BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8636641.2.1
(1326 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX679939.1|BX679939 BX679939 RS Pinus pinaster cDNA clon... 56 4e-006
gb|DR164099.1|DR164099 RTFE1_46_G03.g1_A029 Roots minus iro... 56 4e-006
gb|CF666432.1|CF666432 RTCNT1_23_F04.b1_A029 Root control P... 54 2e-005
gb|DR058028.1|DR058028 RTNIT1_9_F04.b1_A029 Roots minus nit... 54 2e-005
gb|AL750501.1|AL750501 AL750501 RN Pinus pinaster cDNA clon... 44 0.015
gb|CF389670.1|CF389670 RTDR2_8_D11.g1_A021 Loblolly pine ro... 44 0.015
gb|CF476619.1|CF476619 RTWW3_2_E11.g1_A022 Well-watered lob... 44 0.015
gb|CF663228.1|CF663228 RTCNT1_1_C11.g1_A029 Root control Pi... 44 0.015
gb|CF663893.1|CF663893 RTCNT1_5_G12.g1_A029 Root control Pi... 44 0.015
gb|CF664709.1|CF664709 RTCNT1_11_B04.g1_A029 Root control P... 44 0.015
gb|CF665191.1|CF665191 RTCNT1_14_A12.g1_A029 Root control P... 44 0.015
gb|CF666458.1|CF666458 RTCNT1_23_A08.g1_A029 Root control P... 44 0.015
gb|CF671964.1|CF671964 RTCNT1_60_A05.g1_A029 Root control P... 44 0.015
gb|BX676813.1|BX676813 BX676813 RN Pinus pinaster cDNA clon... 44 0.015
gb|BX678020.1|BX678020 BX678020 RN Pinus pinaster cDNA clon... 44 0.015
gb|BX678133.1|BX678133 BX678133 RN Pinus pinaster cDNA clon... 44 0.015
gb|CR392234.1|CR392234 CR392234 RN Pinus pinaster cDNA clon... 44 0.015
gb|CR393261.1|CR393261 CR393261 RN Pinus pinaster cDNA clon... 44 0.015
gb|CR393478.1|CR393478 CR393478 RN Pinus pinaster cDNA clon... 44 0.015
gb|CR394388.1|CR394388 CR394388 RN Pinus pinaster cDNA clon... 44 0.015
gb|CO159824.1|CO159824 FLD1_16_E07.b1_A029 Root flooded Pin... 44 0.015
gb|CO161849.1|CO161849 FLD1_31_C06.g1_A029 Root flooded Pin... 44 0.015
gb|CO167718.1|CO167718 FLD1_70_E12.g1_A029 Root flooded Pin... 44 0.015
gb|CO201890.1|CO201890 RTCNT2_8_F12.g1_A029 Root control 2 ... 44 0.015
gb|DR016861.1|DR016861 STRS1_12_D06.g1_A034 Shoot tip pitch... 44 0.015
gb|DR019654.1|DR019654 STRS1_31_B07.g1_A034 Shoot tip pitch... 44 0.015
gb|DR021011.1|DR021011 STRS1_40_F08.g1_A034 Shoot tip pitch... 44 0.015
gb|DR050769.1|DR050769 RTBOR1_25_C07.g1_A029 Roots plus add... 44 0.015
gb|DR078213.1|DR078213 RTFEPL1_2_D10.g1_A029 Roots plus add... 44 0.015
gb|DR079785.1|DR079785 RTFEPL1_17_D11.g1_A029 Roots plus ad... 44 0.015
gb|DR090425.1|DR090425 RTAL1_15_A06.b1_A029 Roots plus adde... 44 0.015
gb|DR092479.1|DR092479 STRR1_1_D06.g1_A033 Stem Response Re... 44 0.015
gb|DR095060.1|DR095060 STRR1_18_C01.g1_A033 Stem Response R... 44 0.015
gb|DR098171.1|DR098171 STRR1_39_C08.g1_A033 Stem Response R... 44 0.015
gb|DR099813.1|DR099813 STRR1_58_F12.g1_A033 Stem Response R... 44 0.015
gb|DR102098.1|DR102098 STRR1_78_A01.g1_A033 Stem Response R... 44 0.015
gb|DR162792.1|DR162792 RTFE1_20_C02.g1_A029 Roots minus iro... 44 0.015
gb|DR166815.1|DR166815 RTPHOS1_14_E01.g1_A029 Roots minus p... 44 0.015
gb|DR388727.1|DR388727 RTHG1_30_D05.b1_A029 Roots plus adde... 44 0.015
gb|DR683429.1|DR683429 EST1073505 Normalized pine embryo li... 44 0.015
gb|DR688117.1|DR688117 EST1078201 Normalized pine embryo li... 44 0.015
gb|DR744454.1|DR744454 RTCU1_22_C07.g1_A029 Roots plus adde... 44 0.015
gb|DT631437.1|DT631437 EST1146368 Normalized pine embryo li... 44 0.015
gb|DT634565.1|DT634565 EST1149496 Normalized pine embryo li... 44 0.015
dbj|BD224564.1| Materials and methods for the modification ... 44 0.015
gb|AL751213.1|AL751213 AL751213 RS Pinus pinaster cDNA clon... 42 0.057
gb|AL751293.1|AL751293 AL751293 RS Pinus pinaster cDNA clon... 42 0.057
gb|CF474883.1|CF474883 RTWW2_8_F04.g1_A021 Well-watered lob... 42 0.057
gb|CO159581.1|CO159581 FLD1_14_B02.g1_A029 Root flooded Pin... 42 0.057
gb|CO167878.1|CO167878 FLD1_71_G07.g1_A029 Root flooded Pin... 42 0.057
gb|CO199407.1|CO199407 GEO2_1_A09.b1_A032 Root gravitropism... 42 0.057
gb|CX652846.1|CX652846 COLD1_61_G11.g1_A029 Root cold Pinus... 42 0.057
gb|CF666632.1|CF666632 RTCNT1_24_G05.g1_A029 Root control P... 40 0.23
gb|DR097614.1|DR097614 STRR1_35_H07.g4_A033 Stem Response R... 40 0.23
gb|DR100118.1|DR100118 STRR1_61_G12.g1_A033 Stem Response R... 40 0.23
gb|DR177119.1|DR177119 RTMNUT1_3_F08.b1_A029 Roots minus mi... 40 0.23
>gb|BX679939.1|BX679939 BX679939 RS Pinus pinaster cDNA clone RS36F06, mRNA sequence
Length = 518
Score = 56.0 bits (28), Expect = 4e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatggctcggt 225
|||||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 180 atgcactttcacgactgctttgtaaggggctgcgatggatcggt 223
>gb|DR164099.1|DR164099 RTFE1_46_G03.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_46_G03_A029 5', mRNA sequence
Length = 860
Score = 56.0 bits (28), Expect = 4e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatggctcggt 225
|||||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 175 atgcactttcacgactgctttgtaaggggctgcgatggatcggt 218
>gb|CF666432.1|CF666432 RTCNT1_23_F04.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_23_F04_A029 3', mRNA sequence
Length = 693
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatggctcggtgct 228
||||| || ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 518 atgcattttcatgattgctttgtcaggggttgcgatggatcggtgct 472
>gb|DR058028.1|DR058028 RTNIT1_9_F04.b1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_9_F04_A029 3', mRNA sequence
Length = 380
Score = 54.0 bits (27), Expect = 2e-005
Identities = 42/47 (89%)
Strand = Plus / Minus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatggctcggtgct 228
||||| || ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 181 atgcattttcatgattgctttgtcaggggttgcgatggatcggtgct 135
>gb|AL750501.1|AL750501 AL750501 RN Pinus pinaster cDNA clone RN03C02 similar to
PEROXIDASE, mRNA sequence
Length = 475
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 277 cacttccacgactgctttgtccagggatgcgatggttcggtg 318
>gb|CF389670.1|CF389670 RTDR2_8_D11.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_8_D11_A021 5', mRNA
sequence
Length = 768
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 5 atgcacttccatgattgtttcgtcaggggatgcgatgg 42
>gb|CF476619.1|CF476619 RTWW3_2_E11.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_2_E11_A022 5', mRNA sequence
Length = 555
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 224 atgcacttccatgattgtttcgtcaggggatgcgatgg 261
>gb|CF663228.1|CF663228 RTCNT1_1_C11.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_1_C11_A029 5', mRNA sequence
Length = 824
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 191 catgactgctttgtcaggggctgcgatggctcggtgct 228
||||||||||||||||| || |||||||| || |||||
Sbjct: 219 catgactgctttgtcagaggttgcgatggatctgtgct 256
>gb|CF663893.1|CF663893 RTCNT1_5_G12.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_5_G12_A029 5', mRNA sequence
Length = 577
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
||||| |||||||| || ||||||||||| ||||||||
Sbjct: 216 atgcatttccatgattgttttgtcaggggatgcgatgg 253
>gb|CF664709.1|CF664709 RTCNT1_11_B04.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_11_B04_A029 5', mRNA sequence
Length = 666
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 75 atgcacttccatgattgtttcgtcaggggatgcgatgg 112
>gb|CF665191.1|CF665191 RTCNT1_14_A12.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_14_A12_A029 5', mRNA sequence
Length = 678
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 258 cacttccacgactgctttgtccagggatgcgatgggtcggtg 299
>gb|CF666458.1|CF666458 RTCNT1_23_A08.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_23_A08_A029 5', mRNA sequence
Length = 644
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 179 cgcatgcacttccatgactgctttgtcaggggctgcga 216
|||||||| || |||||||| ||||| |||||||||||
Sbjct: 80 cgcatgcattttcatgactgttttgtaaggggctgcga 117
>gb|CF671964.1|CF671964 RTCNT1_60_A05.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_60_A05_A029 5', mRNA sequence
Length = 756
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 248 atgcacttccatgattgtttcgtcaggggatgcgatgg 285
>gb|BX676813.1|BX676813 BX676813 RN Pinus pinaster cDNA clone RN11G03, mRNA sequence
Length = 500
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 232 atgcacttccatgattgtttcgtcaggggatgcgatgg 269
>gb|BX678020.1|BX678020 BX678020 RN Pinus pinaster cDNA clone RN55C03, mRNA sequence
Length = 519
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
||||| |||||||| || ||||||||||| ||||||||
Sbjct: 19 atgcatttccatgattgttttgtcaggggatgcgatgg 56
>gb|BX678133.1|BX678133 BX678133 RN Pinus pinaster cDNA clone RN56F10, mRNA sequence
Length = 90
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
||||| |||||||| || ||||||||||| ||||||||
Sbjct: 29 atgcatttccatgattgttttgtcaggggatgcgatgg 66
>gb|CR392234.1|CR392234 CR392234 RN Pinus pinaster cDNA clone RN28F04, mRNA sequence
Length = 499
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 231 atgcacttccatgattgtttcgtcaggggatgcgatgg 268
>gb|CR393261.1|CR393261 CR393261 RN Pinus pinaster cDNA clone RN54F02, mRNA sequence
Length = 482
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 264 cacttccacgactgctttgtccagggatgcgatggttcggtg 305
>gb|CR393478.1|CR393478 CR393478 RN Pinus pinaster cDNA clone RN60F07, mRNA sequence
Length = 325
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 257 atgcacttccatgattgtttcgtcaggggatgcgatgg 294
>gb|CR394388.1|CR394388 CR394388 RN Pinus pinaster cDNA clone RN78E10, mRNA sequence
Length = 491
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
||||| |||||||| || ||||||||||| ||||||||
Sbjct: 19 atgcatttccatgattgttttgtcaggggatgcgatgg 56
>gb|CO159824.1|CO159824 FLD1_16_E07.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_16_E07_A029 3', mRNA sequence
Length = 636
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Minus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 375 cacttccacgactgctttgtccagggatgcgatggttcggtg 334
>gb|CO161849.1|CO161849 FLD1_31_C06.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_31_C06_A029 5', mRNA sequence
Length = 888
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 119 atgcacttccatgattgtttcgtcaggggatgcgatgg 156
>gb|CO167718.1|CO167718 FLD1_70_E12.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_70_E12_A029 5', mRNA sequence
Length = 716
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 255 atgcacttccatgattgtttcgtcaggggatgcgatgg 292
>gb|CO201890.1|CO201890 RTCNT2_8_F12.g1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_8_F12_A029 5', mRNA sequence
Length = 766
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 234 atgcacttccatgattgtttcgtcaggggatgcgatgg 271
>gb|DR016861.1|DR016861 STRS1_12_D06.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_12_D06_A034 5', mRNA sequence
Length = 895
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 261 cacttccacgactgctttgtccagggatgcgatgggtcggtg 302
>gb|DR019654.1|DR019654 STRS1_31_B07.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_31_B07_A034 5', mRNA sequence
Length = 727
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 164 cacttccacgactgctttgtccagggatgcgatgggtcggtg 205
>gb|DR021011.1|DR021011 STRS1_40_F08.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_40_F08_A034 5', mRNA sequence
Length = 629
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 20 cacttccacgactgctttgtccagggatgcgatggttcggtg 61
>gb|DR050769.1|DR050769 RTBOR1_25_C07.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_25_C07_A029 5', mRNA sequence
Length = 836
Score = 44.1 bits (22), Expect = 0.015
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatggctcggtgctgat 231
||||| |||||||| || || |||||||| ||||||||||| || |||||
Sbjct: 263 atgcatttccatgattgtttcgtcaggggatgcgatggctctgttctgat 312
>gb|DR078213.1|DR078213 RTFEPL1_2_D10.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_2_D10_A029 5', mRNA sequence
Length = 751
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 248 atgcacttccatgattgtttcgtcaggggatgcgatgg 285
>gb|DR079785.1|DR079785 RTFEPL1_17_D11.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_17_D11_A029 5', mRNA sequence
Length = 783
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 130 atgcacttccatgattgtttcgtcaggggatgcgatgg 167
>gb|DR090425.1|DR090425 RTAL1_15_A06.b1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_15_A06_A029 3', mRNA sequence
Length = 766
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 514 atgcacttccatgattgtttcgtcaggggatgcgatgg 477
>gb|DR092479.1|DR092479 STRR1_1_D06.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_1_D06_A033 5', mRNA sequence
Length = 893
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 270 cacttccacgactgctttgtccagggatgcgatgggtcggtg 311
>gb|DR095060.1|DR095060 STRR1_18_C01.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_18_C01_A033 5', mRNA sequence
Length = 876
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 25 cacttccacgactgctttgtccagggatgcgatgggtcggtg 66
>gb|DR098171.1|DR098171 STRR1_39_C08.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_39_C08_A033 5', mRNA sequence
Length = 724
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 250 cacttccacgactgctttgtccagggatgcgatgggtcggtg 291
>gb|DR099813.1|DR099813 STRR1_58_F12.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_58_F12_A033 5', mRNA sequence
Length = 609
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 18 cacttccacgactgctttgtccagggatgcgatgggtcggtg 59
>gb|DR102098.1|DR102098 STRR1_78_A01.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_78_A01_A033 5', mRNA sequence
Length = 491
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 57 cacttccacgactgctttgtccagggatgcgatggttcggtg 98
>gb|DR162792.1|DR162792 RTFE1_20_C02.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_20_C02_A029 5', mRNA sequence
Length = 518
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
||||| |||||||| || ||||||||||| ||||||||
Sbjct: 202 atgcatttccatgattgttttgtcaggggatgcgatgg 239
>gb|DR166815.1|DR166815 RTPHOS1_14_E01.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_14_E01_A029 5', mRNA sequence
Length = 824
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 234 cacttccacgactgctttgtccagggatgcgatgggtcggtg 275
>gb|DR388727.1|DR388727 RTHG1_30_D05.b1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_30_D05_A029 3', mRNA sequence
Length = 757
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Minus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 472 cacttccacgactgctttgtccagggatgcgatgggtcggtg 431
>gb|DR683429.1|DR683429 EST1073505 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAAH09 3' end, mRNA sequence
Length = 752
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 286 atgcacttccatgattgtttcgtcaggggatgcgatgg 323
>gb|DR688117.1|DR688117 EST1078201 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAC089 3' end, mRNA sequence
Length = 427
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 191 catgactgctttgtcaggggctgcgatggctcggtgct 228
||||||||||||||||| || |||||||| || |||||
Sbjct: 258 catgactgctttgtcagaggttgcgatggatctgtgct 295
>gb|DR744454.1|DR744454 RTCU1_22_C07.g1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_22_C07_A029 5', mRNA sequence
Length = 746
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 272 cacttccacgactgctttgtccagggatgcgatgggtcggtg 313
>gb|DT631437.1|DT631437 EST1146368 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMF876 3' end, mRNA sequence
Length = 933
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 182 atgcacttccatgactgctttgtcaggggctgcgatgg 219
|||||||||||||| || || |||||||| ||||||||
Sbjct: 294 atgcacttccatgattgtttcgtcaggggatgcgatgg 331
>gb|DT634565.1|DT634565 EST1149496 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMG736 3' end, mRNA sequence
Length = 739
Score = 44.1 bits (22), Expect = 0.015
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 191 catgactgctttgtcaggggctgcgatggctcggtgct 228
||||||||||||||||| || |||||||| || |||||
Sbjct: 266 catgactgctttgtcagaggttgcgatggatctgtgct 303
>dbj|BD224564.1| Materials and methods for the modification of plant lignin content
Length = 1522
Score = 44.1 bits (22), Expect = 0.015
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 185 cacttccatgactgctttgtcaggggctgcgatggctcggtg 226
|||||||| |||||||||||| ||| |||||||| ||||||
Sbjct: 296 cacttccacgactgctttgtccagggatgcgatgggtcggtg 337
>gb|AL751213.1|AL751213 AL751213 RS Pinus pinaster cDNA clone RS06C12 similar to
PEROXIDASE, mRNA sequence
Length = 709
Score = 42.1 bits (21), Expect = 0.057
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 183 tgcacttccatgactgctttgtcaggggctgcgatgg 219
|||| |||||||| || ||||||||||| ||||||||
Sbjct: 1 tgcatttccatgattgttttgtcaggggatgcgatgg 37
>gb|AL751293.1|AL751293 AL751293 RS Pinus pinaster cDNA clone RS07B11 similar to
PEROXIDASE, mRNA sequence
Length = 706
Score = 42.1 bits (21), Expect = 0.057
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 183 tgcacttccatgactgctttgtcaggggctgcgatgg 219
|||| |||||||| || ||||||||||| ||||||||
Sbjct: 1 tgcatttccatgattgttttgtcaggggatgcgatgg 37
>gb|CF474883.1|CF474883 RTWW2_8_F04.g1_A021 Well-watered loblolly pine roots WW2 Pinus
taeda cDNA clone RTWW2_8_F04_A021 5', mRNA sequence
Length = 719
Score = 42.1 bits (21), Expect = 0.057
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 183 tgcacttccatgactgctttgtcaggggctgcgatgg 219
||||||||||||| ||||| |||| |||||||||||
Sbjct: 172 tgcacttccatgattgcttcgtcaacggctgcgatgg 208
>gb|CO159581.1|CO159581 FLD1_14_B02.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_14_B02_A029 5', mRNA sequence
Length = 757
Score = 42.1 bits (21), Expect = 0.057
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 183 tgcacttccatgactgctttgtcaggggctgcgatgg 219
||||||||||||| ||||| |||| |||||||||||
Sbjct: 210 tgcacttccatgattgcttcgtcaacggctgcgatgg 246
>gb|CO167878.1|CO167878 FLD1_71_G07.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_71_G07_A029 5', mRNA sequence
Length = 710
Score = 42.1 bits (21), Expect = 0.057
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 183 tgcacttccatgactgctttgtcaggggctgcgatgg 219
||||||||||||| ||||| |||| |||||||||||
Sbjct: 204 tgcacttccatgattgcttcgtcaacggctgcgatgg 240
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 127,799
Number of Sequences: 355925
Number of extensions: 127799
Number of successful extensions: 33976
Number of sequences better than 0.5: 56
Number of HSP's better than 0.5 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33874
Number of HSP's gapped (non-prelim): 102
length of query: 1326
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1307
effective length of database: 210,514,662
effective search space: 275142663234
effective search space used: 275142663234
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)