BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3748380.2.1
(1272 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW010398.1|AW010398 ST06D02 Pine TriplEx shoot tip libra... 72 6e-011
gb|BQ290846.1|BQ290846 NXRV050_D03_F NXRV (Nsf Xylem Root w... 72 6e-011
gb|BQ654531.1|BQ654531 NXRV081_H04_F NXRV (Nsf Xylem Root w... 72 6e-011
gb|U76726.1|PRU76726 Pinus radiata MADS-box protein (PrMADS... 64 2e-008
gb|U42400.1|PRU42400 Pinus radiata putative MADS-box family... 58 9e-007
emb|Y09611.1|PRMADS1 P.resinosa mRNA for MADS-box protein 58 9e-007
gb|CF476348.1|CF476348 RTWW2_22_G12.g1_A021 Well-watered lo... 50 2e-004
gb|CV033251.1|CV033251 RTNACL1_33_G03.b1_A029 Roots plus ad... 50 2e-004
gb|CX645838.1|CX645838 COLD1_5_D01.g1_A029 Root cold Pinus ... 50 2e-004
gb|DR177222.1|DR177222 RTMNUT1_3_H10.g1_A029 Roots minus mi... 50 2e-004
gb|U90346.1|PRU90346 Pinus radiata putative MADS box transc... 50 2e-004
gb|CV033324.1|CV033324 RTNACL1_33_G03.g1_A029 Roots plus ad... 48 9e-004
gb|AW010611.1|AW010611 ST08G08 Pine TriplEx shoot tip libra... 46 0.004
gb|BM134188.1|BM134188 NXLV_017_H01_F NXLV (Nsf Xylem Late ... 44 0.014
gb|CF386447.1|CF386447 RTDR1_14_B10.g1_A015 Loblolly pine r... 44 0.014
gb|CO361066.1|CO361066 NDL2_2_B04.g1_A029 Needles control 2... 44 0.014
gb|CF394057.1|CF394057 RTDS2_3_D04.b1_A021 Drought-stressed... 42 0.055
gb|CF668263.1|CF668263 RTCNT1_35_A03.g1_A029 Root control P... 42 0.055
gb|CO200411.1|CO200411 GEO2_7_G03.b1_A032 Root gravitropism... 42 0.055
gb|CO200495.1|CO200495 GEO2_7_G03.g1_A032 Root gravitropism... 42 0.055
gb|CO201105.1|CO201105 RTCNT2_3_D12.g1_A029 Root control 2 ... 42 0.055
gb|CO364847.1|CO364847 RTK1_22_D10.b1_A029 Roots minus pota... 42 0.055
gb|CV031753.1|CV031753 RTNACL1_3_B05.g1_A029 Roots plus add... 42 0.055
gb|DR058437.1|DR058437 RTNIT1_11_F11.g1_A029 Roots minus ni... 42 0.055
gb|DR178004.1|DR178004 RTMNUT1_8_E05.g1_A029 Roots minus mi... 42 0.055
gb|CF388137.1|CF388137 RTDR2_1_D05.b1_A021 Loblolly pine ro... 40 0.22
gb|CF389852.1|CF389852 RTDR2_11_B08.b1_A021 Loblolly pine r... 40 0.22
gb|CF389963.1|CF389963 RTDR2_11_B08.g1_A021 Loblolly pine r... 40 0.22
gb|CO161503.1|CO161503 FLD1_29_F09.b1_A029 Root flooded Pin... 40 0.22
gb|CO161575.1|CO161575 FLD1_29_F09.g1_A029 Root flooded Pin... 40 0.22
gb|CX713803.1|CX713803 RTPQ1_13_F12.b1_A032 Roots treated w... 40 0.22
gb|DR013883.1|DR013883 HEAT1_22_D05.b1_A029 Root at 37 C fo... 40 0.22
>gb|AW010398.1|AW010398 ST06D02 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST06D02, mRNA sequence
Length = 647
Score = 71.9 bits (36), Expect = 6e-011
Identities = 72/84 (85%)
Strand = Plus / Minus
Query: 1102 ctcgtgcgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccggtttat 1161
||||| ||||||||||||||| ||||||||||||||||| || || || || || |||||
Sbjct: 125 ctcgtacgccttcttcagcagtccgttccggcgcttggaaaacgtaacttgtcgatttat 66
Query: 1162 cttgttctctatccgcttcagctg 1185
||||| ||||| ||| |||||||
Sbjct: 65 tttgttttctattcgcctcagctg 42
>gb|BQ290846.1|BQ290846 NXRV050_D03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV050_D03 5' similar to Arabidopsis thaliana
sequence At5g15800 transcription factor (AGL2) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 546
Score = 71.9 bits (36), Expect = 6e-011
Identities = 72/84 (85%)
Strand = Plus / Minus
Query: 1102 ctcgtgcgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccggtttat 1161
||||| ||||||||||||||| ||||||||||||||||| || || || || || |||||
Sbjct: 186 ctcgtacgccttcttcagcagtccgttccggcgcttggaaaacgtaacttgtcgatttat 127
Query: 1162 cttgttctctatccgcttcagctg 1185
||||| ||||| ||| |||||||
Sbjct: 126 tttgttttctattcgcctcagctg 103
>gb|BQ654531.1|BQ654531 NXRV081_H04_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV081_H04 5' similar to Arabidopsis thaliana
sequence At5g15800 transcription factor (AGL2) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 436
Score = 71.9 bits (36), Expect = 6e-011
Identities = 72/84 (85%)
Strand = Plus / Minus
Query: 1102 ctcgtgcgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccggtttat 1161
||||| ||||||||||||||| ||||||||||||||||| || || || || || |||||
Sbjct: 163 ctcgtacgccttcttcagcagtccgttccggcgcttggaaaacgtaacttgtcgatttat 104
Query: 1162 cttgttctctatccgcttcagctg 1185
||||| ||||| ||| |||||||
Sbjct: 103 tttgttttctattcgcctcagctg 80
>gb|U76726.1|PRU76726 Pinus radiata MADS-box protein (PrMADS3) mRNA, complete cds
Length = 1130
Score = 63.9 bits (32), Expect = 2e-008
Identities = 71/84 (84%)
Strand = Plus / Minus
Query: 1102 ctcgtgcgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccggtttat 1161
||||| ||||||||||||||| |||||||||||||| || || || || || || |||||
Sbjct: 102 ctcgtacgccttcttcagcagtccgttccggcgcttcgaaaacgtgacttgtcgatttat 43
Query: 1162 cttgttctctatccgcttcagctg 1185
||||| ||||| ||| |||||||
Sbjct: 42 tttgttttctattcgcctcagctg 19
>gb|U42400.1|PRU42400 Pinus radiata putative MADS-box family transcription factor (PrMADS2)
mRNA, complete cds
Length = 1064
Score = 58.0 bits (29), Expect = 9e-007
Identities = 65/77 (84%)
Strand = Plus / Minus
Query: 1108 cgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccggtttatcttgtt 1167
|||||| |||||||| || |||||||| || || || || ||||| ||||| ||||| ||
Sbjct: 190 cgcctttttcagcagaccattccggcgtttcgaaaacgtgacctggcggttaatcttatt 131
Query: 1168 ctctatccgcttcagct 1184
||| |||||||||||||
Sbjct: 130 ctcgatccgcttcagct 114
>emb|Y09611.1|PRMADS1 P.resinosa mRNA for MADS-box protein
Length = 1073
Score = 58.0 bits (29), Expect = 9e-007
Identities = 65/77 (84%)
Strand = Plus / Minus
Query: 1108 cgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccggtttatcttgtt 1167
|||||| |||||||| || |||||||| || || || || ||||| ||||| ||||| ||
Sbjct: 171 cgcctttttcagcagaccattccggcgtttcgaaaacgtgacctgacggttaatcttatt 112
Query: 1168 ctctatccgcttcagct 1184
||| |||||||||||||
Sbjct: 111 ctcgatccgcttcagct 95
>gb|CF476348.1|CF476348 RTWW2_22_G12.g1_A021 Well-watered loblolly pine roots WW2 Pinus taeda
cDNA clone RTWW2_22_G12_A021 5', mRNA sequence
Length = 757
Score = 50.1 bits (25), Expect = 2e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 1102 ctcgtgcgccttcttcagcagcccgttccggcgcttggagaaggtcacctgcc 1154
|||| |||||||||||||||||||||| || ||||| || || || |||||||
Sbjct: 358 ctcgcgcgccttcttcagcagcccgttgcgccgctttgaaaaagtgacctgcc 306
>gb|CV033251.1|CV033251 RTNACL1_33_G03.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_33_G03_A029 3', mRNA sequence
Length = 839
Score = 50.1 bits (25), Expect = 2e-004
Identities = 75/92 (81%)
Strand = Plus / Minus
Query: 1058 gagaagacgatgacggcgacctcggcgtcgcagaggacggagatctcgtgcgccttcttc 1117
|||||||||||||| ||||| || |||||||| || || || | ||| | ||| ||||||
Sbjct: 98 gagaagacgatgaccgcgacttctgcgtcgcanagcacagacagctcatacgctttcttc 39
Query: 1118 agcagcccgttccggcgcttggagaaggtcac 1149
| ||| ||||| || ||| ||||||| |||||
Sbjct: 38 aacagaccgtttcgacgcgtggagaaagtcac 7
>gb|CX645838.1|CX645838 COLD1_5_D01.g1_A029 Root cold Pinus taeda cDNA clone COLD1_5_D01_A029
5', mRNA sequence
Length = 705
Score = 50.1 bits (25), Expect = 2e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 1085 tcgcagaggacggagatctcgtgcgccttcttcagcagcccgttccggcgctt 1137
|||||||| || |||| ||||| || ||||||||||||||||| ||||||||
Sbjct: 285 tcgcagagcaccgagagctcgtaagctttcttcagcagcccgttgcggcgctt 233
>gb|DR177222.1|DR177222 RTMNUT1_3_H10.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_3_H10_A029 5', mRNA sequence
Length = 770
Score = 50.1 bits (25), Expect = 2e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 1085 tcgcagaggacggagatctcgtgcgccttcttcagcagcccgttccggcgctt 1137
|||||||| || |||| ||||| || ||||||||||||||||| ||||||||
Sbjct: 298 tcgcagagcaccgagagctcgtaagctttcttcagcagcccgttgcggcgctt 246
>gb|U90346.1|PRU90346 Pinus radiata putative MADS box transcription factor PrMADS5 mRNA,
complete cds
Length = 1301
Score = 50.1 bits (25), Expect = 2e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 1085 tcgcagaggacggagatctcgtgcgccttcttcagcagcccgttccggcgctt 1137
|||||||| || |||| ||||| || ||||||||||||||||| ||||||||
Sbjct: 287 tcgcagagcaccgagagctcgtaagctttcttcagcagcccgttgcggcgctt 235
>gb|CV033324.1|CV033324 RTNACL1_33_G03.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_33_G03_A029 5', mRNA sequence
Length = 796
Score = 48.1 bits (24), Expect = 9e-004
Identities = 75/92 (81%)
Strand = Plus / Minus
Query: 1058 gagaagacgatgacggcgacctcggcgtcgcagaggacggagatctcgtgcgccttcttc 1117
|||||||||||||| ||||| || |||||||| || || || | ||| | ||| ||||||
Sbjct: 314 gagaagacgatgaccgcgacttctgcgtcgcaaagcacagacagctcatacgctttcttc 255
Query: 1118 agcagcccgttccggcgcttggagaaggtcac 1149
| ||| ||||| || ||| ||||||| |||||
Sbjct: 254 aacagaccgtttcgacgcgtggagaaagtcac 223
>gb|AW010611.1|AW010611 ST08G08 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST08G08, mRNA sequence
Length = 927
Score = 46.1 bits (23), Expect = 0.004
Identities = 44/51 (86%)
Strand = Plus / Minus
Query: 1085 tcgcagaggacggagatctcgtgcgccttcttcagcagcccgttccggcgc 1135
|||||||| || |||| ||||| || ||||||||||||||||| ||||||
Sbjct: 219 tcgcagagcaccgagagctcgtaagctttcttcagcagcccgttgcggcgc 169
>gb|BM134188.1|BM134188 NXLV_017_H01_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_017_H01 5' similar to Arabidopsis thaliana
sequence At2g45660 MADS-box protein (AGL20) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 508
Score = 44.1 bits (22), Expect = 0.014
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 1112 ttcttcagcagcccgttccggcgctt 1137
||||||||||||||||| ||||||||
Sbjct: 366 ttcttcagcagcccgttgcggcgctt 341
>gb|CF386447.1|CF386447 RTDR1_14_B10.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_14_B10_A015 5', mRNA
sequence
Length = 821
Score = 44.1 bits (22), Expect = 0.014
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 1112 ttcttcagcagcccgttccggcgctt 1137
||||||||||||||||| ||||||||
Sbjct: 323 ttcttcagcagcccgttgcggcgctt 298
>gb|CO361066.1|CO361066 NDL2_2_B04.g1_A029 Needles control 2 Pinus taeda cDNA clone
NDL2_2_B04_A029 5', mRNA sequence
Length = 840
Score = 44.1 bits (22), Expect = 0.014
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 1112 ttcttcagcagcccgttccggcgctt 1137
||||||||||||||||| ||||||||
Sbjct: 239 ttcttcagcagcccgttgcggcgctt 214
>gb|CF394057.1|CF394057 RTDS2_3_D04.b1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_3_D04_A021 3', mRNA sequence
Length = 611
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1130 cggcgcttggagaaggtcacctgcc 1154
||||||||| |||||||||||||||
Sbjct: 404 cggcgcttgcagaaggtcacctgcc 428
>gb|CF668263.1|CF668263 RTCNT1_35_A03.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_35_A03_A029 5', mRNA sequence
Length = 764
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 1130 cggcgcttggagaaggtcacctgcc 1154
||||||||| |||||||||||||||
Sbjct: 459 cggcgcttgcagaaggtcacctgcc 435
>gb|CO200411.1|CO200411 GEO2_7_G03.b1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_7_G03_A032 3', mRNA sequence
Length = 860
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 1130 cggcgcttggagaaggtcacctgcc 1154
||||||||| |||||||||||||||
Sbjct: 237 cggcgcttgcagaaggtcacctgcc 213
>gb|CO200495.1|CO200495 GEO2_7_G03.g1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_7_G03_A032 5', mRNA sequence
Length = 820
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 1130 cggcgcttggagaaggtcacctgcc 1154
||||||||| |||||||||||||||
Sbjct: 480 cggcgcttgcagaaggtcacctgcc 456
>gb|CO201105.1|CO201105 RTCNT2_3_D12.g1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_3_D12_A029 5', mRNA sequence
Length = 758
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 1130 cggcgcttggagaaggtcacctgcc 1154
||||||||| |||||||||||||||
Sbjct: 266 cggcgcttgcagaaggtcacctgcc 242
>gb|CO364847.1|CO364847 RTK1_22_D10.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_22_D10_A029 3', mRNA sequence
Length = 867
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1130 cggcgcttggagaaggtcacctgcc 1154
||||||||| |||||||||||||||
Sbjct: 574 cggcgcttgcagaaggtcacctgcc 598
>gb|CV031753.1|CV031753 RTNACL1_3_B05.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_3_B05_A029 5', mRNA sequence
Length = 851
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 1130 cggcgcttggagaaggtcacctgcc 1154
||||||||| |||||||||||||||
Sbjct: 252 cggcgcttgcagaaggtcacctgcc 228
>gb|DR058437.1|DR058437 RTNIT1_11_F11.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_11_F11_A029 5', mRNA sequence
Length = 795
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 1130 cggcgcttggagaaggtcacctgcc 1154
||||||||| |||||||||||||||
Sbjct: 274 cggcgcttgcagaaggtcacctgcc 250
>gb|DR178004.1|DR178004 RTMNUT1_8_E05.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_8_E05_A029 5', mRNA sequence
Length = 779
Score = 42.1 bits (21), Expect = 0.055
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 1130 cggcgcttggagaaggtcacctgcc 1154
||||||||| |||||||||||||||
Sbjct: 338 cggcgcttgcagaaggtcacctgcc 314
>gb|CF388137.1|CF388137 RTDR2_1_D05.b1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_1_D05_A021 3', mRNA sequence
Length = 532
Score = 40.1 bits (20), Expect = 0.22
Identities = 41/48 (85%)
Strand = Plus / Plus
Query: 1108 cgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccg 1155
||||||||| |||| ||| || || ||||||||||| ||||| |||||
Sbjct: 338 cgccttctttagcaacccatttcgacgcttggagaaagtcacttgccg 385
>gb|CF389852.1|CF389852 RTDR2_11_B08.b1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_11_B08_A021 3', mRNA
sequence
Length = 685
Score = 40.1 bits (20), Expect = 0.22
Identities = 41/48 (85%)
Strand = Plus / Plus
Query: 1108 cgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccg 1155
||||||||| |||| ||| || || ||||||||||| ||||| |||||
Sbjct: 401 cgccttctttagcaacccatttcgacgcttggagaaagtcacttgccg 448
>gb|CF389963.1|CF389963 RTDR2_11_B08.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_11_B08_A021 5', mRNA
sequence
Length = 791
Score = 40.1 bits (20), Expect = 0.22
Identities = 41/48 (85%)
Strand = Plus / Plus
Query: 1108 cgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccg 1155
||||||||| |||| ||| || || ||||||||||| ||||| |||||
Sbjct: 684 cgccttctttagcaacccatttcgacgcttggagaaagtcacttgccg 731
>gb|CO161503.1|CO161503 FLD1_29_F09.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_29_F09_A029 3', mRNA sequence
Length = 896
Score = 40.1 bits (20), Expect = 0.22
Identities = 41/48 (85%)
Strand = Plus / Minus
Query: 1108 cgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccg 1155
||||||||| |||| ||| || || ||||||||||| ||||| |||||
Sbjct: 282 cgccttctttagcaacccatttcgacgcttggagaaagtcacttgccg 235
>gb|CO161575.1|CO161575 FLD1_29_F09.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_29_F09_A029 5', mRNA sequence
Length = 909
Score = 40.1 bits (20), Expect = 0.22
Identities = 41/48 (85%)
Strand = Plus / Minus
Query: 1108 cgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccg 1155
||||||||| |||| ||| || || ||||||||||| ||||| |||||
Sbjct: 285 cgccttctttagcaacccatttcgacgcttggagaaagtcacttgccg 238
>gb|CX713803.1|CX713803 RTPQ1_13_F12.b1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_13_F12_A032 3', mRNA sequence
Length = 586
Score = 40.1 bits (20), Expect = 0.22
Identities = 41/48 (85%)
Strand = Plus / Plus
Query: 1108 cgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccg 1155
||||||||| |||| ||| || || ||||||||||| ||||| |||||
Sbjct: 387 cgccttctttagcaacccatttcgacgcttggagaaagtcacttgccg 434
>gb|DR013883.1|DR013883 HEAT1_22_D05.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_22_D05_A029 3', mRNA sequence
Length = 705
Score = 40.1 bits (20), Expect = 0.22
Identities = 41/48 (85%)
Strand = Plus / Plus
Query: 1108 cgccttcttcagcagcccgttccggcgcttggagaaggtcacctgccg 1155
||||||||| |||| ||| || || ||||||||||| ||||| |||||
Sbjct: 466 cgccttctttagcaacccatttcgacgcttggagaaagtcacttgccg 513
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 167,458
Number of Sequences: 355925
Number of extensions: 167458
Number of successful extensions: 42195
Number of sequences better than 0.5: 32
Number of HSP's better than 0.5 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42131
Number of HSP's gapped (non-prelim): 64
length of query: 1272
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1253
effective length of database: 210,514,662
effective search space: 263774871486
effective search space used: 263774871486
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)