BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3536697.2.1
(651 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BX254051.1|BX254051 BX254051 Pinus pinaster differenciat... 56 2e-006
gb|BX255353.1|BX255353 BX255353 Pinus pinaster differenciat... 56 2e-006
gb|AW758946.1|AW758946 NXNV_095_F06_F Nsf Xylem Normal wood... 56 2e-006
gb|BG317512.1|BG317512 NXPV_002_F10_F NXPV (Nsf Xylem Plani... 56 2e-006
gb|BG526951.1|BG526951 NXPV_057_G05_F NXPV (Nsf Xylem Plani... 56 2e-006
gb|BM492654.1|BM492654 NXRV_029_B09_F NXRV (Nsf Xylem Root ... 56 2e-006
gb|BQ697805.1|BQ697805 NXPV_061_A10_F NXPV (Nsf Xylem Plani... 56 2e-006
gb|BQ700846.1|BQ700846 NXRV112_B12_F NXRV (Nsf Xylem Root w... 56 2e-006
gb|CF479544.1|CF479544 RTWW3_22_G10.g1_A022 Well-watered lo... 56 2e-006
gb|DR056998.1|DR056998 RTNIT1_1_H09.g1_A029 Roots minus nit... 56 2e-006
gb|DR079740.1|DR079740 RTFEPL1_17_F12.b1_A029 Roots plus ad... 56 2e-006
gb|DR092788.1|DR092788 STRR1_4_A12.b1_A033 Stem Response Re... 56 2e-006
gb|DR092855.1|DR092855 STRR1_4_A12.g1_A033 Stem Response Re... 56 2e-006
gb|DR100307.1|DR100307 STRR1_63_E02.b1_A033 Stem Response R... 56 2e-006
gb|DR118566.1|DR118566 RTMG1_17_G05.g1_A029 Roots minus mag... 56 2e-006
gb|DR384279.1|DR384279 RTHG1_1_E12.b1_A029 Roots plus added... 56 2e-006
gb|DR682085.1|DR682085 EST1072160 Normalized pine embryo li... 56 2e-006
gb|DR684272.1|DR684272 EST1074349 Normalized pine embryo li... 56 2e-006
gb|DR691657.1|DR691657 EST1081744 Normalized pine embryo li... 56 2e-006
gb|DT631983.1|DT631983 EST1146914 Normalized pine embryo li... 56 2e-006
gb|AW758792.1|AW758792 NXNV_089_G04_F Nsf Xylem Normal wood... 52 3e-005
gb|AW888189.1|AW888189 NXNV_105_F12_F Nsf Xylem Normal wood... 52 3e-005
gb|BE496383.1|BE496383 NXCI_017_A02_F NXCI (Nsf Xylem Compr... 52 3e-005
gb|BI202802.1|BI202802 NXPV_090_F11_F NXPV (Nsf Xylem Plani... 52 3e-005
gb|BQ654839.1|BQ654839 NXRV086_D03_F NXRV (Nsf Xylem Root w... 52 3e-005
gb|BQ696304.1|BQ696304 NXPV_037_G06_F NXPV (Nsf Xylem Plani... 52 3e-005
gb|BQ696316.1|BQ696316 NXPV_037_H09_F NXPV (Nsf Xylem Plani... 52 3e-005
gb|BQ696619.1|BQ696619 NXPV_043_C09_F NXPV (Nsf Xylem Plani... 52 3e-005
gb|CD025786.1|CD025786 NXSI_081_C08_F NXSI (Nsf Xylem Side ... 52 3e-005
gb|CO367783.1|CO367783 RTK1_36_C12.g1_A029 Roots minus pota... 52 3e-005
gb|DR081469.1|DR081469 RTFEPL1_29_G11.g1_A029 Roots plus ad... 52 3e-005
gb|DR684166.1|DR684166 EST1074243 Normalized pine embryo li... 44 0.007
>gb|BX254051.1|BX254051 BX254051 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP092F08 similar to DTDP GLUCOSE 4,6
DEHYDRATASE, mRNA sequence
Length = 692
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 315 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 370
>gb|BX255353.1|BX255353 BX255353 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP004G08 similar to DTDP GLUCOSE 4,6
DEHYDRATASE, mRNA sequence
Length = 495
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 224 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 279
>gb|AW758946.1|AW758946 NXNV_095_F06_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_095_F06 5' similar to Arabidopsis thaliana
sequence At2g47650 putative nucleotide-sugar dehydratase
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 330
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 99 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 154
>gb|BG317512.1|BG317512 NXPV_002_F10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_002_F10 5' similar to Arabidopsis
thaliana sequence At2g47650 putative nucleotide-sugar
dehydratase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 483
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 326 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 381
>gb|BG526951.1|BG526951 NXPV_057_G05_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_057_G05 5' similar to Arabidopsis
thaliana sequence At2g47650 putative nucleotide-sugar
dehydratase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 609
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 326 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 381
>gb|BM492654.1|BM492654 NXRV_029_B09_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_029_B09 5' similar to Arabidopsis thaliana
sequence At3g62830 dTDP-glucose 4-6-dehydratase homolog
D18 see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 627
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 95 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 150
>gb|BQ697805.1|BQ697805 NXPV_061_A10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_061_A10 5' similar to Arabidopsis
thaliana sequence At3g62830 dTDP-glucose 4-6-dehydratase
homolog D18 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 509
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 326 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 381
>gb|BQ700846.1|BQ700846 NXRV112_B12_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV112_B12 5' similar to Arabidopsis thaliana
sequence At2g47650 putative nucleotide-sugar dehydratase
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 477
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 283 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 338
>gb|CF479544.1|CF479544 RTWW3_22_G10.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_22_G10_A022 5', mRNA sequence
Length = 716
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 284 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 339
>gb|DR056998.1|DR056998 RTNIT1_1_H09.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_1_H09_A029 5', mRNA sequence
Length = 786
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 677 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 622
>gb|DR079740.1|DR079740 RTFEPL1_17_F12.b1_A029 Roots plus added iron Pinus taeda cDNA
clone RTFEPL1_17_F12_A029 3', mRNA sequence
Length = 784
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 6 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 61
>gb|DR092788.1|DR092788 STRR1_4_A12.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_4_A12_A033 3', mRNA sequence
Length = 898
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 653 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 598
>gb|DR092855.1|DR092855 STRR1_4_A12.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_4_A12_A033 5', mRNA sequence
Length = 885
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 736 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 681
>gb|DR100307.1|DR100307 STRR1_63_E02.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_63_E02_A033 3', mRNA sequence
Length = 830
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 178 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 233
>gb|DR118566.1|DR118566 RTMG1_17_G05.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_17_G05_A029 5', mRNA sequence
Length = 479
Score = 56.0 bits (28), Expect = 2e-006
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 24 aaggagcctttgacagtctatggtgatggcaagcagactaggag 67
||||||||||||||||||||||| ||||| || |||||| ||||
Sbjct: 341 aaggagcctttgacagtctatggagatgggaaacagactcggag 384
>gb|DR384279.1|DR384279 RTHG1_1_E12.b1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_1_E12_A029 3', mRNA sequence
Length = 749
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Minus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 639 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 584
>gb|DR682085.1|DR682085 EST1072160 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAA651 3' end, mRNA sequence
Length = 797
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 241 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 296
>gb|DR684272.1|DR684272 EST1074349 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAAQ80 3' end, mRNA sequence
Length = 776
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 604 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 659
>gb|DR691657.1|DR691657 EST1081744 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWADB24 3' end, mRNA sequence
Length = 831
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 544 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 599
>gb|DT631983.1|DT631983 EST1146914 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMFF10 3' end, mRNA sequence
Length = 817
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||| || | ||||||||||||||||||||||| ||||| || |||||
Sbjct: 612 gttgctcaggctttgcgcaaggagcctttgacagtctatggagatgggaaacagac 667
>gb|AW758792.1|AW758792 NXNV_089_G04_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_089_G04 5' similar to Arabidopsis thaliana
sequence At2g47650 putative nucleotide-sugar
dehydratase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 306
Score = 52.0 bits (26), Expect = 3e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 24 aaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||||||||||||||| ||||| || |||||
Sbjct: 4 aaggagcctttgacagtctatggagatgggaaacagac 41
>gb|AW888189.1|AW888189 NXNV_105_F12_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_105_F12 5' similar to Arabidopsis thaliana
sequence At3g62830 dTDP-glucose 4-6-dehydratase homolog
D18 see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 480
Score = 52.0 bits (26), Expect = 3e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 24 aaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||||||||||||||| ||||| || |||||
Sbjct: 20 aaggagcctttgacagtctatggagatgggaaacagac 57
>gb|BE496383.1|BE496383 NXCI_017_A02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_017_A02 5' similar to Arabidopsis
thaliana sequence At2g47650 putative nucleotide-sugar
dehydratase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 567
Score = 52.0 bits (26), Expect = 3e-005
Identities = 71/86 (82%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagactagg 65
||||||||||| ||| | || || ||||||||||| |||||||| || || || || ||
Sbjct: 131 gttgctcaggcactgcgcaaagaacctttgacagtttatggtgacggtaaacaaacacgg 190
Query: 66 agctttcaatatgtctcagatttggt 91
|||||||| ||||| || ||||||||
Sbjct: 191 agctttcagtatgtttctgatttggt 216
>gb|BI202802.1|BI202802 NXPV_090_F11_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_090_F11 5' similar to Arabidopsis
thaliana sequence At3g62830 dTDP-glucose 4-6-dehydratase
homolog D18 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 500
Score = 52.0 bits (26), Expect = 3e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 24 aaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||||||||||||||| ||||| || |||||
Sbjct: 344 aaggagcctttgacagtctatggagatgggaaacagac 381
>gb|BQ654839.1|BQ654839 NXRV086_D03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV086_D03 5' similar to Arabidopsis thaliana
sequence At3g62830 dTDP-glucose 4-6-dehydratase homolog
D18 see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 694
Score = 52.0 bits (26), Expect = 3e-005
Identities = 71/86 (82%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagactagg 65
||||||||||| ||| | || || ||||||||||| |||||||| || || || || ||
Sbjct: 16 gttgctcaggcactgcgcaaagaacctttgacagtttatggtgacggtaaacaaacacgg 75
Query: 66 agctttcaatatgtctcagatttggt 91
|||||||| ||||| || ||||||||
Sbjct: 76 agctttcagtatgtttctgatttggt 101
>gb|BQ696304.1|BQ696304 NXPV_037_G06_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_037_G06 5' similar to Arabidopsis
thaliana sequence At2g47650 putative nucleotide-sugar
dehydratase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 470
Score = 52.0 bits (26), Expect = 3e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 24 aaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||||||||||||||| ||||| || |||||
Sbjct: 344 aaggagcctttgacagtctatggagatgggaaacagac 381
>gb|BQ696316.1|BQ696316 NXPV_037_H09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_037_H09 5' similar to Arabidopsis
thaliana sequence At2g47650 putative nucleotide-sugar
dehydratase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 487
Score = 52.0 bits (26), Expect = 3e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 24 aaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||||||||||||||| ||||| || |||||
Sbjct: 344 aaggagcctttgacagtctatggagatgggaaacagac 381
>gb|BQ696619.1|BQ696619 NXPV_043_C09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_043_C09 5' similar to Arabidopsis
thaliana sequence At2g47650 putative nucleotide-sugar
dehydratase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 508
Score = 52.0 bits (26), Expect = 3e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 24 aaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||||||||||||||| ||||| || |||||
Sbjct: 344 aaggagcctttgacagtctatggagatgggaaacagac 381
>gb|CD025786.1|CD025786 NXSI_081_C08_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_081_C08 5' similar to Arabidopsis thaliana
sequence At3g62830 dTDP-glucose 4-6-dehydratase homolog
D18 see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 180
Score = 52.0 bits (26), Expect = 3e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 24 aaggagcctttgacagtctatggtgatggcaagcagac 61
||||||||||||||||||||||| ||||| || |||||
Sbjct: 110 aaggagcctttgacagtctatggagatgggaaacagac 147
>gb|CO367783.1|CO367783 RTK1_36_C12.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_36_C12_A029 5', mRNA sequence
Length = 792
Score = 52.0 bits (26), Expect = 3e-005
Identities = 71/86 (82%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagactagg 65
||||||||||| ||| | || || ||||||||||| |||||||| || || || || ||
Sbjct: 275 gttgctcaggcactgcgcaaagaacctttgacagtttatggtgacggtaaacaaacacgg 334
Query: 66 agctttcaatatgtctcagatttggt 91
|||||||| ||||| || ||||||||
Sbjct: 335 agctttcagtatgtttctgatttggt 360
>gb|DR081469.1|DR081469 RTFEPL1_29_G11.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_29_G11_A029 5', mRNA sequence
Length = 667
Score = 52.0 bits (26), Expect = 3e-005
Identities = 71/86 (82%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagactagg 65
||||||||||| ||| | || || ||||||||||| |||||||| || || || || ||
Sbjct: 53 gttgctcaggcactgcgcaaagaacctttgacagtttatggtgacggtaaacaaacacgg 112
Query: 66 agctttcaatatgtctcagatttggt 91
|||||||| ||||| || ||||||||
Sbjct: 113 agctttcagtatgtttctgatttggt 138
>gb|DR684166.1|DR684166 EST1074243 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAAP61 3' end, mRNA sequence
Length = 736
Score = 44.1 bits (22), Expect = 0.007
Identities = 70/86 (81%)
Strand = Plus / Plus
Query: 6 gttgctcaggcgctgaggaaggagcctttgacagtctatggtgatggcaagcagactagg 65
||||||||||| ||| | || || ||||||||||| |||||||| || || || || |
Sbjct: 356 gttgctcaggcactgcgcaaagaacctttgacagtttatggtgacggtaaacaaacacgt 415
Query: 66 agctttcaatatgtctcagatttggt 91
|||||||| ||||| || ||||||||
Sbjct: 416 agctttcagtatgtttctgatttggt 441
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 57,055
Number of Sequences: 355925
Number of extensions: 57055
Number of successful extensions: 14571
Number of sequences better than 0.5: 32
Number of HSP's better than 0.5 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14539
Number of HSP's gapped (non-prelim): 32
length of query: 651
length of database: 217,277,237
effective HSP length: 19
effective length of query: 632
effective length of database: 210,514,662
effective search space: 133045266384
effective search space used: 133045266384
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)