESTs from loblo... 54 1e-005
gb|DN457106.1|DN457106 EST952905 Sequencing ESTs from loblo... 54 1e-005
gb|DN457404.1|DN457404 EST953203 Sequencing ESTs from loblo... 54 1e-005
gb|DN457959.1|DN457959 EST953758 Sequencing ESTs from loblo... 54 1e-005
gb|DN458084.1|DN458084 EST953883 Sequencing ESTs from loblo... 54 1e-005
gb|DN458194.1|DN458194 EST953993 Sequencing ESTs from loblo... 54 1e-005
gb|DN458303.1|DN458303 EST954102 Sequencing ESTs from loblo... 54 1e-005
gb|DN458626.1|DN458626 EST954425 Sequencing ESTs from loblo... 54 1e-005
gb|DN459154.1|DN459154 EST954953 Sequencing ESTs from loblo... 54 1e-005
gb|DN459884.1|DN459884 EST955683 Sequencing ESTs from loblo... 54 1e-005
gb|DN459915.1|DN459915 EST955714 Sequencing ESTs from loblo... 54 1e-005
gb|DN460359.1|DN460359 EST956158 Sequencing ESTs from loblo... 54 1e-005
gb|DN460848.1|DN460848 EST956647 Sequencing ESTs from loblo... 54 1e-005
gb|DN461104.1|DN461104 EST956903 Sequencing ESTs from loblo... 54 1e-005
gb|DN461471.1|DN461471 EST957270 Sequencing ESTs from loblo... 54 1e-005
gb|DN461843.1|DN461843 EST957642 Sequencing ESTs from loblo... 54 1e-005
gb|DN461987.1|DN461987 EST957786 Sequencing ESTs from loblo... 54 1e-005
gb|DN462607.1|DN462607 EST958406 Sequencing ESTs from loblo... 54 1e-005
gb|DN463318.1|DN463318 EST959117 Sequencing ESTs from loblo... 54 1e-005
gb|DN463373.1|DN463373 EST959172 Sequencing ESTs from loblo... 54 1e-005
gb|DN463731.1|DN463731 EST959530 Sequencing ESTs from loblo... 54 1e-005
gb|DN463889.1|DN463889 EST959688 Sequencing ESTs from loblo... 54 1e-005
gb|DN464335.1|DN464335 EST960134 Sequencing ESTs from loblo... 54 1e-005
gb|DN464440.1|DN464440 EST960239 Sequencing ESTs from loblo... 54 1e-005
gb|DN465514.1|DN465514 EST961313 Sequencing ESTs from loblo... 54 1e-005
gb|DN465515.1|DN465515 EST961314 Sequencing ESTs from loblo... 54 1e-005
gb|DR048121.1|DR048121 RTBOR1_6_E12.g2_A029 Roots plus adde... 54 1e-005
gb|DR054005.1|DR054005 RTCA1_14_D11.g1_A029 Roots minus cal... 54 1e-005
gb|DR056470.1|DR056470 RTCA1_30_B05.g1_A029 Roots minus cal... 54 1e-005
gb|DR060275.1|DR060275 RTNIT1_26_G08.g1_A029 Roots minus ni... 54 1e-005
gb|DR093681.1|DR093681 STRR1_9_F05.g1_A033 Stem Response Re... 54 1e-005
gb|DR112908.1|DR112908 RTS1_31_B11.g1_A029 Roots minus sulf... 54 1e-005
gb|DT627090.1|DT627090 EST1160166 Sequencing ESTs from lobl... 54 1e-005
gb|CV146862.1|CV146862 EST858071 Sequencing ESTs from loblo... 48 9e-004
gb|AA230194.1|AA230194 ESTH12 Pinus radiata male cone libra... 46 0.003
gb|CV031577.1|CV031577 RTNACL1_2_A03.g1_A029 Roots plus add... 44 0.013
gb|CV135328.1|CV135328 EST846537 Sequencing ESTs from loblo... 42 0.053
gb|DN457423.1|DN457423 EST953222 Sequencing ESTs from loblo... 42 0.053
gb|DN610128.1|DN610128 EST963178 Subtracted pine embryo lib... 42 0.053
gb|DN613998.1|DN613998 EST967048 Subtracted pine embryo lib... 42 0.053
gb|DR161311.1|DR161311 RTFE1_11_C05.b1_A029 Roots minus iro... 42 0.053
gb|DR689848.1|DR689848 EST1079934 Normalized pine embryo li... 42 0.053
gb|DT626057.1|DT626057 EST1157981 Sequencing ESTs from lobl... 42 0.053
gb|DT626824.1|DT626824 EST1159900 Sequencing ESTs from lobl... 42 0.053
gb|CF666959.1|CF666959 RTCNT1_27_G02.b1_A029 Root control P... 40 0.21
gb|CF667036.1|CF667036 RTCNT1_27_G02.g1_A029 Root control P... 40 0.21
>gb|BX249989.1|BX249989 BX249989 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP031B01, mRNA sequence
Length = 630
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 163 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 209
>gb|BE496611.1|BE496611 NXCI_021_G04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_021_G04 5' similar to Arabidopsis
thaliana sequence At3g19430 putative late embryogenesis
abundant protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 591
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 225 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 271
>gb|BQ654468.1|BQ654468 NXRV080_F11_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV080_F11 5' similar to Arabidopsis thaliana
sequence At3g19430 putative late embryogenesis abundant
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 541
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 244 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 290
>gb|CF664403.1|CF664403 RTCNT1_9_C04.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_9_C04_A029 5', mRNA sequence
Length = 603
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 238 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 284
>gb|CF667780.1|CF667780 RTCNT1_32_B01.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_32_B01_A029 5', mRNA sequence
Length = 663
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 104 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 150
>gb|CF671866.1|CF671866 RTCNT1_59_F11.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_59_F11_A029 5', mRNA sequence
Length = 714
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 11 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 57
>gb|CN783735.1|CN783735 EST782426 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAAC42 5' end, mRNA sequence
Length = 937
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 249 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 295
>gb|CN783967.1|CN783967 EST782658 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAAF56 5' end, mRNA sequence
Length = 667
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 130 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 176
>gb|CN785116.1|CN785116 EST783807 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAAU81 5' end, mRNA sequence
Length = 938
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 107 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 153
>gb|CN785360.1|CN785360 EST784051 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAAX92 5' end, mRNA sequence
Length = 928
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 253 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 299
>gb|CN785698.1|CN785698 EST784389 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAB238 5' end, mRNA sequence
Length = 999
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 217 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 263
>gb|CN785730.1|CN785730 EST784421 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAB277 5' end, mRNA sequence
Length = 968
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 265 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 311
>gb|CO175055.1|CO175055 NDL1_48_C05.b1_A029 Needles control Pinus taeda cDNA clone
NDL1_48_C05_A029 3', mRNA sequence
Length = 716
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 463 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 417
>gb|CO198161.1|CO198161 GEO1_11_E04.g1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_11_E04_A029 5', mRNA sequence
Length = 692
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 214 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 260
>gb|CO409001.1|CO409001 EST839386 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAKK09 5' end, mRNA sequence
Length = 980
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 253 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 299
>gb|CO409023.1|CO409023 EST839408 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAKK39 5' end, mRNA sequence
Length = 825
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 268 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 314
>gb|CO409040.1|CO409040 EST839425 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAKK59 5' end, mRNA sequence
Length = 929
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 430 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 476
>gb|CO410358.1|CO410358 EST840743 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAL211 5' end, mRNA sequence
Length = 806
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 230 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 276
>gb|CO411477.1|CO411477 EST841862 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIALK76 5' end, mRNA sequence
Length = 872
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 266 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 312
>gb|CO411961.1|CO411961 EST842346 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIALR12 5' end, mRNA sequence
Length = 798
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 250 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 296
>gb|CO412371.1|CO412371 EST842756 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIALW41 5' end, mRNA sequence
Length = 855
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 257 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 303
>gb|CO412580.1|CO412580 EST842965 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIALZ16 5' end, mRNA sequence
Length = 961
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 258 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 304
>gb|CO413394.1|CO413394 EST843779 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAMA25 5' end, mRNA sequence
Length = 872
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 265 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 311
>gb|CO413834.1|CO413834 EST844219 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAMG12 5' end, mRNA sequence
Length = 851
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 253 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 299
>gb|CO413853.1|CO413853 EST844238 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAMG43 5' end, mRNA sequence
Length = 816
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 230 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 276
>gb|CO414360.1|CO414360 EST844745 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAMN31 5' end, mRNA sequence
Length = 841
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 265 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 311
>gb|CO414557.1|CO414557 EST844942 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAMP96 5' end, mRNA sequence
Length = 911
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 266 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 312
>gb|CO370464.1|CO370464 RTK1_68_C04.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_68_C04_A029 3', mRNA sequence
Length = 809
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 557 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 511
>gb|CV133871.1|CV133871 EST845080 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIAGB89 5' end, mRNA sequence
Length = 842
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 248 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 294
>gb|CV136995.1|CV136995 EST848204 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAI82 5' end, mRNA sequence
Length = 930
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 60 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 106
>gb|CV137214.1|CV137214 EST848423 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAL58 5' end, mRNA sequence
Length = 888
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 308 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 354
>gb|CV137257.1|CV137257 EST848466 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAM19 5' end, mRNA sequence
Length = 786
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 253 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 299
>gb|CV137335.1|CV137335 EST848544 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAN15 5' end, mRNA sequence
Length = 958
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 253 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 299
>gb|CV137390.1|CV137390 EST848599 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAN80 5' end, mRNA sequence
Length = 817
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 109 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 155
>gb|CV137436.1|CV137436 EST848645 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAO48 5' end, mRNA sequence
Length = 779
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 248 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 294
>gb|CV137618.1|CV137618 EST848827 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAR40 5' end, mRNA sequence
Length = 863
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 265 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 311
>gb|CV137627.1|CV137627 EST848836 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAR61 5' end, mRNA sequence
Length = 845
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 250 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 296
>gb|CV137635.1|CV137635 EST848844 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAR82 5' end, mRNA sequence
Length = 873
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 258 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 304
>gb|CV137863.1|CV137863 EST849072 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAV57 5' end, mRNA sequence
Length = 738
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 265 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 311
>gb|CV137955.1|CV137955 EST849164 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAW79 5' end, mRNA sequence
Length = 896
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 84 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 130
>gb|CV137988.1|CV137988 EST849197 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAX25 5' end, mRNA sequence
Length = 964
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 248 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 294
>gb|CV138046.1|CV138046 EST849255 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAY05 5' end, mRNA sequence
Length = 865
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 266 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 312
>gb|CV138084.1|CV138084 EST849293 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIAY63 5' end, mRNA sequence
Length = 859
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 253 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 299
>gb|CV138450.1|CV138450 EST849659 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIB330 5' end, mRNA sequence
Length = 766
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 239 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 285
>gb|CV139040.1|CV139040 EST850249 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIBA40 5' end, mRNA sequence
Length = 785
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 265 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 311
>gb|CV139228.1|CV139228 EST850437 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIBD75 5' end, mRNA sequence
Length = 880
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 265 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 311
>gb|CV143592.1|CV143592 EST854801 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPICV02 5' end, mRNA sequence
Length = 543
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 248 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 294
>gb|CV143743.1|CV143743 EST854952 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPICW86 5' end, mRNA sequence
Length = 859
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 253 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 299
>gb|CV143752.1|CV143752 EST854961 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPICX01 5' end, mRNA sequence
Length = 750
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 253 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 299
>gb|CV143830.1|CV143830 EST855039 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPICX92 5' end, mRNA sequence
Length = 820
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 367 ttctacttccacggcaagaaggaccgggacttctgcatcgtctccga 413
|||||||| || ||||||||||||||||| |||||| | ||||||||
Sbjct: 256 ttctactttcatggcaagaaggaccgggatttctgccttgtctccga 302
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 135,665
Number of Sequences: 355925
Number of extensions: 135665
Number of successful extensions: 39767
Number of sequences better than 0.5: 150
Number of HSP's better than 0.5 without gapping: 150
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39340
Number of HSP's gapped (non-prelim): 427
length of query: 1225
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1206
effective length of database: 210,514,662
effective search space: 253880682372
effective search space used: 253880682372
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)