BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3748535.2.1
         (619 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CX645971.1|CX645971  COLD1_6_A08.g1_A029 Root cold Pinus ...    48   4e-004
gb|DR098181.1|DR098181  STRR1_39_D08.g1_A033 Stem Response R...    48   4e-004
gb|DR118894.1|DR118894  RTMG1_19_G09.g1_A029 Roots minus mag...    48   4e-004
gb|DR686435.1|DR686435  EST1076513 Normalized pine embryo li...    48   4e-004
gb|DR693591.1|DR693591  EST1083680 Normalized pine embryo li...    48   4e-004
gb|DT633502.1|DT633502  EST1148433 Normalized pine embryo li...    48   4e-004
gb|DR691945.1|DR691945  EST1082032 Normalized pine embryo li...    44   0.007
gb|DT636879.1|DT636879  EST1151810 Normalized pine embryo li...    44   0.007

>gb|CX645971.1|CX645971 COLD1_6_A08.g1_A029 Root cold Pinus taeda cDNA clone
           COLD1_6_A08_A029 5', mRNA sequence
          Length = 691

 Score = 48.1 bits (24), Expect = 4e-004
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 545 tatgcaatacaggctacatgtcatgcaccagatgca 580
           ||||||||  ||||||| ||||||||||||||||||
Sbjct: 263 tatgcaattgaggctacctgtcatgcaccagatgca 298



>gb|DR098181.1|DR098181 STRR1_39_D08.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
           STRR1_39_D08_A033 5', mRNA sequence
          Length = 741

 Score = 48.1 bits (24), Expect = 4e-004
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 545 tatgcaatacaggctacatgtcatgcaccagatgca 580
           ||||||||  ||||||| ||||||||||||||||||
Sbjct: 31  tatgcaattgaggctacctgtcatgcaccagatgca 66



>gb|DR118894.1|DR118894 RTMG1_19_G09.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
           RTMG1_19_G09_A029 5', mRNA sequence
          Length = 578

 Score = 48.1 bits (24), Expect = 4e-004
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 545 tatgcaatacaggctacatgtcatgcaccagatgca 580
           ||||||||  ||||||| ||||||||||||||||||
Sbjct: 67  tatgcaattgaggctacctgtcatgcaccagatgca 102



>gb|DR686435.1|DR686435 EST1076513 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWABG04 3' end, mRNA sequence
          Length = 808

 Score = 48.1 bits (24), Expect = 4e-004
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 545 tatgcaatacaggctacatgtcatgcaccagatgca 580
           ||||||||  ||||||| ||||||||||||||||||
Sbjct: 750 tatgcaattgaggctacctgtcatgcaccagatgca 785



>gb|DR693591.1|DR693591 EST1083680 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAE147 3' end, mRNA sequence
          Length = 733

 Score = 48.1 bits (24), Expect = 4e-004
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 545 tatgcaatacaggctacatgtcatgcaccagatgca 580
           ||||||||  ||||||| ||||||||||||||||||
Sbjct: 445 tatgcaattgaggctacctgtcatgcaccagatgca 480



>gb|DT633502.1|DT633502 EST1148433 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMFV57 3' end, mRNA sequence
          Length = 857

 Score = 48.1 bits (24), Expect = 4e-004
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 545 tatgcaatacaggctacatgtcatgcaccagatgca 580
           ||||||||  ||||||| ||||||||||||||||||
Sbjct: 759 tatgcaattgaggctacctgtcatgcaccagatgca 794



>gb|DR691945.1|DR691945 EST1082032 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWADG12 3' end, mRNA sequence
          Length = 832

 Score = 44.1 bits (22), Expect = 0.007
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 555 aggctacatgtcatgcaccagatgca 580
           ||||||| ||||||||||||||||||
Sbjct: 514 aggctacctgtcatgcaccagatgca 539



>gb|DT636879.1|DT636879 EST1151810 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMGX11 3' end, mRNA sequence
          Length = 829

 Score = 44.1 bits (22), Expect = 0.007
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 555 aggctacatgtcatgcaccagatgca 580
           ||||||| ||||||||||||||||||
Sbjct: 522 aggctacctgtcatgcaccagatgca 547



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 68,498
Number of Sequences: 355925
Number of extensions: 68498
Number of successful extensions: 18785
Number of sequences better than  0.5: 8
Number of HSP's better than  0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18770
Number of HSP's gapped (non-prelim): 15
length of query: 619
length of database: 217,277,237
effective HSP length: 19
effective length of query: 600
effective length of database: 210,514,662
effective search space: 126308797200
effective search space used: 126308797200
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)