BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3438088.2.1
         (615 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BM492367.1|BM492367  NXRV_023_D01_F NXRV (Nsf Xylem Root ...    40   0.10 
gb|BQ700793.1|BQ700793  NXRV111_D08_F NXRV (Nsf Xylem Root w...    38   0.41 
gb|CF392038.1|CF392038  RTDR3_12_E04.g1_A022 Loblolly pine r...    38   0.41 

>gb|BM492367.1|BM492367 NXRV_023_D01_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
           clone NXRV_023_D01 5', mRNA sequence
          Length = 210

 Score = 40.1 bits (20), Expect = 0.10
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 202 ataccataccataccatacc 221
           ||||||||||||||||||||
Sbjct: 87  ataccataccataccatacc 106




 Score = 40.1 bits (20), Expect = 0.10
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 202 ataccataccataccatacc 221
           ||||||||||||||||||||
Sbjct: 82  ataccataccataccatacc 101




 Score = 40.1 bits (20), Expect = 0.10
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 202 ataccataccataccatacc 221
           ||||||||||||||||||||
Sbjct: 77  ataccataccataccatacc 96



>gb|BQ700793.1|BQ700793 NXRV111_D08_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
           clone NXRV111_D08 5' similar to Arabidopsis thaliana
           sequence At5g49720 cellulase homolog OR16pep precursor
           (pir||S71215) see
           http://mips.gsf.de/proj/thal/db/index.html, mRNA
           sequence
          Length = 352

 Score = 38.2 bits (19), Expect = 0.41
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 491 ccacttccaccctcctttgcagc 513
           ||||||||| |||||||||||||
Sbjct: 141 ccacttccatcctcctttgcagc 119



>gb|CF392038.1|CF392038 RTDR3_12_E04.g1_A022 Loblolly pine roots recovering from drought
           DR3 Pinus taeda cDNA clone RTDR3_12_E04_A022 5', mRNA
           sequence
          Length = 699

 Score = 38.2 bits (19), Expect = 0.41
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 250 ccggcggcggcggaggcgaagggaaca 276
           |||||||||||||||| | ||||||||
Sbjct: 395 ccggcggcggcggaggaggagggaaca 421



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 68,318
Number of Sequences: 355925
Number of extensions: 68318
Number of successful extensions: 22524
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22515
Number of HSP's gapped (non-prelim): 9
length of query: 615
length of database: 217,277,237
effective HSP length: 19
effective length of query: 596
effective length of database: 210,514,662
effective search space: 125466738552
effective search space used: 125466738552
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)