BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8028975.2.1
(595 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF395538.1|CF395538 RTDS2_12_C07.b1_A021 Drought-stresse... 56 2e-006
gb|CF395619.1|CF395619 RTDS2_12_C07.g1_A021 Drought-stresse... 56 2e-006
gb|CF671007.1|CF671007 RTCNT1_54_C08.b1_A029 Root control P... 56 2e-006
gb|CF671078.1|CF671078 RTCNT1_54_C08.g1_A029 Root control P... 56 2e-006
gb|CO158387.1|CO158387 FLD1_6_C10.g1_A029 Root flooded Pinu... 56 2e-006
gb|CO198875.1|CO198875 GEO1_17_E10.b1_A029 Root gravitropis... 56 2e-006
gb|CO198952.1|CO198952 GEO1_17_E10.g1_A029 Root gravitropis... 56 2e-006
gb|CO361728.1|CO361728 NDL2_6_E01.g1_A029 Needles control 2... 56 2e-006
gb|CO361739.1|CO361739 NDL2_6_F01.g1_A029 Needles control 2... 56 2e-006
gb|CV031923.1|CV031923 RTNACL1_4_D03.g1_A029 Roots plus add... 56 2e-006
gb|DR098106.1|DR098106 STRR1_39_D06.b1_A033 Stem Response R... 56 2e-006
gb|DR098180.1|DR098180 STRR1_39_D06.g1_A033 Stem Response R... 56 2e-006
gb|DR024916.1|DR024916 STRS1_68_H05.b1_A034 Shoot tip pitch... 48 4e-004
gb|AL749587.1|AL749587 AL749587 AN Pinus pinaster cDNA clon... 38 0.40
gb|AL749639.1|AL749639 AL749639 AN Pinus pinaster cDNA clon... 38 0.40
gb|DR070106.1|DR070106 RTDK1_11_G05.b1_A029 Roots, dark Pin... 38 0.40
>gb|CF395538.1|CF395538 RTDS2_12_C07.b1_A021 Drought-stressed loblolly pine roots DS2
Pinus taeda cDNA clone RTDS2_12_C07_A021 3', mRNA
sequence
Length = 590
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 9 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 64
>gb|CF395619.1|CF395619 RTDS2_12_C07.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_12_C07_A021 5', mRNA sequence
Length = 755
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 671 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 726
>gb|CF671007.1|CF671007 RTCNT1_54_C08.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_54_C08_A029 3', mRNA sequence
Length = 584
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 3 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 58
>gb|CF671078.1|CF671078 RTCNT1_54_C08.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_54_C08_A029 5', mRNA sequence
Length = 676
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 75 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 130
>gb|CO158387.1|CO158387 FLD1_6_C10.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_6_C10_A029 5', mRNA sequence
Length = 802
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 223 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 278
>gb|CO198875.1|CO198875 GEO1_17_E10.b1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_17_E10_A029 3', mRNA sequence
Length = 661
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 80 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 135
>gb|CO198952.1|CO198952 GEO1_17_E10.g1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_17_E10_A029 5', mRNA sequence
Length = 800
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 718 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 773
>gb|CO361728.1|CO361728 NDL2_6_E01.g1_A029 Needles control 2 Pinus taeda cDNA clone
NDL2_6_E01_A029 5', mRNA sequence
Length = 761
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 563 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 618
>gb|CO361739.1|CO361739 NDL2_6_F01.g1_A029 Needles control 2 Pinus taeda cDNA clone
NDL2_6_F01_A029 5', mRNA sequence
Length = 823
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 563 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 618
>gb|CV031923.1|CV031923 RTNACL1_4_D03.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_4_D03_A029 5', mRNA sequence
Length = 745
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 512 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 457
>gb|DR098106.1|DR098106 STRR1_39_D06.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_39_D06_A033 3', mRNA sequence
Length = 667
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 144 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 89
>gb|DR098180.1|DR098180 STRR1_39_D06.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_39_D06_A033 5', mRNA sequence
Length = 632
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||||| |||||||| || || || || |||| ||||||||||||
Sbjct: 550 tatgtggggattgaagtctggcaggtgaaggcaggctcggtttatgacaacatttt 495
>gb|DR024916.1|DR024916 STRS1_68_H05.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_68_H05_A034 3', mRNA sequence
Length = 652
Score = 48.1 bits (24), Expect = 4e-004
Identities = 48/56 (85%)
Strand = Plus / Plus
Query: 5 tatgtggggattgaagtatggcaggtcaaagctggttcagtttttgacaacatttt 60
||||||||||||||| | |||||||| || || || || |||| ||||||||||||
Sbjct: 71 tatgtggggattgaattctggcaggtgaaggcaggctcggtttatgacaacatttt 126
>gb|AL749587.1|AL749587 AL749587 AN Pinus pinaster cDNA clone AN02A07 similar to NUCELLIN,
mRNA sequence
Length = 547
Score = 38.2 bits (19), Expect = 0.40
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 292 ccatgacgagctatagatcctgt 314
||||||||||| |||||||||||
Sbjct: 235 ccatgacgagcaatagatcctgt 213
>gb|AL749639.1|AL749639 AL749639 AN Pinus pinaster cDNA clone AN05B02 similar to NUCELLIN,
mRNA sequence
Length = 696
Score = 38.2 bits (19), Expect = 0.40
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 292 ccatgacgagctatagatcctgt 314
||||||||||| |||||||||||
Sbjct: 233 ccatgacgagcaatagatcctgt 211
>gb|DR070106.1|DR070106 RTDK1_11_G05.b1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_11_G05_A029 3', mRNA sequence
Length = 756
Score = 38.2 bits (19), Expect = 0.40
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 292 ccatgacgagctatagatcctgt 314
||||||||||| |||||||||||
Sbjct: 486 ccatgacgagcaatagatcctgt 508
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 80,511
Number of Sequences: 355925
Number of extensions: 80511
Number of successful extensions: 24454
Number of sequences better than 0.5: 16
Number of HSP's better than 0.5 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24438
Number of HSP's gapped (non-prelim): 16
length of query: 595
length of database: 217,277,237
effective HSP length: 19
effective length of query: 576
effective length of database: 210,514,662
effective search space: 121256445312
effective search space used: 121256445312
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)